Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP029580 Escherichia coli strain DA33137 plasmid pDA33137-178, complete sequence 0 crisprs RT 0 0 2 0
NZ_CP029581 Escherichia coli strain DA33137 plasmid pDA33137-2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP029579 Escherichia coli strain DA33137 chromosome, complete genome 4 crisprs DinG,DEDDh,c2c9_V-U4,cas3,csa3,PD-DExK,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2 0 10 11 0

Results visualization

1. NZ_CP029580
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2169 : 72015 56 Escherichia_phage(42.86%) integrase,transposase attL 35982:36001|attR 72146:72165
DBSCAN-SWA_2 84189 : 132342 47 Escherichia_phage(58.33%) protease,transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP029579
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029579_1 1974782-1974931 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029579_2 3388517-3388667 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029579_3 3774421-3774754 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029579_4 3801892-3802469 TypeI-E I-E
9 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP029579_4 4.4|3802104|32|NZ_CP029579|PILER-CR 3802104-3802135 32 NZ_CP037443 Klebsiella sp. PO552 plasmid p2, complete sequence 42679-42710 1 0.969
NZ_CP029579_4 4.13|3802101|35|NZ_CP029579|CRISPRCasFinder,CRT 3802101-3802135 35 NZ_CP037443 Klebsiella sp. PO552 plasmid p2, complete sequence 42676-42710 2 0.943
NZ_CP029579_3 3.3|3774572|32|NZ_CP029579|PILER-CR,CRISPRCasFinder,CRT 3774572-3774603 32 NC_016040 Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence 37866-37897 6 0.812
NZ_CP029579_4 4.7|3802287|32|NZ_CP029579|PILER-CR 3802287-3802318 32 MT110073 Stenotrophomonas phage vB_SmaS_DLP_3, complete genome 39410-39441 7 0.781
NZ_CP029579_3 3.1|3774450|32|NZ_CP029579|PILER-CR,CRISPRCasFinder,CRT 3774450-3774481 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 107507-107538 8 0.75
NZ_CP029579_3 3.1|3774450|32|NZ_CP029579|PILER-CR,CRISPRCasFinder,CRT 3774450-3774481 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 199281-199312 8 0.75
NZ_CP029579_3 3.4|3774633|32|NZ_CP029579|PILER-CR,CRISPRCasFinder,CRT 3774633-3774664 32 MN855878 Bacteriophage sp. isolate 336, complete genome 5171-5202 8 0.75
NZ_CP029579_4 4.5|3802165|32|NZ_CP029579|PILER-CR 3802165-3802196 32 KC847113 Bacillus phage PBP180, complete sequence 100-131 8 0.75
NZ_CP029579_4 4.8|3802348|32|NZ_CP029579|PILER-CR 3802348-3802379 32 NZ_CP044084 Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence 347859-347890 8 0.75
NZ_CP029579_4 4.4|3802104|32|NZ_CP029579|PILER-CR 3802104-3802135 32 NZ_CP019063 Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence 287201-287232 9 0.719
NZ_CP029579_4 4.5|3802165|32|NZ_CP029579|PILER-CR 3802165-3802196 32 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 20152-20183 9 0.719
NZ_CP029579_4 4.5|3802165|32|NZ_CP029579|PILER-CR 3802165-3802196 32 NC_049837 Klebsiella phage vB_KpnS_Alina, complete genome 13583-13614 9 0.719
NZ_CP029579_4 4.9|3802409|32|NZ_CP029579|PILER-CR 3802409-3802440 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 11267-11298 9 0.719
NZ_CP029579_4 4.5|3802165|32|NZ_CP029579|PILER-CR 3802165-3802196 32 MN480762 Streptococcus salivarius strain NU10 plasmid pSsal-NU10, complete sequence 179050-179081 10 0.688
NZ_CP029579_4 4.14|3802162|35|NZ_CP029579|CRISPRCasFinder,CRT 3802162-3802196 35 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 20152-20186 12 0.657

1. spacer 4.4|3802104|32|NZ_CP029579|PILER-CR matches to NZ_CP037443 (Klebsiella sp. PO552 plasmid p2, complete sequence) position: , mismatch: 1, identity: 0.969 

gcgagtaagagtactgagtattttaatctcat	CRISPR spacer
gcgagtaagagtgctgagtattttaatctcat	Protospacer
************.*******************

2. spacer 4.13|3802101|35|NZ_CP029579|CRISPRCasFinder,CRT matches to NZ_CP037443 (Klebsiella sp. PO552 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.943 

tcggcgagtaagagtactgagtattttaatctcat	CRISPR spacer
acggcgagtaagagtgctgagtattttaatctcat	Protospacer
 **************.*******************

3. spacer 3.3|3774572|32|NZ_CP029579|PILER-CR,CRISPRCasFinder,CRT matches to NC_016040 (Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence) position: , mismatch: 6, identity: 0.812 

tgcacgccctgccggaatctcccctcgctctc	CRISPR spacer
tgcacgccctgccggaagatcccctcacgatt	Protospacer
*****************  *******.*  *.

4. spacer 4.7|3802287|32|NZ_CP029579|PILER-CR matches to MT110073 (Stenotrophomonas phage vB_SmaS_DLP_3, complete genome) position: , mismatch: 7, identity: 0.781 

aggggcagggagtgacgctggagcaggcgatc	CRISPR spacer
gggagggggcattgacgctggagcaggcgaac	Protospacer
.**.* .** * ****************** *

5. spacer 3.1|3774450|32|NZ_CP029579|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 8, identity: 0.75 

acattgactgcccgtggcgtccccgcgacctt	CRISPR spacer
ccgtcgactgcccgtggggtcccagcgaaatc	Protospacer
 *.*.************ ***** ****  *.

6. spacer 3.1|3774450|32|NZ_CP029579|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

acattgactgcccgtggcgtccccgcgacctt	CRISPR spacer
ccgtcgactgcccgtggggtcccagcgaaatc	Protospacer
 *.*.************ ***** ****  *.

7. spacer 3.4|3774633|32|NZ_CP029579|PILER-CR,CRISPRCasFinder,CRT matches to MN855878 (Bacteriophage sp. isolate 336, complete genome) position: , mismatch: 8, identity: 0.75 

agtaagccggttgattatcgcca----gggatatta	CRISPR spacer
agtaagcaggatgattatcgccaccatggcgt----	Protospacer
******* ** ************    ** .*

8. spacer 4.5|3802165|32|NZ_CP029579|PILER-CR matches to KC847113 (Bacillus phage PBP180, complete sequence) position: , mismatch: 8, identity: 0.75 

gccatagactttattaacttcattgggggtta	CRISPR spacer
accatcgactttattaactacattagagagaa	Protospacer
.**** ************* ****.*.*.  *

9. spacer 4.8|3802348|32|NZ_CP029579|PILER-CR matches to NZ_CP044084 (Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

cagggaaaccgttcgtacttatcgacctcaac	CRISPR spacer
cgctgtaaccattcgtactcatcgacctcttc	Protospacer
*.  * ****.********.*********  *

10. spacer 4.4|3802104|32|NZ_CP029579|PILER-CR matches to NZ_CP019063 (Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgagtaagagtactgagtattttaatctcat	CRISPR spacer
gacggtaagagtaccgagtatgttaattcccg	Protospacer
*  .**********.****** *****..*

11. spacer 4.5|3802165|32|NZ_CP029579|PILER-CR matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gccatagactttattaacttcattgggggtta	CRISPR spacer
gccatagaattttttaacttcattgcctaaag	Protospacer
******** *** ************   .  .

12. spacer 4.5|3802165|32|NZ_CP029579|PILER-CR matches to NC_049837 (Klebsiella phage vB_KpnS_Alina, complete genome) position: , mismatch: 9, identity: 0.719 

gccatagactttattaacttcattgggggtta	CRISPR spacer
gccatacacgttattaacttcatcgccaatgt	Protospacer
****** ** *************.*  ..*

13. spacer 4.9|3802409|32|NZ_CP029579|PILER-CR matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719 

aaggggacggctacgggacgccgcctattgac	CRISPR spacer
tcggggatggctacggcacgccgccagagcac	Protospacer
  *****.******** ******** .   **

14. spacer 4.5|3802165|32|NZ_CP029579|PILER-CR matches to MN480762 (Streptococcus salivarius strain NU10 plasmid pSsal-NU10, complete sequence) position: , mismatch: 10, identity: 0.688 

gccatagactttattaacttcattgggggtta	CRISPR spacer
atcatagtttttattaacttcattgaatctac	Protospacer
..***** .****************..  *

15. spacer 4.14|3802162|35|NZ_CP029579|CRISPRCasFinder,CRT matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 12, identity: 0.657 

tcggccatagactttattaacttcattgggggtta	CRISPR spacer
atcgccatagaattttttaacttcattgcctaaag	Protospacer
 . ******** *** ************   .  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 47264 : 107121 79 Enterobacteria_phage(45.28%) capsid,terminase,portal,lysis,head,tail,integrase,transposase attL 78117:78132|attR 111817:111832
DBSCAN-SWA_2 456175 : 525903 87 Shigella_phage(36.73%) capsid,portal,terminase,holin,plate,head,tail,integrase,transposase,protease attL 493706:493721|attR 530863:530878
DBSCAN-SWA_3 633808 : 641326 7 Escherichia_phage(42.86%) NA NA
DBSCAN-SWA_4 688731 : 748777 62 Escherichia_phage(41.51%) capsid,terminase,holin,portal,lysis,plate,tRNA,head,tail,integrase attL 701656:701671|attR 739412:739427
DBSCAN-SWA_5 1933404 : 2001825 57 uncultured_Caudovirales_phage(17.65%) transposase,protease,tRNA NA
DBSCAN-SWA_6 2190922 : 2230429 53 Shigella_phage(45.83%) capsid,portal,terminase,holin,plate,tRNA,head,tail,integrase,protease attL 2181682:2181697|attR 2231763:2231778
DBSCAN-SWA_7 3818824 : 3825964 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_8 4447583 : 4457026 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_9 4468465 : 4566720 96 Escherichia_phage(39.22%) capsid,terminase,portal,holin,lysis,plate,tRNA,head,tail,integrase attL 4450039:4450056|attR 4574586:4574603
DBSCAN-SWA_10 4738549 : 4813343 86 Enterobacteria_phage(38.0%) capsid,terminase,holin,lysis,tRNA,head,tail,integrase,transposase attL 4738402:4738461|attR 4812737:4813454
DBSCAN-SWA_11 5032062 : 5083947 58 Escherichia_phage(53.19%) terminase,holin,lysis,tRNA,tail,integrase attL 5022958:5022973|attR 5065942:5065957

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage