Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP029571 Acinetobacter baumannii strain DA33098 plasmid pDA33098-71, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP029570 Acinetobacter baumannii strain DA33098 plasmid pDA33098-108, complete sequence 0 crisprs DEDDh 0 0 3 0
NZ_CP029569 Acinetobacter baumannii strain DA33098 chromosome, complete genome 1 crisprs WYL,cas3,csa3,RT,DEDDh 0 0 267 0
NZ_CP029572 Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP029573 Acinetobacter baumannii strain DA33098 plasmid pDA33098-9, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP029570
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 76017 87 Pseudomonas_phage(39.47%) holin,transposase,integrase attL 16173:16194|attR 38721:38742
DBSCAN-SWA_2 79032 : 79407 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_3 83247 : 107986 28 Salmonella_phage(52.63%) portal,terminase,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP029569
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029569_1 1165596-1165681 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 32848 35 Acinetobacter_phage(100.0%) tail,integrase attL 18376:18389|attR 39423:39436
DBSCAN-SWA_2 41172 : 43636 2 Pithovirus(50.0%) NA NA
DBSCAN-SWA_3 52056 : 53439 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_4 71215 : 71785 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_5 75089 : 87824 10 Vibrio_phage(20.0%) NA NA
DBSCAN-SWA_6 92740 : 95791 4 Planktothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_7 103486 : 105971 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_8 111797 : 112811 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_9 127784 : 130872 4 Salicola_phage(33.33%) NA NA
DBSCAN-SWA_10 137044 : 145791 8 Mollivirus(25.0%) protease,tRNA NA
DBSCAN-SWA_11 149555 : 150359 1 Iragoides_fasciata_nucleopolyhedrovirus(100.0%) NA NA
DBSCAN-SWA_12 177945 : 179433 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_13 201764 : 206967 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_14 218441 : 219887 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_15 227376 : 229764 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_16 245495 : 246335 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_17 250897 : 260273 8 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_18 289589 : 291542 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_19 295887 : 298293 2 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_20 308898 : 310611 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_21 328237 : 328708 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_22 335272 : 343198 8 Hokovirus(33.33%) NA NA
DBSCAN-SWA_23 352663 : 358471 4 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_24 374241 : 420037 64 Acinetobacter_phage(92.59%) integrase,capsid attL 374064:374081|attR 423302:423319
DBSCAN-SWA_25 427652 : 428981 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_26 448956 : 451426 5 uncultured_Caudovirales_phage(66.67%) NA NA
DBSCAN-SWA_27 467308 : 468061 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_28 478800 : 479850 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_29 487855 : 497449 7 Faecalibacterium_phage(20.0%) transposase NA
DBSCAN-SWA_30 502776 : 505635 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_31 542894 : 547443 4 uncultured_Mediterranean_phage(25.0%) protease NA
DBSCAN-SWA_32 555327 : 559189 3 Only_Syngen_Nebraska_virus(33.33%) NA NA
DBSCAN-SWA_33 569993 : 570821 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_34 626903 : 628538 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_35 634549 : 640705 5 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_36 659981 : 668177 2 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_37 680698 : 681676 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_38 690824 : 691850 1 Faecalibacterium_phage(100.0%) transposase NA
DBSCAN-SWA_39 706957 : 719182 12 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_40 724066 : 725092 1 Faecalibacterium_phage(100.0%) transposase NA
DBSCAN-SWA_41 738981 : 739422 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_42 742674 : 743169 1 Haemophilus_phage(100.0%) NA NA
DBSCAN-SWA_43 751784 : 756971 3 Leptospira_phage(66.67%) NA NA
DBSCAN-SWA_44 773836 : 780116 5 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_45 807073 : 807859 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_46 828777 : 832203 4 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_47 837556 : 838906 1 Ochrobactrum_phage(100.0%) NA NA
DBSCAN-SWA_48 861025 : 862117 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_49 884604 : 886362 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_50 894995 : 898599 3 Edwardsiella_phage(50.0%) NA NA
DBSCAN-SWA_51 920882 : 926339 4 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_52 929512 : 929785 1 Burkholderia_phage(100.0%) NA NA
DBSCAN-SWA_53 933137 : 938250 6 Lake_Baikal_phage(50.0%) NA NA
DBSCAN-SWA_54 948960 : 955605 5 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_55 960094 : 962680 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_56 974578 : 974881 1 Burkholderia_phage(100.0%) NA NA
DBSCAN-SWA_57 978022 : 980367 3 Pandoravirus(50.0%) tRNA NA
DBSCAN-SWA_58 988404 : 992924 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_59 1009293 : 1015827 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_60 1027854 : 1029021 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_61 1050396 : 1051629 1 Moraxella_phage(100.0%) integrase attL 1043645:1043659|attR 1052061:1052075
DBSCAN-SWA_62 1057616 : 1058360 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_63 1068110 : 1069187 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_64 1081937 : 1082423 1 Fowlpox_virus(100.0%) NA NA
DBSCAN-SWA_65 1088249 : 1091813 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_66 1096696 : 1098283 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_67 1101754 : 1102597 2 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_68 1111853 : 1112648 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_69 1136969 : 1138460 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_70 1146027 : 1148896 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_71 1153115 : 1160300 7 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_72 1163464 : 1173958 12 uncultured_Caudovirales_phage(20.0%) NA NA
DBSCAN-SWA_73 1180202 : 1189284 7 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_74 1205386 : 1206148 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_75 1223520 : 1224723 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_76 1247784 : 1313992 64 Escherichia_phage(33.33%) integrase,transposase,plate attL 1279021:1279080|attR 1316355:1317535
DBSCAN-SWA_77 1317477 : 1317951 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_78 1325359 : 1326292 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_79 1329999 : 1370356 45 Acinetobacter_phage(36.84%) tRNA,transposase,capsid NA
DBSCAN-SWA_80 1385324 : 1387280 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_81 1391940 : 1399856 6 Catovirus(50.0%) NA NA
DBSCAN-SWA_82 1413745 : 1417978 3 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_83 1422323 : 1436765 13 Faecalibacterium_phage(16.67%) tRNA,transposase NA
DBSCAN-SWA_84 1444942 : 1445647 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_85 1449052 : 1450288 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_86 1464718 : 1472681 2 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_87 1476907 : 1477876 1 Faecalibacterium_phage(100.0%) transposase NA
DBSCAN-SWA_88 1482179 : 1486690 4 Dickeya_phage(33.33%) NA NA
DBSCAN-SWA_89 1490570 : 1492160 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_90 1496080 : 1500908 2 Lactobacillus_phage(50.0%) NA NA
DBSCAN-SWA_91 1505701 : 1506538 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_92 1516125 : 1517499 1 Moraxella_phage(100.0%) integrase attL 1510788:1510801|attR 1520239:1520252
DBSCAN-SWA_93 1523115 : 1567367 63 Acinetobacter_phage(98.04%) capsid NA
DBSCAN-SWA_94 1578353 : 1580783 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_95 1607621 : 1613751 5 Hokovirus(50.0%) tRNA NA
DBSCAN-SWA_96 1627025 : 1630343 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_97 1644093 : 1647780 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_98 1658372 : 1667403 8 Synechococcus_phage(25.0%) NA NA
DBSCAN-SWA_99 1675350 : 1675932 1 Raoultella_phage(100.0%) NA NA
DBSCAN-SWA_100 1686734 : 1694649 5 Vibrio_phage(66.67%) holin NA
DBSCAN-SWA_101 1711070 : 1714778 2 Yellowstone_lake_mimivirus(50.0%) transposase NA
DBSCAN-SWA_102 1728132 : 1731729 1 Lactobacillus_virus(100.0%) NA NA
DBSCAN-SWA_103 1741038 : 1745173 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_104 1752469 : 1756718 2 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_105 1761208 : 1764632 2 Cedratvirus(50.0%) NA NA
DBSCAN-SWA_106 1771404 : 1773030 1 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_107 1778006 : 1780645 2 Acanthamoeba_polyphaga_moumouvirus(50.0%) NA NA
DBSCAN-SWA_108 1784771 : 1786140 3 uncultured_Mediterranean_phage(66.67%) NA NA
DBSCAN-SWA_109 1790141 : 1792007 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_110 1796994 : 1797945 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_111 1802269 : 1806298 6 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_112 1810736 : 1816192 6 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_113 1821915 : 1823952 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_114 1843682 : 1844252 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_115 1879665 : 1892815 9 Bacillus_phage(33.33%) transposase NA
DBSCAN-SWA_116 1896318 : 1897161 1 uncultured_marine_virus(100.0%) NA NA
DBSCAN-SWA_117 1908782 : 1909808 1 Faecalibacterium_phage(100.0%) transposase NA
DBSCAN-SWA_118 1923558 : 1924584 1 Faecalibacterium_phage(100.0%) transposase NA
DBSCAN-SWA_119 1939664 : 1940975 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_120 1956930 : 1957410 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_121 1964178 : 1964451 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_122 1978830 : 1980186 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_123 2004498 : 2007270 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_124 2012708 : 2021428 10 Streptomyces_phage(25.0%) tRNA NA
DBSCAN-SWA_125 2024929 : 2029449 3 Agrobacterium_phage(33.33%) tRNA NA
DBSCAN-SWA_126 2033375 : 2034809 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_127 2039415 : 2045552 4 Streptococcus_phi-m46.1-like_phage(33.33%) NA NA
DBSCAN-SWA_128 2058684 : 2059449 1 Pandoravirus(100.0%) tRNA NA
DBSCAN-SWA_129 2065801 : 2067394 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_130 2071939 : 2086225 10 Bacillus_phage(20.0%) tRNA NA
DBSCAN-SWA_131 2089538 : 2092072 4 Diachasmimorpha_longicaudata_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_132 2102582 : 2104118 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_133 2113600 : 2114893 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_134 2118979 : 2124021 5 Powai_lake_megavirus(50.0%) NA NA
DBSCAN-SWA_135 2127827 : 2129093 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_136 2143070 : 2145091 2 Bacillus_virus(50.0%) protease NA
DBSCAN-SWA_137 2149369 : 2150053 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_138 2154798 : 2155425 1 Cassava_brown_streak_virus(100.0%) NA NA
DBSCAN-SWA_139 2165743 : 2167140 2 Geobacillus_virus(50.0%) NA NA
DBSCAN-SWA_140 2178265 : 2190743 11 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_141 2211574 : 2213869 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_142 2237629 : 2244157 9 Ostreococcus_lucimarinus_virus(33.33%) NA NA
DBSCAN-SWA_143 2261896 : 2262853 1 Megavirus(100.0%) NA NA
DBSCAN-SWA_144 2269578 : 2275119 2 Brevibacillus_phage(50.0%) NA NA
DBSCAN-SWA_145 2283598 : 2289095 4 Ostreococcus_mediterraneus_virus(50.0%) NA NA
DBSCAN-SWA_146 2297517 : 2300217 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_147 2320651 : 2321506 1 Acanthamoeba_polyphaga_mimivirus(100.0%) NA NA
DBSCAN-SWA_148 2326473 : 2328577 2 Faecalibacterium_phage(50.0%) transposase NA
DBSCAN-SWA_149 2339432 : 2341352 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_150 2344429 : 2355423 6 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_151 2359397 : 2366550 5 Cedratvirus(33.33%) NA NA
DBSCAN-SWA_152 2392840 : 2393761 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_153 2399520 : 2403678 3 Hokovirus(50.0%) NA NA
DBSCAN-SWA_154 2407680 : 2415720 9 Staphylococcus_phage(40.0%) NA NA
DBSCAN-SWA_155 2419798 : 2420602 1 Hepacivirus(100.0%) NA NA
DBSCAN-SWA_156 2424810 : 2430553 4 uncultured_Caudovirales_phage(66.67%) NA NA
DBSCAN-SWA_157 2434292 : 2435003 1 Vibriophage(100.0%) transposase NA
DBSCAN-SWA_158 2442243 : 2453349 10 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_159 2458464 : 2460843 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_160 2464988 : 2465915 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_161 2477621 : 2481200 4 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_162 2495651 : 2496440 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_163 2501979 : 2503770 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_164 2508851 : 2510420 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_165 2514567 : 2515410 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_166 2524350 : 2536863 8 Tupanvirus(25.0%) NA NA
DBSCAN-SWA_167 2539954 : 2541604 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_168 2579004 : 2580021 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_169 2583060 : 2583936 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_170 2588162 : 2591452 3 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_171 2596053 : 2602489 5 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_172 2625212 : 2626013 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_173 2629980 : 2632818 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_174 2644600 : 2644936 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_175 2648931 : 2660007 10 Tupanvirus(20.0%) NA NA
DBSCAN-SWA_176 2665842 : 2672625 7 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_177 2677156 : 2677669 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_178 2683658 : 2685599 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_179 2689670 : 2691432 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_180 2703446 : 2704409 1 Prochlorococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_181 2709977 : 2711273 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_182 2720051 : 2721164 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_183 2724575 : 2729306 6 Indivirus(50.0%) NA NA
DBSCAN-SWA_184 2733406 : 2741646 11 Moraxella_phage(20.0%) NA NA
DBSCAN-SWA_185 2753910 : 2755023 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_186 2758715 : 2760254 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_187 2767651 : 2774366 7 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_188 2779357 : 2790718 10 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_189 2800314 : 2805662 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_190 2810542 : 2812426 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_191 2824894 : 2825806 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_192 2841475 : 2842168 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_193 2849386 : 2860952 9 Faecalibacterium_phage(25.0%) transposase NA
DBSCAN-SWA_194 2866650 : 2868600 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_195 2873925 : 2877423 1 Ectocarpus_siliculosus_virus(100.0%) NA NA
DBSCAN-SWA_196 2880683 : 2889176 4 Vibrio_phage(33.33%) holin NA
DBSCAN-SWA_197 2892855 : 2896082 3 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_198 2899563 : 2902512 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_199 2926138 : 2929850 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_200 2944916 : 2947156 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_201 2953884 : 2957121 2 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_202 3000859 : 3001450 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_203 3008646 : 3011940 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_204 3030921 : 3032154 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_205 3036326 : 3040512 3 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_206 3050926 : 3052141 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_207 3078749 : 3079352 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_208 3082922 : 3085992 3 Catovirus(50.0%) NA NA
DBSCAN-SWA_209 3089652 : 3090234 1 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_210 3103796 : 3105344 1 Klebsiella_phage(100.0%) NA NA
DBSCAN-SWA_211 3130742 : 3135363 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_212 3149890 : 3154700 3 Pseudomonas_phage(50.0%) tRNA NA
DBSCAN-SWA_213 3172241 : 3173144 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_214 3179542 : 3179971 1 Pseudomonas_phage(100.0%) protease NA
DBSCAN-SWA_215 3191761 : 3194555 3 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_216 3204469 : 3205804 2 Archaeal_BJ1_virus(50.0%) NA NA
DBSCAN-SWA_217 3213770 : 3219576 5 uncultured_Mediterranean_phage(66.67%) tRNA NA
DBSCAN-SWA_218 3223139 : 3229946 5 Faecalibacterium_phage(33.33%) transposase NA
DBSCAN-SWA_219 3243682 : 3245461 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_220 3260012 : 3263491 3 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_221 3301196 : 3301550 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_222 3305700 : 3306906 1 Bordetella_phage(100.0%) NA NA
DBSCAN-SWA_223 3311278 : 3318345 7 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_224 3327053 : 3340425 8 Leptospira_phage(20.0%) NA NA
DBSCAN-SWA_225 3352063 : 3353278 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_226 3356826 : 3357762 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_227 3388041 : 3440351 78 Acinetobacter_phage(94.03%) integrase,capsid attL 3387283:3387303|attR 3440520:3440540
DBSCAN-SWA_228 3445157 : 3446012 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_229 3456177 : 3457365 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_230 3461463 : 3464343 1 Klosneuvirus(100.0%) tRNA NA
DBSCAN-SWA_231 3480216 : 3481488 1 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_232 3489299 : 3491186 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_233 3505575 : 3509228 3 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_234 3512951 : 3514454 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_235 3541379 : 3542012 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_236 3549073 : 3551754 2 Marsac_virus(50.0%) NA NA
DBSCAN-SWA_237 3556077 : 3559728 4 Enterococcus_phage(50.0%) NA NA
DBSCAN-SWA_238 3577582 : 3579566 2 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_239 3587590 : 3589863 2 Geobacillus_virus(50.0%) tRNA NA
DBSCAN-SWA_240 3593920 : 3597919 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_241 3604602 : 3605760 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_242 3610049 : 3612088 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_243 3619852 : 3629023 7 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_244 3635301 : 3636381 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_245 3640696 : 3648578 7 Planktothrix_phage(20.0%) NA NA
DBSCAN-SWA_246 3657630 : 3658602 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_247 3669027 : 3680229 11 Burkholderia_phage(16.67%) NA NA
DBSCAN-SWA_248 3683247 : 3684309 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_249 3689919 : 3698903 9 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_250 3708605 : 3712279 3 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_251 3717979 : 3719113 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_252 3725457 : 3726594 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_253 3732397 : 3737267 4 Bodo_saltans_virus(50.0%) NA NA
DBSCAN-SWA_254 3742887 : 3744144 1 Phage_21(100.0%) NA NA
DBSCAN-SWA_255 3750329 : 3753092 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_256 3760067 : 3762905 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_257 3769631 : 3771005 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_258 3774938 : 3784566 7 Micromonas_sp._RCC1109_virus(25.0%) protease NA
DBSCAN-SWA_259 3787801 : 3789190 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_260 3792383 : 3796415 5 Stx2-converting_phage(33.33%) NA NA
DBSCAN-SWA_261 3812950 : 3863226 71 Acinetobacter_phage(100.0%) tail,integrase,capsid attL 3805051:3805065|attR 3824609:3824623
DBSCAN-SWA_262 3878006 : 3881611 2 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_263 3890315 : 3893118 3 Faecalibacterium_phage(50.0%) transposase NA
DBSCAN-SWA_264 3904523 : 3911759 5 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_265 3922262 : 3926861 4 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_266 3938409 : 3966455 38 Acinetobacter_phage(97.3%) NA NA
DBSCAN-SWA_267 3970410 : 3975274 6 Acinetobacter_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP029572
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029572_1 6917-7012 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP044476 Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence 6018-6049 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP044476 Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence 6039-6070 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_LR026972 Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence 14314-14345 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_LR026972 Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence 14335-14366 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP023027 Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence 2706-2737 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP023027 Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence 2727-2758 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP020587 Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence 1572-1603 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP020587 Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence 1593-1624 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP021348 Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence 15134-15165 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP021348 Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence 15155-15186 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP023021 Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence 4058-4089 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP023021 Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence 4079-4110 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_KY499579 Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence 6031-6062 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_KY499579 Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence 6052-6083 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP027248 Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence 13480-13511 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP027248 Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence 13501-13532 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP028570 Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence 3684-3715 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP028570 Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence 3705-3736 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP031994 Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence 2307-2338 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP031994 Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence 2328-2359 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP044462 Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence 3598-3629 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP044462 Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence 3619-3650 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_010481 Acinetobacter baumannii plasmid pABIR, complete sequence 228-259 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_010481 Acinetobacter baumannii plasmid pABIR, complete sequence 249-280 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP033542 Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence 59-90 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP033542 Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence 80-111 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP038648 Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence 1817-1848 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP038648 Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence 1838-1869 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP033571 Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence 6654-6685 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP033571 Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence 6675-6706 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP033132 Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence 8645-8676 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP033132 Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence 8666-8697 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP033752 Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence 9523-9554 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP033752 Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence 9544-9575 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP027252 Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence 8103-8134 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP027252 Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence 8124-8155 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_LT984691 Acinetobacter baumannii isolate K50 plasmid II, complete sequence 9414-9445 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_LT984691 Acinetobacter baumannii isolate K50 plasmid II, complete sequence 9435-9466 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP029572 Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence 6928-6959 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP029572 Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence 6949-6980 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MN461228 Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence 3638-3669 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MN461228 Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence 3659-3690 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MN481286 Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence 2718-2749 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MN481286 Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence 2739-2770 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MN495625 Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence 8318-8349 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MN495625 Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence 8339-8370 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MN495626 Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence 8318-8349 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MN495626 Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence 8339-8370 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP051871 Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence 2122-2153 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP051871 Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence 2143-2174 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_013506 Acinetobacter baumannii plasmid pMMCU2, complete sequence 8537-8568 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_013506 Acinetobacter baumannii plasmid pMMCU2, complete sequence 8558-8589 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MK978160 Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence 2818-2849 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MK978160 Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence 2839-2870 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_013056 Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence 7752-7783 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_013056 Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence 7773-7804 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP042207 Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence 8144-8175 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP042207 Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence 8165-8196 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP042367 Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence 10198-10229 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP042367 Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence 10219-10250 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP018141 Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence 4129-4160 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP018141 Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence 4150-4181 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP038260 Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence 10478-10509 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP038260 Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence 10499-10530 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP049810 Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence 7568-7599 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP049810 Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence 7589-7620 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP015146 Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence 247-278 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP015146 Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence 268-299 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP051877 Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence 1389-1420 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP051877 Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence 1410-1441 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP031981 Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence 759-790 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP031981 Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence 780-811 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP026427 Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence 6952-6983 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP026427 Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence 6973-7004 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP014479 Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence 17984-18015 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP014479 Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence 18005-18036 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP016899 Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence 2195-2226 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP016899 Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence 2216-2247 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP051868 Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence 7686-7717 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP051868 Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence 7707-7738 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_019280 Acinetobacter baumannii plasmid pMMD, complete sequence 7703-7734 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_019280 Acinetobacter baumannii plasmid pMMD, complete sequence 7724-7755 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP023035 Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence 2972-3003 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP023035 Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence 2993-3024 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_KT022421 Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence 4250-4281 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_KT022421 Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence 4271-4302 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP032127 Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence 18027-18058 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP032127 Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence 18048-18079 0 1.0
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP015112 Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence 7417-7448 1 0.969
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP015112 Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence 7438-7469 1 0.969
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP032275 Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence 4788-4819 1 0.969
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP032275 Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence 4809-4840 1 0.969
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP010354 Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence 8559-8590 1 0.969
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP010354 Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence 8580-8611 1 0.969
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP050406 Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence 9450-9481 1 0.969
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP050406 Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence 9471-9502 1 0.969
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP035940 Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence 3221-3252 1 0.969
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP035940 Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence 3242-3273 1 0.969
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_014312 Klebsiella pneumoniae plasmid pKP048, complete sequence 33923-33954 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_KY399978 Vibrio cholerae O139 strain ICDC-211 plasmid pVC211, complete sequence 33736-33767 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_AP023051 Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence 137476-137507 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MF399199 Acinetobacter baumannii strain D46 plasmid pD46-4, complete sequence 81897-81928 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP016764 Citrobacter freundii strain B38 plasmid pOZ181, complete sequence 208670-208701 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_021728 Acinetobacter baumannii BJAB07104 plasmid p2BJAB07104, complete sequence 14498-14529 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_KX443408 Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence 59126-59157 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_KU302802 Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence 72945-72976 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_KX009507 Escherichia coli strain 06K2206 plasmid LM6771, complete sequence 30580-30611 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_KU302801 Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence 72945-72976 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_KM083064 Vibrio cholerae strain ICDC-1447 plasmid pVC1447, complete sequence 11040-11071 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_KT225462 Klebsiella pneumoniae strain YDC676 plasmid pYDC676, complete sequence 15891-15922 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_KR091911 Salmonella enterica subsp. enterica serovar Corvallis strain RH-1238 plasmid pRH-1238, complete sequence 82195-82226 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP012428 Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence 33092-33123 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP026156 Klebsiella pneumoniae strain B12(AN) plasmid pB12AN_1, complete sequence 5686-5717 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP040051 Acinetobacter baumannii strain VB16141 plasmid unnamed1, complete sequence 157830-157861 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_004464 Citrobacter freundii plasmid pCTX-M3, complete sequence 78331-78362 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_007682 Escherichia coli plasmid pMUR050, complete sequence 23523-23554 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 269347-269378 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP052160 Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-2, complete sequence 1306-1337 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_021180 Klebsiella pneumoniae plasmid pNDM-1saitama01 DNA, complete sequence, strain: NDM-1saitama01 47233-47264 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP052311 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-2, complete sequence 123333-123364 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP027679 Salmonella enterica subsp. enterica serovar Corvallis strain 12-01738 plasmid pSE12-01738-2, complete sequence 71941-71972 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 66516-66547 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 379170-379201 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP029729 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence 192795-192826 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_LS992184 Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence 4269-4300 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_LS992184 Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence 172346-172377 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_KJ187752 Klebsiella pneumoniae strain 7433 plasmid pTR2, complete sequence 51083-51114 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP052145 Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence 21151-21182 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_AP014650 Acinetobacter baumannii strain IOMTU433 plasmid pIOMTU433, complete sequence 1251-1282 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP044454 Acinetobacter indicus strain MMS9-2 plasmid pMMS9-2-4, complete sequence 6554-6585 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP033628 Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence 70170-70201 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP038646 Acinetobacter baumannii strain ACN21 plasmid unnamed2, complete sequence 1306-1337 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 136022-136053 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 353358-353389 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP012007 Acinetobacter baumannii strain Ab04-mff plasmid pAB04-1, complete sequence 115941-115972 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 80036-80067 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MN175387 Klebsiella pneumoniae strain KP-14-6 plasmid pKP-14-6-NDM-1, complete sequence 140438-140469 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 213043-213074 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_019165 Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence 73574-73605 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 1992-2023 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MH909331 Leclercia adecarboxylata plasmid p707804-NDM, complete sequence 140993-141024 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 57768-57799 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP041083 Klebsiella pneumoniae strain Kp202 plasmid pKp202_1, complete sequence 123289-123320 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 252486-252517 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 1306-1337 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_016974 Providencia stuartii plasmid pMR0211, complete sequence 129281-129312 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_017172 Acinetobacter baumannii MDR-ZJ06 plasmid pMDR-ZJ06, complete sequence 7220-7251 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MN310378 Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence 64116-64147 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 210601-210632 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 KU318419 Enterbacter aerogenes strain EA49 plasmid pEA49-KPC, complete sequence 2279-2310 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 18918-18949 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_LT985387 Escherichia coli strain 694 genome assembly, plasmid: RCS55_pI 10636-10667 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 96027-96058 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP036195 Klebsiella pneumoniae strain BA34918 plasmid pIncX3 46739-46770 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 LC508263 Klebsiella pneumoniae A1-3 plasmid pA1-3 DNA, complete sequence 75060-75091 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 225163-225194 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP050416 Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence 1306-1337 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_019063 Escherichia coli plasmid pNDM-HK, complete sequence 24804-24835 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP050426 Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence 1306-1337 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 LT009689 Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence 71778-71809 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP040054 Acinetobacter baumannii strain VB35179 plasmid unnamed1, complete sequence 178122-178153 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 204413-204444 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MF344571 Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence 240182-240213 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP050433 Acinetobacter baumannii strain PM194229 plasmid pPM194229_1, complete sequence 1306-1337 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP050386 Acinetobacter baumannii strain VB82 plasmid pVB82_1, complete sequence 190142-190173 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 117937-117968 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP029118 Escherichia coli strain AR435 plasmid unnamed5, complete sequence 117666-117697 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MF344568 Pseudomonas aeruginosa plasmid p727-IMP, complete sequence 234138-234169 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 232207-232238 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP041052 Enterobacter hormaechei strain C126 plasmid pEnC126NDM, complete sequence 24288-24319 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 260033-260064 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 175110-175141 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP050162 Escherichia coli plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence 82577-82608 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 186059-186090 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP031235 Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_NDM, complete sequence 50975-51006 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 59097-59128 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 238004-238035 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP052423 Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence 168984-169015 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 131618-131649 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_019065 Escherichia coli plasmid pPG010208, complete sequence 20620-20651 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 211170-211201 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 85298-85329 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 LC536683 Klebsiella pneumoniae MyNCGM084 plasmid pMyNCGM084, complete sequence 23823-23854 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 LC542971 Escherichia coli IOMTU413 plasmid pIOMTU413 DNA, complete sequence 96278-96309 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 101394-101425 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 116343-116374 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 KX957970 Vibrio parahaemolyticus plasmid pVPS43, complete sequence 110095-110126 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP021709 Klebsiella pneumoniae strain AR_0143 plasmid tig00000001_p1, complete sequence 82830-82861 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP021551 Proteus mirabilis strain AR_0159 plasmid tig00000137, complete sequence 96680-96711 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 152490-152521 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 KX957969 Vibrio alginolyticus plasmid pVAS114, complete sequence 113977-114008 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP013115 Shewanella xiamenensis strain T17 plasmid pSx1, complete sequence 97345-97376 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP052205 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence 1306-1337 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 1992-2023 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP012902 Escherichia coli strain N15-01078 plasmid pNDM15-1078, complete sequence 47690-47721 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP020596 Acinetobacter baumannii strain HWBA8 plasmid pHWBA8_1, complete sequence 9354-9385 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 208719-208750 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP032193 Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 plasmid unnamed2, complete sequence 12765-12796 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP040260 Acinetobacter baumannii strain P7774 plasmid unnamed1, complete sequence 80809-80840 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_022589 Providencia rettgeri strain 09ACRGNY2001 plasmid pPrY2001, complete sequence 77049-77080 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP052352 Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-1, complete sequence 16262-16293 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP044337 Enterobacter hormaechei strain AKB48 plasmid unnamed2, complete sequence 53382-53413 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP007579 Acinetobacter baumannii AC30 plasmid pAC30b, complete sequence 6758-6789 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_019360 Citrobacter freundii plasmid pNDM-CIT, complete sequence 31352-31383 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 161706-161737 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP046598 Acinetobacter indicus strain FS42-2 plasmid pFS42-2-3, complete sequence 3413-3444 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP030345 Enterobacter hormaechei strain AR_038 plasmid unnamed1 10319-10350 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP030345 Enterobacter hormaechei strain AR_038 plasmid unnamed1 132235-132266 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 189638-189669 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP052393 Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-1, complete sequence 16262-16293 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 52169-52200 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 263190-263221 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_AP018143 Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence 126288-126319 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_AP018145 Escherichia coli strain M216 isolate M216 plasmid pM216_AC2, complete sequence 145049-145080 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 CP052316 Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence 1306-1337 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_LN831184 Vibrio cholerae isolate V. cholerae 116-14 plasmid pNDM-116-14, complete sequence 232232-232263 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_LN831185 Vibrio cholerae isolate V. cholerae 116-17a plasmid pNDM-116-17, complete sequence 74417-74448 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MN937241 Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence 107980-108011 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_LT985241 Escherichia coli strain 721 plasmid RCS40_p, complete sequence 33073-33104 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 LC505604 Klebsiella pneumoniae A1-1 plasmid pKp1-1 genomic DNA, complete sequence 75060-75091 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 LC508722 Klebsiella pneumoniae A2-1 plasmid pA2-4 DNA, complete sequence 75060-75091 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MN101852 Escherichia coli strain 13ZX28-TC-98 plasmid p13ZX28-TC-98, complete sequence 18954-18985 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 174691-174722 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MN101850 Escherichia coli strain 13ZX28 plasmid p13ZX28-272, complete sequence 214047-214078 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MN101853 Escherichia coli strain 13ZX36 plasmid p13ZX36-200, complete sequence 140400-140431 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_019889 Klebsiella pneumoniae strain 601 plasmid pNDM-OM, complete sequence 62261-62292 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MN657249 Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence 111158-111189 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MN657250 Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence 111194-111225 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MN657252 Enterobacteriaceae bacterium strain 21-16 plasmid pPS-T1, complete sequence 134420-134451 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 65657-65688 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MH011352 Klebsiella pneumoniae strain 185 plasmid pNDM-185, complete sequence 180693-180724 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MK413720 Enterobacter cloacae strain 12949 plasmid p12949-HI2, complete sequence 121318-121349 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 75770-75801 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MN657241 Enterobacteriaceae bacterium strain 20-16 plasmid pCF104a-T3, complete sequence 132511-132542 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP012903 Providencia rettgeri strain N15-01091 plasmid pNDM15-1091, complete sequence 49446-49477 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MH001166 Escherichia coli strain TAEC1 plasmid pNDM-TAEC1, complete sequence 159056-159087 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MF344561 Klebsiella pneumoniae strain 11219 plasmid p11219-IMP, complete sequence 193045-193076 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MF344561 Klebsiella pneumoniae strain 11219 plasmid p11219-IMP, complete sequence 294301-294332 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 151708-151739 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 287996-288027 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 166624-166655 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 302552-302583 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 183933-183964 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 317390-317421 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MF344572 Enterobacter hormaechei strain 24845 plasmid p24845-Ct2, complete sequence 88579-88610 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MG450360 Escherichia coli strain AMA566 plasmid pAMA566, complete sequence 134913-134944 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MH892479 Citrobacter freundii strain 2262 plasmid pNDM-2262, complete sequence 150519-150550 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP049048 Enterobacter hormaechei strain Y233 plasmid p233-142, complete sequence 72812-72843 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NC_021732 Acinetobacter baumannii BJAB0868 plasmid p3BJAB0868, complete sequence 15627-15658 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP044468 Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-5, complete sequence 5814-5845 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_KY883660 Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence 257700-257731 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MF072965 Citrobacter freundii strain P10159 plasmid pP10159-5, complete sequence 138794-138825 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MG288680 Klebsiella pneumoniae strain D610 plasmid pD610-HI2, complete sequence 121625-121656 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 247967-247998 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 74577-74608 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 247998-248029 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_MF344582 Citrobacter freundii strain 525011 plasmid p525011-HI2, complete sequence 143388-143419 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP040068 Escherichia coli strain A1_181 plasmid p_unnamed1_KPC2, complete sequence 124572-124603 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 244179-244210 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 279108-279139 7 0.781
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP032275 Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence 4767-4798 8 0.75
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP050406 Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence 9492-9523 8 0.75
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP035940 Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence 3200-3231 8 0.75
NZ_CP029572_1 1.1|6949|32|NZ_CP029572|CRISPRCasFinder 6949-6980 32 NZ_CP033846 Klebsiella oxytoca strain FDAARGOS_500 plasmid unnamed2, complete sequence 381-412 10 0.688

1. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP044476 (Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

2. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP044476 (Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

3. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_LR026972 (Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

4. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_LR026972 (Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

5. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP023027 (Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

6. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP023027 (Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

7. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP020587 (Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

8. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP020587 (Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

9. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP021348 (Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

10. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP021348 (Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

11. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP023021 (Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

12. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP023021 (Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

13. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_KY499579 (Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

14. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_KY499579 (Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

15. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP027248 (Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

16. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP027248 (Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

17. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP028570 (Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

18. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP028570 (Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

19. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP031994 (Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

20. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP031994 (Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

21. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP044462 (Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

22. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP044462 (Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

23. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_010481 (Acinetobacter baumannii plasmid pABIR, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

24. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_010481 (Acinetobacter baumannii plasmid pABIR, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

25. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP033542 (Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

26. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP033542 (Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

27. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP038648 (Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

28. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP038648 (Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

29. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP033571 (Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

30. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP033571 (Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

31. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP033132 (Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

32. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP033132 (Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

33. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP033752 (Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

34. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP033752 (Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

35. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP027252 (Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

36. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP027252 (Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

37. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_LT984691 (Acinetobacter baumannii isolate K50 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

38. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_LT984691 (Acinetobacter baumannii isolate K50 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

39. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP029572 (Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

40. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP029572 (Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

41. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MN461228 (Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

42. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MN461228 (Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

43. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MN481286 (Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

44. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MN481286 (Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

45. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MN495625 (Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

46. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MN495625 (Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

47. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MN495626 (Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

48. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MN495626 (Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

49. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP051871 (Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

50. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP051871 (Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

51. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_013506 (Acinetobacter baumannii plasmid pMMCU2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

52. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_013506 (Acinetobacter baumannii plasmid pMMCU2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

53. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MK978160 (Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

54. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MK978160 (Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

55. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_013056 (Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

56. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_013056 (Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

57. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP042207 (Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

58. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP042207 (Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

59. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP042367 (Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

60. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP042367 (Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

61. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP018141 (Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

62. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP018141 (Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

63. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP038260 (Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

64. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP038260 (Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

65. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP049810 (Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

66. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP049810 (Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

67. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP015146 (Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

68. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP015146 (Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

69. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP051877 (Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

70. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP051877 (Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

71. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP031981 (Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

72. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP031981 (Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

73. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP026427 (Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

74. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP026427 (Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

75. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP014479 (Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

76. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP014479 (Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

77. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP016899 (Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

78. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP016899 (Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

79. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP051868 (Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

80. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP051868 (Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

81. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_019280 (Acinetobacter baumannii plasmid pMMD, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

82. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_019280 (Acinetobacter baumannii plasmid pMMD, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

83. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP023035 (Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

84. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP023035 (Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

85. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_KT022421 (Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

86. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_KT022421 (Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

87. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP032127 (Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

88. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP032127 (Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

89. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP015112 (Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactaccaactatgacggattgactac	Protospacer
***********.********************

90. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP015112 (Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactaccaactatgacggattgactac	Protospacer
***********.********************

91. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP032275 (Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

92. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP032275 (Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

93. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP010354 (Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

94. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP010354 (Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

95. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP050406 (Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

96. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP050406 (Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

97. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP035940 (Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

98. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP035940 (Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

99. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_014312 (Klebsiella pneumoniae plasmid pKP048, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

100. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_KY399978 (Vibrio cholerae O139 strain ICDC-211 plasmid pVC211, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

101. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_AP023051 (Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

102. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MF399199 (Acinetobacter baumannii strain D46 plasmid pD46-4, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

103. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP016764 (Citrobacter freundii strain B38 plasmid pOZ181, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

104. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_021728 (Acinetobacter baumannii BJAB07104 plasmid p2BJAB07104, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

105. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_KX443408 (Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

106. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_KU302802 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

107. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_KX009507 (Escherichia coli strain 06K2206 plasmid LM6771, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

108. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_KU302801 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

109. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_KM083064 (Vibrio cholerae strain ICDC-1447 plasmid pVC1447, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

110. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_KT225462 (Klebsiella pneumoniae strain YDC676 plasmid pYDC676, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

111. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_KR091911 (Salmonella enterica subsp. enterica serovar Corvallis strain RH-1238 plasmid pRH-1238, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

112. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP012428 (Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

113. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP026156 (Klebsiella pneumoniae strain B12(AN) plasmid pB12AN_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

114. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP040051 (Acinetobacter baumannii strain VB16141 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

115. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_004464 (Citrobacter freundii plasmid pCTX-M3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

116. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_007682 (Escherichia coli plasmid pMUR050, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

117. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

118. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP052160 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

119. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_021180 (Klebsiella pneumoniae plasmid pNDM-1saitama01 DNA, complete sequence, strain: NDM-1saitama01) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

120. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP052311 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

121. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP027679 (Salmonella enterica subsp. enterica serovar Corvallis strain 12-01738 plasmid pSE12-01738-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

122. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

123. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

124. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP029729 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

125. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_LS992184 (Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

126. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_LS992184 (Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

127. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_KJ187752 (Klebsiella pneumoniae strain 7433 plasmid pTR2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

128. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP052145 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

129. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_AP014650 (Acinetobacter baumannii strain IOMTU433 plasmid pIOMTU433, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

130. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP044454 (Acinetobacter indicus strain MMS9-2 plasmid pMMS9-2-4, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

131. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP033628 (Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

132. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP038646 (Acinetobacter baumannii strain ACN21 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

133. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

134. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

135. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP012007 (Acinetobacter baumannii strain Ab04-mff plasmid pAB04-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

136. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

137. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MN175387 (Klebsiella pneumoniae strain KP-14-6 plasmid pKP-14-6-NDM-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

138. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

139. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_019165 (Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

140. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

141. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MH909331 (Leclercia adecarboxylata plasmid p707804-NDM, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

142. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

143. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP041083 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

144. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

145. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

146. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_016974 (Providencia stuartii plasmid pMR0211, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

147. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_017172 (Acinetobacter baumannii MDR-ZJ06 plasmid pMDR-ZJ06, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

148. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MN310378 (Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

149. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

150. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to KU318419 (Enterbacter aerogenes strain EA49 plasmid pEA49-KPC, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

151. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

152. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_LT985387 (Escherichia coli strain 694 genome assembly, plasmid: RCS55_pI) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

153. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

154. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP036195 (Klebsiella pneumoniae strain BA34918 plasmid pIncX3) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

155. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to LC508263 (Klebsiella pneumoniae A1-3 plasmid pA1-3 DNA, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

156. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

157. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP050416 (Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

158. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_019063 (Escherichia coli plasmid pNDM-HK, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

159. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP050426 (Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

160. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to LT009689 (Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

161. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP040054 (Acinetobacter baumannii strain VB35179 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

162. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

163. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

164. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP050433 (Acinetobacter baumannii strain PM194229 plasmid pPM194229_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

165. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP050386 (Acinetobacter baumannii strain VB82 plasmid pVB82_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

166. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

167. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP029118 (Escherichia coli strain AR435 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

168. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MF344568 (Pseudomonas aeruginosa plasmid p727-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

169. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

170. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP041052 (Enterobacter hormaechei strain C126 plasmid pEnC126NDM, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

171. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

172. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

173. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP050162 (Escherichia coli plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

174. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

175. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP031235 (Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_NDM, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

176. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

177. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

178. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

179. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

180. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_019065 (Escherichia coli plasmid pPG010208, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

181. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

182. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

183. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to LC536683 (Klebsiella pneumoniae MyNCGM084 plasmid pMyNCGM084, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

184. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to LC542971 (Escherichia coli IOMTU413 plasmid pIOMTU413 DNA, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

185. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

186. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

187. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to KX957970 (Vibrio parahaemolyticus plasmid pVPS43, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

188. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP021709 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000001_p1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

189. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP021551 (Proteus mirabilis strain AR_0159 plasmid tig00000137, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

190. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

191. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to KX957969 (Vibrio alginolyticus plasmid pVAS114, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

192. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP013115 (Shewanella xiamenensis strain T17 plasmid pSx1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

193. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

194. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

195. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP012902 (Escherichia coli strain N15-01078 plasmid pNDM15-1078, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

196. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP020596 (Acinetobacter baumannii strain HWBA8 plasmid pHWBA8_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

197. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

198. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP032193 (Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

199. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP040260 (Acinetobacter baumannii strain P7774 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

200. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_022589 (Providencia rettgeri strain 09ACRGNY2001 plasmid pPrY2001, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

201. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP052352 (Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

202. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP044337 (Enterobacter hormaechei strain AKB48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

203. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP007579 (Acinetobacter baumannii AC30 plasmid pAC30b, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

204. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_019360 (Citrobacter freundii plasmid pNDM-CIT, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

205. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

206. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP046598 (Acinetobacter indicus strain FS42-2 plasmid pFS42-2-3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

207. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP030345 (Enterobacter hormaechei strain AR_038 plasmid unnamed1) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

208. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP030345 (Enterobacter hormaechei strain AR_038 plasmid unnamed1) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

209. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

210. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP052393 (Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

211. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

212. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

213. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_AP018143 (Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

214. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_AP018145 (Escherichia coli strain M216 isolate M216 plasmid pM216_AC2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

215. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to CP052316 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

216. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_LN831184 (Vibrio cholerae isolate V. cholerae 116-14 plasmid pNDM-116-14, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

217. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_LN831185 (Vibrio cholerae isolate V. cholerae 116-17a plasmid pNDM-116-17, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

218. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MN937241 (Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

219. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_LT985241 (Escherichia coli strain 721 plasmid RCS40_p, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

220. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to LC505604 (Klebsiella pneumoniae A1-1 plasmid pKp1-1 genomic DNA, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

221. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to LC508722 (Klebsiella pneumoniae A2-1 plasmid pA2-4 DNA, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

222. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MN101852 (Escherichia coli strain 13ZX28-TC-98 plasmid p13ZX28-TC-98, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

223. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

224. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MN101850 (Escherichia coli strain 13ZX28 plasmid p13ZX28-272, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

225. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MN101853 (Escherichia coli strain 13ZX36 plasmid p13ZX36-200, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

226. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_019889 (Klebsiella pneumoniae strain 601 plasmid pNDM-OM, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

227. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MN657249 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

228. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MN657250 (Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

229. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MN657252 (Enterobacteriaceae bacterium strain 21-16 plasmid pPS-T1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

230. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

231. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MH011352 (Klebsiella pneumoniae strain 185 plasmid pNDM-185, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

232. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MK413720 (Enterobacter cloacae strain 12949 plasmid p12949-HI2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

233. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

234. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MN657241 (Enterobacteriaceae bacterium strain 20-16 plasmid pCF104a-T3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

235. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP012903 (Providencia rettgeri strain N15-01091 plasmid pNDM15-1091, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

236. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MH001166 (Escherichia coli strain TAEC1 plasmid pNDM-TAEC1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

237. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MF344561 (Klebsiella pneumoniae strain 11219 plasmid p11219-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

238. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MF344561 (Klebsiella pneumoniae strain 11219 plasmid p11219-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

239. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

240. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

241. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

242. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

243. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

244. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

245. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MF344572 (Enterobacter hormaechei strain 24845 plasmid p24845-Ct2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

246. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MG450360 (Escherichia coli strain AMA566 plasmid pAMA566, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

247. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MH892479 (Citrobacter freundii strain 2262 plasmid pNDM-2262, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

248. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP049048 (Enterobacter hormaechei strain Y233 plasmid p233-142, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

249. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NC_021732 (Acinetobacter baumannii BJAB0868 plasmid p3BJAB0868, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

250. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP044468 (Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-5, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

251. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

252. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MF072965 (Citrobacter freundii strain P10159 plasmid pP10159-5, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

253. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MG288680 (Klebsiella pneumoniae strain D610 plasmid pD610-HI2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

254. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

255. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

256. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

257. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_MF344582 (Citrobacter freundii strain 525011 plasmid p525011-HI2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

258. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP040068 (Escherichia coli strain A1_181 plasmid p_unnamed1_KPC2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

259. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

260. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

261. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP032275 (Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence) position: , mismatch: 8, identity: 0.75

ggattgactactaactatgacggattgactac	CRISPR spacer
ctttcagctcctaactatgagggattgactac	Protospacer
   *...** ********** ***********

262. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP050406 (Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence) position: , mismatch: 8, identity: 0.75

ggattgactactaactatgacggattgactac	CRISPR spacer
ctttcagctcctaactatgagggattgactac	Protospacer
   *...** ********** ***********

263. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP035940 (Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence) position: , mismatch: 8, identity: 0.75

ggattgactactaactatgacggattgactac	CRISPR spacer
ctttcagctcctaactatgagggattgactac	Protospacer
   *...** ********** ***********

264. spacer 1.1|6949|32|NZ_CP029572|CRISPRCasFinder matches to NZ_CP033846 (Klebsiella oxytoca strain FDAARGOS_500 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggattgactactaactatgacggattgactac	CRISPR spacer
acagcagaaactaaacatgacggattgactac	Protospacer
. * ...  ***** .****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage