Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP029578 Escherichia coli strain DA33135 plasmid pDA33135-70, complete sequence 0 crisprs DEDDh 0 0 0 0
NZ_CP029577 Escherichia coli strain DA33135 plasmid pDA33135-139, complete sequence 0 crisprs RT 0 0 2 0
NZ_CP029576 Escherichia coli strain DA33135 chromosome, complete genome 5 crisprs RT,csa3,cas3,DEDDh,c2c9_V-U4,DinG 0 4 367 0

Results visualization

1. NZ_CP029577
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 27888 : 53034 27 Escherichia_phage(62.5%) protease,transposase NA
DBSCAN-SWA_2 59012 : 110136 44 Escherichia_phage(33.33%) integrase,transposase attL 86088:86108|attR 104755:104775
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP029576
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029576_1 1225737-1225860 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029576_2 1955893-1956016 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029576_3 2676647-2676738 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029576_4 2837083-2837165 Orphan I-F
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029576_5 3684129-3684261 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP029576_5 5.1|3684146|42|NZ_CP029576|PILER-CR 3684146-3684187 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 1 0.976
NZ_CP029576_5 5.2|3684205|40|NZ_CP029576|PILER-CR 3684205-3684244 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 1 0.975
NZ_CP029576_2 2.1|1955936|38|NZ_CP029576|CRISPRCasFinder 1955936-1955973 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP029576_3 3.1|2676673|40|NZ_CP029576|CRISPRCasFinder 2676673-2676712 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 2 0.95
NZ_CP029576_5 5.2|3684205|40|NZ_CP029576|PILER-CR 3684205-3684244 40 NZ_CP034685 Bacillus sp. BD59S plasmid pBTBD59S2, complete sequence 143235-143274 11 0.725

1. spacer 5.1|3684146|42|NZ_CP029576|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.976

tgtcacacgcagataaatccaactttcaatattgttaagctc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
***************************************.**

2. spacer 5.2|3684205|40|NZ_CP029576|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.975

catggcgtagaaaaaagaaattttcaatattgttttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********************************.*******

3. spacer 2.1|1955936|38|NZ_CP029576|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

4. spacer 3.1|2676673|40|NZ_CP029576|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 2, identity: 0.95

gcgctgcgggtcatttttgaaattacctccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
***************.***********.************

5. spacer 5.2|3684205|40|NZ_CP029576|PILER-CR matches to NZ_CP034685 (Bacillus sp. BD59S plasmid pBTBD59S2, complete sequence) position: , mismatch: 11, identity: 0.725

catggcgtagaaaaaagaaattttcaatattgttttatgg-	CRISPR spacer
aacacaatagaaaaaagaaattttcaaccttg-tttatact	Protospacer
 *..  .********************. *** *****.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 19926 24 Burkholderia_virus(42.11%) tail,plate NA
DBSCAN-SWA_2 26576 : 28529 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_3 49753 : 51225 2 Prochlorococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_4 61565 : 62324 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_5 71546 : 72431 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_6 77767 : 82279 4 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_7 91565 : 92609 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_8 110254 : 111622 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_9 115589 : 119600 4 Pseudomonas_phage(50.0%) protease NA
DBSCAN-SWA_10 128303 : 143097 17 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_11 147165 : 148648 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_12 155277 : 158150 2 Micromonas_pusilla_virus(50.0%) protease NA
DBSCAN-SWA_13 162230 : 168869 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_14 174350 : 176240 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_15 181942 : 189738 10 Diadromus_pulchellus_ascovirus(25.0%) NA NA
DBSCAN-SWA_16 207358 : 208504 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_17 214658 : 216953 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_18 236763 : 237729 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_19 250384 : 266532 12 Herpes_simplex_virus(16.67%) tRNA NA
DBSCAN-SWA_20 272832 : 274071 1 Sinorhizobium_phage(100.0%) tRNA NA
DBSCAN-SWA_21 279208 : 280642 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_22 284555 : 285209 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_23 296448 : 308894 11 Ralstonia_phage(16.67%) NA NA
DBSCAN-SWA_24 316736 : 321776 4 Stx_converting_phage(50.0%) NA NA
DBSCAN-SWA_25 329234 : 336553 6 Ostreococcus_tauri_virus(33.33%) NA NA
DBSCAN-SWA_26 342629 : 343514 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_27 365726 : 366899 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_28 413672 : 484519 53 Pseudomonas_phage(18.75%) protease,transposase NA
DBSCAN-SWA_29 490007 : 492176 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_30 498912 : 500178 1 Enterobacteria_phage(100.0%) integrase attL 498164:498178|attR 506755:506769
DBSCAN-SWA_31 522871 : 524026 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_32 532394 : 533303 1 Yersinia_phage(100.0%) NA NA
DBSCAN-SWA_33 539006 : 539684 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_34 553191 : 554424 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_35 562560 : 567033 2 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_36 570838 : 586230 14 Brevibacillus_phage(14.29%) tRNA NA
DBSCAN-SWA_37 610508 : 611264 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_38 615550 : 618045 2 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_39 627676 : 634449 6 Moraxella_phage(33.33%) NA NA
DBSCAN-SWA_40 639926 : 651074 5 Klosneuvirus(25.0%) NA NA
DBSCAN-SWA_41 654945 : 659280 4 Tetraselmis_virus(25.0%) transposase NA
DBSCAN-SWA_42 674435 : 676949 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_43 680314 : 691358 5 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_44 700191 : 702697 3 Pandoravirus(50.0%) tRNA NA
DBSCAN-SWA_45 714274 : 715120 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_46 719888 : 720737 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_47 728269 : 732384 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_48 735780 : 744005 6 Only_Syngen_Nebraska_virus(25.0%) NA NA
DBSCAN-SWA_49 751306 : 752092 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_50 766743 : 768776 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_51 771886 : 775602 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_52 779968 : 787108 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_53 811122 : 812088 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_54 817871 : 823258 5 Pseudomonas_phage(25.0%) tRNA NA
DBSCAN-SWA_55 837999 : 843296 5 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_56 847230 : 851281 4 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_57 856291 : 856774 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_58 870404 : 871475 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_59 877380 : 879954 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_60 885738 : 887037 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_61 892330 : 898413 7 Achromobacter_phage(25.0%) tRNA NA
DBSCAN-SWA_62 904184 : 907926 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_63 911385 : 911646 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_64 915765 : 927074 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_65 932832 : 934362 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_66 944347 : 950685 8 Faustovirus(20.0%) NA NA
DBSCAN-SWA_67 960570 : 961002 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_68 981495 : 987966 7 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_69 994213 : 998215 4 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_70 1005693 : 1006407 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_71 1023648 : 1024599 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_72 1043253 : 1064981 22 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_73 1090519 : 1091254 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_74 1095073 : 1095994 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_75 1099683 : 1107260 4 Ostreococcus_lucimarinus_virus(50.0%) NA NA
DBSCAN-SWA_76 1115623 : 1117794 4 Klebsiella_phage(33.33%) NA NA
DBSCAN-SWA_77 1128743 : 1192291 48 Stx2-converting_phage(38.46%) integrase,transposase attL 1115039:1115058|attR 1196199:1196212
DBSCAN-SWA_78 1209200 : 1210286 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_79 1218822 : 1219959 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_80 1226617 : 1228135 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_81 1232346 : 1233120 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_82 1243790 : 1247018 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_83 1281979 : 1286983 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_84 1290586 : 1295253 5 Oenococcus_phage(50.0%) transposase NA
DBSCAN-SWA_85 1301145 : 1314963 8 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_86 1329886 : 1334729 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_87 1339006 : 1344802 5 Enterobacteria_phage(25.0%) NA NA
DBSCAN-SWA_88 1353570 : 1354188 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_89 1364246 : 1371896 7 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_90 1377650 : 1381951 4 Clostridioides_phage(50.0%) NA NA
DBSCAN-SWA_91 1395339 : 1396197 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_92 1400265 : 1404051 3 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_93 1407745 : 1409266 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_94 1429626 : 1437938 9 Enterobacteria_phage(83.33%) NA NA
DBSCAN-SWA_95 1454876 : 1456910 1 Indivirus(100.0%) tRNA NA
DBSCAN-SWA_96 1467559 : 1471116 4 Paenibacillus_phage(50.0%) NA NA
DBSCAN-SWA_97 1480255 : 1486529 6 Bacillus_phage(50.0%) tRNA NA
DBSCAN-SWA_98 1500300 : 1501653 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_99 1506379 : 1516947 8 Catovirus(40.0%) NA NA
DBSCAN-SWA_100 1521191 : 1527976 6 Synechococcus_phage(25.0%) NA NA
DBSCAN-SWA_101 1533976 : 1550227 15 Enterobacteria_phage(20.0%) NA NA
DBSCAN-SWA_102 1557669 : 1558569 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_103 1564766 : 1565933 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_104 1568975 : 1575202 10 Acidithiobacillus_phage(20.0%) transposase NA
DBSCAN-SWA_105 1586334 : 1587102 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_106 1590613 : 1592416 3 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_107 1596211 : 1598628 3 Stx2-converting_phage(66.67%) transposase NA
DBSCAN-SWA_108 1612994 : 1614847 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_109 1642551 : 1667207 8 Bacillus_phage(40.0%) integrase attL 1629029:1629043|attR 1668764:1668778
DBSCAN-SWA_110 1672397 : 1684766 12 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_111 1700749 : 1701626 2 Helicobacter_phage(50.0%) transposase NA
DBSCAN-SWA_112 1713805 : 1714558 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_113 1726539 : 1728054 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_114 1738141 : 1742410 4 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_115 1746917 : 1748651 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_116 1755138 : 1757189 3 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_117 1761082 : 1769651 10 Bacillus_virus(40.0%) transposase NA
DBSCAN-SWA_118 1773649 : 1775125 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_119 1783181 : 1787650 7 Klebsiella_phage(33.33%) NA NA
DBSCAN-SWA_120 1795145 : 1797194 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_121 1802526 : 1802736 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_122 1808377 : 1809934 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_123 1813796 : 1822678 8 Pandoravirus(33.33%) tRNA NA
DBSCAN-SWA_124 1831645 : 1836222 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_125 1839540 : 1840395 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_126 1849208 : 1853294 4 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_127 1859011 : 1860967 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_128 1865357 : 1866011 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_129 1872774 : 1873995 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_130 1881471 : 1882299 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_131 1888424 : 1890686 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_132 1900057 : 1919652 19 Tupanvirus(22.22%) tRNA NA
DBSCAN-SWA_133 1938070 : 1943154 5 Lake_Baikal_phage(33.33%) NA NA
DBSCAN-SWA_134 1951443 : 1953710 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_135 1959215 : 1968019 9 Orpheovirus(20.0%) NA NA
DBSCAN-SWA_136 1972434 : 1973933 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_137 1980844 : 1982119 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_138 2002201 : 2004013 1 Vaccinia_virus(100.0%) NA NA
DBSCAN-SWA_139 2013908 : 2015210 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_140 2032973 : 2096841 83 Enterobacteria_phage(41.07%) tail,portal,lysis,capsid,transposase,terminase,head,integrase attL 2032886:2032901|attR 2065734:2065749
DBSCAN-SWA_141 2101227 : 2102118 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_142 2105120 : 2105504 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_143 2112247 : 2113666 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_144 2139968 : 2142368 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_145 2145772 : 2147530 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_146 2158775 : 2160320 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_147 2169283 : 2171386 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_148 2176883 : 2177897 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_149 2181526 : 2183488 1 Phage_TP(100.0%) NA NA
DBSCAN-SWA_150 2195338 : 2196287 2 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_151 2200240 : 2204143 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_152 2219118 : 2220108 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_153 2225067 : 2234486 6 Enterobacteria_phage(20.0%) tRNA NA
DBSCAN-SWA_154 2239258 : 2239774 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_155 2256998 : 2258081 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_156 2277423 : 2279441 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_157 2288375 : 2290310 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_158 2298122 : 2298713 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_159 2303622 : 2308914 4 Tupanvirus(33.33%) protease NA
DBSCAN-SWA_160 2317412 : 2320370 2 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_161 2330332 : 2332347 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_162 2341913 : 2348276 7 Citrobacter_phage(33.33%) NA NA
DBSCAN-SWA_163 2357063 : 2358602 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_164 2369724 : 2376002 8 Spodoptera_litura_granulovirus(33.33%) NA NA
DBSCAN-SWA_165 2379138 : 2386929 8 Tupanvirus(25.0%) transposase,integrase,tRNA attL 2374314:2374328|attR 2393606:2393620
DBSCAN-SWA_166 2397114 : 2401773 8 Vibrio_phage(33.33%) integrase attL 2383293:2383306|attR 2400815:2400828
DBSCAN-SWA_167 2420389 : 2421148 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_168 2437065 : 2438753 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_169 2452949 : 2509493 76 Enterobacteria_phage(55.0%) tail,portal,lysis,capsid,transposase,terminase,head,integrase,tRNA attL 2452686:2452701|attR 2514792:2514807
DBSCAN-SWA_170 2514514 : 2564776 68 Escherichia_phage(38.89%) tail,portal,lysis,capsid,holin,terminase,head,integrase attL 2514527:2514541|attR 2564878:2564892
DBSCAN-SWA_171 2568221 : 2571944 4 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_172 2579230 : 2579488 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_173 2591810 : 2593453 2 Streptococcus_virus(50.0%) NA NA
DBSCAN-SWA_174 2596725 : 2597907 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_175 2610263 : 2611205 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_176 2627086 : 2627332 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_177 2631993 : 2632914 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_178 2642221 : 2642755 1 Red_sea_bream_iridovirus(100.0%) NA NA
DBSCAN-SWA_179 2646892 : 2647726 1 Pelagibacter_phage(100.0%) NA NA
DBSCAN-SWA_180 2651117 : 2652485 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_181 2659303 : 2660368 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_182 2674689 : 2676789 3 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_183 2679819 : 2692236 13 Klosneuvirus(20.0%) NA NA
DBSCAN-SWA_184 2703242 : 2703902 1 uncultured_Caudovirales_phage(100.0%) protease NA
DBSCAN-SWA_185 2708136 : 2710191 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_186 2722801 : 2724709 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_187 2732676 : 2744262 9 Bacillus_virus(33.33%) tRNA NA
DBSCAN-SWA_188 2753014 : 2842570 95 Enterobacteria_phage(64.18%) tail,portal,capsid,protease,holin,terminase,head,integrase,plate,tRNA attL 2783351:2783370|attR 2822039:2822058
DBSCAN-SWA_189 2851786 : 2853505 1 Yellowstone_lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_190 2857092 : 2859830 4 Roseobacter_phage(50.0%) NA NA
DBSCAN-SWA_191 2862955 : 2872095 11 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_192 2880662 : 2881865 1 Stx2-converting_phage(100.0%) NA NA
DBSCAN-SWA_193 2893199 : 2895071 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_194 2898286 : 2905170 5 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_195 2910166 : 2915392 7 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_196 2921781 : 2933352 10 Synechococcus_phage(20.0%) NA NA
DBSCAN-SWA_197 2943950 : 2944859 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_198 2951186 : 2952476 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_199 2962738 : 2969314 7 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_200 2973677 : 2977197 4 Klebsiella_phage(33.33%) NA NA
DBSCAN-SWA_201 3013035 : 3013791 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_202 3017714 : 3018506 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_203 3021884 : 3033717 10 Hokovirus(40.0%) NA NA
DBSCAN-SWA_204 3040372 : 3041137 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_205 3045282 : 3047928 2 Escherichia_phage(100.0%) tRNA NA
DBSCAN-SWA_206 3052421 : 3053180 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_207 3056234 : 3058181 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_208 3062806 : 3064471 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_209 3069001 : 3070081 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_210 3078025 : 3081558 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_211 3085690 : 3088273 1 Staphylococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_212 3095283 : 3097723 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_213 3102140 : 3102787 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_214 3116876 : 3118991 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_215 3122096 : 3123919 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_216 3138210 : 3144253 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_217 3155640 : 3157185 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_218 3166754 : 3169898 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_219 3173043 : 3175159 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_220 3183962 : 3188437 7 Enterobacteria_phage(25.0%) tail,integrase,tRNA attL 3181920:3181933|attR 3185228:3185241
DBSCAN-SWA_221 3200671 : 3201817 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_222 3208007 : 3209789 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_223 3220893 : 3221580 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_224 3224836 : 3225514 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_225 3230882 : 3234124 3 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_226 3243686 : 3252144 8 Acanthamoeba_polyphaga_moumouvirus(25.0%) NA NA
DBSCAN-SWA_227 3258982 : 3262132 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_228 3270969 : 3274516 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_229 3277839 : 3278535 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_230 3281675 : 3286722 4 Bacillus_phage(25.0%) protease NA
DBSCAN-SWA_231 3308156 : 3316999 10 uncultured_Mediterranean_phage(60.0%) tRNA NA
DBSCAN-SWA_232 3323950 : 3334048 7 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_233 3338337 : 3339453 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_234 3346868 : 3348026 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_235 3354934 : 3358402 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_236 3361480 : 3363441 2 Micromonas_sp._RCC1109_virus(50.0%) NA NA
DBSCAN-SWA_237 3368851 : 3373131 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_238 3378090 : 3379977 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_239 3387621 : 3388671 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_240 3399792 : 3407357 5 Vibrio_phage(33.33%) integrase,holin attL 3393304:3393317|attR 3408384:3408397
DBSCAN-SWA_241 3417275 : 3420580 4 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_242 3426622 : 3427474 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_243 3444481 : 3445801 2 Pseudomonas_phage(50.0%) integrase attL 3439270:3439283|attR 3455727:3455740
DBSCAN-SWA_244 3451030 : 3458984 5 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_245 3463660 : 3464812 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_246 3469926 : 3473249 4 Clostridioides_phage(50.0%) NA NA
DBSCAN-SWA_247 3477680 : 3481882 5 Bradyrhizobium_phage(33.33%) NA NA
DBSCAN-SWA_248 3492061 : 3493093 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_249 3506051 : 3510167 2 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_250 3518995 : 3519754 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_251 3531333 : 3532758 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_252 3536687 : 3537032 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_253 3542943 : 3543741 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_254 3554125 : 3560931 6 Acanthamoeba_polyphaga_mimivirus(50.0%) tRNA NA
DBSCAN-SWA_255 3571063 : 3571996 1 Sodalis_phage(100.0%) transposase NA
DBSCAN-SWA_256 3575258 : 3577533 3 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_257 3589381 : 3590806 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_258 3603919 : 3604471 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_259 3608717 : 3609761 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_260 3635730 : 3637455 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_261 3648932 : 3649631 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_262 3661455 : 3666878 2 Yellowstone_lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_263 3674655 : 3676616 4 Microcystis_phage(50.0%) NA NA
DBSCAN-SWA_264 3684510 : 3690160 4 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_265 3695663 : 3696812 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_266 3701620 : 3704437 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_267 3710864 : 3723853 11 uncultured_Caudovirales_phage(20.0%) NA NA
DBSCAN-SWA_268 3735510 : 3737624 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_269 3740810 : 3746624 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_270 3753344 : 3754667 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_271 3760744 : 3763620 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_272 3771559 : 3772839 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_273 3776066 : 3781431 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_274 3794016 : 3794571 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_275 3801915 : 3803376 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_276 3813579 : 3815256 2 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_277 3818615 : 3823184 5 Stx2-converting_phage(50.0%) transposase NA
DBSCAN-SWA_278 3845779 : 3847855 1 Acidithiobacillus_phage(100.0%) NA NA
DBSCAN-SWA_279 3850995 : 3852186 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_280 3857064 : 3864246 7 Klebsiella_phage(20.0%) transposase NA
DBSCAN-SWA_281 3874657 : 3876816 3 Stx2-converting_phage(100.0%) transposase NA
DBSCAN-SWA_282 3884376 : 3888195 5 Enterobacteria_phage(100.0%) transposase NA
DBSCAN-SWA_283 3900635 : 3904895 2 Nostoc_phage(50.0%) NA NA
DBSCAN-SWA_284 3908574 : 3909486 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_285 3912753 : 3913773 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_286 3918902 : 3928178 7 Klebsiella_phage(50.0%) tRNA NA
DBSCAN-SWA_287 3938524 : 3944621 6 Paramecium_bursaria_Chlorella_virus(66.67%) NA NA
DBSCAN-SWA_288 3948259 : 3951020 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_289 3955209 : 3961770 6 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_290 4004002 : 4005166 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_291 4009008 : 4022033 11 Lactococcus_phage(20.0%) protease,tRNA NA
DBSCAN-SWA_292 4025948 : 4026494 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_293 4034214 : 4035192 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_294 4040112 : 4040646 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_295 4044850 : 4046834 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_296 4061111 : 4076316 8 Enterobacteria_phage(50.0%) tRNA NA
DBSCAN-SWA_297 4099451 : 4100954 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_298 4105794 : 4106583 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_299 4112186 : 4113736 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_300 4119878 : 4126247 5 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_301 4131492 : 4133640 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_302 4137557 : 4139085 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_303 4148796 : 4150755 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_304 4156879 : 4158229 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_305 4162046 : 4165660 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_306 4175603 : 4177022 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_307 4182421 : 4186550 4 Cronobacter_phage(25.0%) NA NA
DBSCAN-SWA_308 4198670 : 4199279 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_309 4206630 : 4207746 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_310 4232084 : 4235768 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_311 4249547 : 4251137 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_312 4256499 : 4258263 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_313 4266559 : 4274888 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_314 4278883 : 4281936 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_315 4290371 : 4296154 5 Acinetobacter_phage(50.0%) tRNA NA
DBSCAN-SWA_316 4311906 : 4319153 5 Serratia_phage(33.33%) NA NA
DBSCAN-SWA_317 4325966 : 4327520 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_318 4339142 : 4343645 5 Erwinia_phage(50.0%) NA NA
DBSCAN-SWA_319 4355255 : 4360115 5 Feldmannia_irregularis_virus(33.33%) NA NA
DBSCAN-SWA_320 4377732 : 4383959 3 Catovirus(50.0%) NA NA
DBSCAN-SWA_321 4394983 : 4397763 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_322 4411487 : 4413958 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_323 4418079 : 4420866 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_324 4434470 : 4435085 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_325 4443864 : 4447151 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_326 4469145 : 4470654 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_327 4478506 : 4481919 3 Sodalis_phage(50.0%) transposase NA
DBSCAN-SWA_328 4488523 : 4492382 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_329 4503289 : 4504945 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_330 4512952 : 4519096 6 Enterobacteria_phage(40.0%) NA NA
DBSCAN-SWA_331 4523138 : 4528552 4 Indivirus(33.33%) NA NA
DBSCAN-SWA_332 4536148 : 4537795 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_333 4551194 : 4557047 5 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_334 4560215 : 4561208 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_335 4573163 : 4580678 6 Chrysochromulina_ericina_virus(25.0%) NA NA
DBSCAN-SWA_336 4591657 : 4592995 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_337 4603192 : 4610561 8 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_338 4615169 : 4616318 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_339 4620747 : 4632626 12 Cyanophage(16.67%) NA NA
DBSCAN-SWA_340 4641267 : 4642602 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_341 4648852 : 4649890 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_342 4663151 : 4664543 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_343 4668844 : 4673865 4 Bordetella_phage(33.33%) NA NA
DBSCAN-SWA_344 4677883 : 4682446 7 Xanthomonas_phage(25.0%) NA NA
DBSCAN-SWA_345 4698123 : 4707628 9 Synechococcus_phage(16.67%) NA NA
DBSCAN-SWA_346 4729336 : 4733948 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_347 4757996 : 4759538 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_348 4764855 : 4765851 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_349 4769707 : 4771730 3 Macacine_betaherpesvirus(50.0%) transposase NA
DBSCAN-SWA_350 4775384 : 4777718 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_351 4787762 : 4789756 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_352 4838498 : 4839968 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_353 4850642 : 4856051 5 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_354 4865737 : 4868473 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_355 4875911 : 4876718 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_356 4884611 : 4888743 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_357 4891749 : 4894568 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_358 4901047 : 4902530 2 Anomala_cuprea_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_359 4906071 : 4907882 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_360 4916138 : 4918235 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_361 4928564 : 4931012 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_362 4941986 : 4944380 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_363 4957433 : 4961201 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_364 4979672 : 4980509 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_365 4999423 : 5008964 9 Acinetobacter_phage(25.0%) NA NA
DBSCAN-SWA_366 5014534 : 5023101 8 uncultured_Caudovirales_phage(40.0%) NA NA
DBSCAN-SWA_367 5026473 : 5043429 27 Burkholderia_virus(36.84%) integrase,transposase attL 5023357:5023370|attR 5037516:5037529
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage