Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP029092 Pseudomonas aeruginosa strain AR441 plasmid unnamed2, complete sequence 1 crisprs DEDDh 1 3 0 0
NZ_CP029094 Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence 1 crisprs RT,DEDDh 0 1 2 0
NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 1 crisprs cas1,csf3gr5,DinG,cas6f,csf2gr7,c2c9_V-U4 0 31 0 0
NZ_CP029093 Pseudomonas aeruginosa strain AR441 chromosome, complete genome 7 crisprs csa3,RT,DEDDh,cas3,cas6f,DinG,WYL,PD-DExK 3 16 11 1

Results visualization

1. NZ_CP029092
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029092_1 41852-42009 Orphan NA
3 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_CP029092.1 42101-42121 0 1.0

1. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to position: 42101-42121, mismatch: 0, identity: 1.0

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaattg	Protospacer
*********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 NZ_CP029092 Pseudomonas aeruginosa strain AR441 plasmid unnamed2, complete sequence 41876-41897 0 1.0
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 NZ_CP027168 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed1, complete sequence 13319-13340 0 1.0
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_KP873171 Pseudomonas aeruginosa PAO1 plasmid pAMBL2, complete sequence 3433-3453 0 1.0
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_CP016446 Pseudomonas putida strain IEC33019 plasmid pIEC33019, complete sequence 4189-4209 0 1.0
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NC_010891 Pseudomonas sp. CT14 plasmid pCT14, complete sequence 1857-1877 0 1.0
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_CP014061 Pseudomonas monteilii strain FDAARGOS_171 plasmid unnamed, complete sequence 18254-18274 0 1.0
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NC_019906 Pseudomonas putida HB3267 plasmid pPC9, complete sequence 39773-39793 0 1.0
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_MK671725 Pseudomonas mosselii strain AM/94 plasmid pMOS94, complete sequence 1145-1165 0 1.0
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_MK671726 Pseudomonas mendocina strain 57 plasmid pAER57, complete sequence 1145-1165 0 1.0
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_MK047610 Pseudomonas aeruginosa strain 163940 plasmid pTROUS1, complete sequence 13703-13723 0 1.0
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_CP042181 Pseudomonas sp. KBS0802 plasmid unnamed, complete sequence 115198-115218 0 1.0
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_CP029092 Pseudomonas aeruginosa strain AR441 plasmid unnamed2, complete sequence 41922-41942 0 1.0
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_CP029092 Pseudomonas aeruginosa strain AR441 plasmid unnamed2, complete sequence 42101-42121 0 1.0
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 266840-266860 0 1.0
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_CP027168 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed1, complete sequence 13365-13385 0 1.0
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_CP027168 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed1, complete sequence 13544-13564 0 1.0
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NC_003350 Pseudomonas putida plasmid pWW0, complete sequence 368-388 0 1.0
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 KY630469 Pseudomonas aeruginosa plasmid pCB58, complete sequence 22697-22717 0 1.0
NZ_CP029092_1 1.3|41967|19|NZ_CP029092|CRISPRCasFinder 41967-41985 19 NZ_CP029092 Pseudomonas aeruginosa strain AR441 plasmid unnamed2, complete sequence 41967-41985 0 1.0
NZ_CP029092_1 1.3|41967|19|NZ_CP029092|CRISPRCasFinder 41967-41985 19 NZ_CP027168 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed1, complete sequence 13410-13428 0 1.0
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 NZ_KP873171 Pseudomonas aeruginosa PAO1 plasmid pAMBL2, complete sequence 3657-3678 1 0.955
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 NZ_CP016446 Pseudomonas putida strain IEC33019 plasmid pIEC33019, complete sequence 4413-4434 1 0.955
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 NC_010891 Pseudomonas sp. CT14 plasmid pCT14, complete sequence 2081-2102 1 0.955
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 NC_019906 Pseudomonas putida HB3267 plasmid pPC9, complete sequence 39997-40018 1 0.955
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 KY630469 Pseudomonas aeruginosa plasmid pCB58, complete sequence 22472-22493 1 0.955
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 MN961669 Pseudomonas monteilii strain 918607 plasmid p918607-IMP, complete sequence 1366-1387 1 0.955
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 NZ_MK671725 Pseudomonas mosselii strain AM/94 plasmid pMOS94, complete sequence 1369-1390 1 0.955
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 NZ_MK671726 Pseudomonas mendocina strain 57 plasmid pAER57, complete sequence 1369-1390 1 0.955
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 NZ_MK047610 Pseudomonas aeruginosa strain 163940 plasmid pTROUS1, complete sequence 13928-13949 1 0.955
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_MK671726 Pseudomonas mendocina strain 57 plasmid pAER57, complete sequence 79372-79392 1 0.952
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_CP024631 Pseudomonas aeruginosa strain PA59 plasmid unnamed1, complete sequence 31269-31289 1 0.952
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_CP027175 Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1 52635-52655 1 0.952
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 MN961669 Pseudomonas monteilii strain 918607 plasmid p918607-IMP, complete sequence 1142-1162 1 0.952
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_MH734334 Pseudomonas aeruginosa strain 1011 plasmid p1011-KPC2, complete sequence 8021-8041 1 0.952
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_CP015000 Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence 39662-39682 1 0.952
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 MN961673 Pseudomonas aeruginosa strain PA15W plasmid pPA15W-IMP, complete sequence 2981-3001 1 0.952
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_MN433456 Pseudomonas aeruginosa strain PAB546 plasmid unnamed, complete sequence 51007-51027 1 0.952
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_MF564291 Pseudomonas putida strain KSS14 plasmid pVIM_Pse-KSS14, complete sequence 45016-45036 1 0.952
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 NZ_CP029092 Pseudomonas aeruginosa strain AR441 plasmid unnamed2, complete sequence 41852-41873 2 0.909
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 NZ_CP027168 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed1, complete sequence 13295-13316 2 0.909
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 NZ_KP873171 Pseudomonas aeruginosa PAO1 plasmid pAMBL2, complete sequence 3590-3611 2 0.909
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 NZ_CP016446 Pseudomonas putida strain IEC33019 plasmid pIEC33019, complete sequence 4346-4367 2 0.909
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 NC_019906 Pseudomonas putida HB3267 plasmid pPC9, complete sequence 39930-39951 2 0.909
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 KY630469 Pseudomonas aeruginosa plasmid pCB58, complete sequence 22539-22560 2 0.909
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 NZ_MK671725 Pseudomonas mosselii strain AM/94 plasmid pMOS94, complete sequence 1302-1323 2 0.909
NZ_CP029092_1 1.1|41876|22|NZ_CP029092|CRISPRCasFinder 41876-41897 22 NZ_MK671726 Pseudomonas mendocina strain 57 plasmid pAER57, complete sequence 1302-1323 2 0.909
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_KP873171 Pseudomonas aeruginosa PAO1 plasmid pAMBL2, complete sequence 3547-3567 2 0.905
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_CP016446 Pseudomonas putida strain IEC33019 plasmid pIEC33019, complete sequence 4303-4323 2 0.905
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NC_010891 Pseudomonas sp. CT14 plasmid pCT14, complete sequence 1971-1991 2 0.905
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NC_019906 Pseudomonas putida HB3267 plasmid pPC9, complete sequence 39887-39907 2 0.905
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_MK671725 Pseudomonas mosselii strain AM/94 plasmid pMOS94, complete sequence 1259-1279 2 0.905
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_MK671726 Pseudomonas mendocina strain 57 plasmid pAER57, complete sequence 1259-1279 2 0.905
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_MK047610 Pseudomonas aeruginosa strain 163940 plasmid pTROUS1, complete sequence 13818-13838 2 0.905
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_CP029092 Pseudomonas aeruginosa strain AR441 plasmid unnamed2, complete sequence 41987-42007 2 0.905
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 NZ_CP027168 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed1, complete sequence 13430-13450 2 0.905
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 KY630469 Pseudomonas aeruginosa plasmid pCB58, complete sequence 22583-22603 2 0.905
NZ_CP029092_1 1.2|41922|21|NZ_CP029092|CRISPRCasFinder 41922-41942 21 MN961669 Pseudomonas monteilii strain 918607 plasmid p918607-IMP, complete sequence 1256-1276 2 0.905

1. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to NZ_CP029092 (Pseudomonas aeruginosa strain AR441 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tggtccctggagtgacgaaccc	CRISPR spacer
tggtccctggagtgacgaaccc	Protospacer
**********************

2. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to NZ_CP027168 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tggtccctggagtgacgaaccc	CRISPR spacer
tggtccctggagtgacgaaccc	Protospacer
**********************

3. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_KP873171 (Pseudomonas aeruginosa PAO1 plasmid pAMBL2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaattg	Protospacer
*********************

4. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_CP016446 (Pseudomonas putida strain IEC33019 plasmid pIEC33019, complete sequence) position: , mismatch: 0, identity: 1.0

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaattg	Protospacer
*********************

5. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NC_010891 (Pseudomonas sp. CT14 plasmid pCT14, complete sequence) position: , mismatch: 0, identity: 1.0

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaattg	Protospacer
*********************

6. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_CP014061 (Pseudomonas monteilii strain FDAARGOS_171 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaattg	Protospacer
*********************

7. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NC_019906 (Pseudomonas putida HB3267 plasmid pPC9, complete sequence) position: , mismatch: 0, identity: 1.0

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaattg	Protospacer
*********************

8. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_MK671725 (Pseudomonas mosselii strain AM/94 plasmid pMOS94, complete sequence) position: , mismatch: 0, identity: 1.0

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaattg	Protospacer
*********************

9. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_MK671726 (Pseudomonas mendocina strain 57 plasmid pAER57, complete sequence) position: , mismatch: 0, identity: 1.0

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaattg	Protospacer
*********************

10. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_MK047610 (Pseudomonas aeruginosa strain 163940 plasmid pTROUS1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaattg	Protospacer
*********************

11. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_CP042181 (Pseudomonas sp. KBS0802 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaattg	Protospacer
*********************

12. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_CP029092 (Pseudomonas aeruginosa strain AR441 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaattg	Protospacer
*********************

13. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_CP029092 (Pseudomonas aeruginosa strain AR441 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaattg	Protospacer
*********************

14. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 0, identity: 1.0

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaattg	Protospacer
*********************

15. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_CP027168 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaattg	Protospacer
*********************

16. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_CP027168 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaattg	Protospacer
*********************

17. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NC_003350 (Pseudomonas putida plasmid pWW0, complete sequence) position: , mismatch: 0, identity: 1.0

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaattg	Protospacer
*********************

18. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to KY630469 (Pseudomonas aeruginosa plasmid pCB58, complete sequence) position: , mismatch: 0, identity: 1.0

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaattg	Protospacer
*********************

19. spacer 1.3|41967|19|NZ_CP029092|CRISPRCasFinder matches to NZ_CP029092 (Pseudomonas aeruginosa strain AR441 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

taggccgcgaaattgagcg	CRISPR spacer
taggccgcgaaattgagcg	Protospacer
*******************

20. spacer 1.3|41967|19|NZ_CP029092|CRISPRCasFinder matches to NZ_CP027168 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

taggccgcgaaattgagcg	CRISPR spacer
taggccgcgaaattgagcg	Protospacer
*******************

21. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to NZ_KP873171 (Pseudomonas aeruginosa PAO1 plasmid pAMBL2, complete sequence) position: , mismatch: 1, identity: 0.955

tggtccctggagtgacgaaccc	CRISPR spacer
cggtccctggagtgacgaaccc	Protospacer
.*********************

22. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to NZ_CP016446 (Pseudomonas putida strain IEC33019 plasmid pIEC33019, complete sequence) position: , mismatch: 1, identity: 0.955

tggtccctggagtgacgaaccc	CRISPR spacer
cggtccctggagtgacgaaccc	Protospacer
.*********************

23. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to NC_010891 (Pseudomonas sp. CT14 plasmid pCT14, complete sequence) position: , mismatch: 1, identity: 0.955

tggtccctggagtgacgaaccc	CRISPR spacer
cggtccctggagtgacgaaccc	Protospacer
.*********************

24. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to NC_019906 (Pseudomonas putida HB3267 plasmid pPC9, complete sequence) position: , mismatch: 1, identity: 0.955

tggtccctggagtgacgaaccc	CRISPR spacer
cggtccctggagtgacgaaccc	Protospacer
.*********************

25. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to KY630469 (Pseudomonas aeruginosa plasmid pCB58, complete sequence) position: , mismatch: 1, identity: 0.955

tggtccctggagtgacgaaccc	CRISPR spacer
cggtccctggagtgacgaaccc	Protospacer
.*********************

26. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to MN961669 (Pseudomonas monteilii strain 918607 plasmid p918607-IMP, complete sequence) position: , mismatch: 1, identity: 0.955

tggtccctggagtgacgaaccc	CRISPR spacer
cggtccctggagtgacgaaccc	Protospacer
.*********************

27. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to NZ_MK671725 (Pseudomonas mosselii strain AM/94 plasmid pMOS94, complete sequence) position: , mismatch: 1, identity: 0.955

tggtccctggagtgacgaaccc	CRISPR spacer
cggtccctggagtgacgaaccc	Protospacer
.*********************

28. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to NZ_MK671726 (Pseudomonas mendocina strain 57 plasmid pAER57, complete sequence) position: , mismatch: 1, identity: 0.955

tggtccctggagtgacgaaccc	CRISPR spacer
cggtccctggagtgacgaaccc	Protospacer
.*********************

29. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to NZ_MK047610 (Pseudomonas aeruginosa strain 163940 plasmid pTROUS1, complete sequence) position: , mismatch: 1, identity: 0.955

tggtccctggagtgacgaaccc	CRISPR spacer
cggtccctggagtgacgaaccc	Protospacer
.*********************

30. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_MK671726 (Pseudomonas mendocina strain 57 plasmid pAER57, complete sequence) position: , mismatch: 1, identity: 0.952

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaatgg	Protospacer
******************* *

31. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_CP024631 (Pseudomonas aeruginosa strain PA59 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctgaagtgacgaattg	Protospacer
********.************

32. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_CP027175 (Pseudomonas aeruginosa strain AR_0230 plasmid unnamed1) position: , mismatch: 1, identity: 0.952

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctgaagtgacgaattg	Protospacer
********.************

33. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to MN961669 (Pseudomonas monteilii strain 918607 plasmid p918607-IMP, complete sequence) position: , mismatch: 1, identity: 0.952

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctgaagtgacgaattg	Protospacer
********.************

34. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_MH734334 (Pseudomonas aeruginosa strain 1011 plasmid p1011-KPC2, complete sequence) position: , mismatch: 1, identity: 0.952

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctgaagtgacgaattg	Protospacer
********.************

35. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_CP015000 (Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence) position: , mismatch: 1, identity: 0.952

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctgaagtgacgaattg	Protospacer
********.************

36. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to MN961673 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-IMP, complete sequence) position: , mismatch: 1, identity: 0.952

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaatgg	Protospacer
******************* *

37. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_MN433456 (Pseudomonas aeruginosa strain PAB546 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctgaagtgacgaattg	Protospacer
********.************

38. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_MF564291 (Pseudomonas putida strain KSS14 plasmid pVIM_Pse-KSS14, complete sequence) position: , mismatch: 1, identity: 0.952

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaatgg	Protospacer
******************* *

39. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to NZ_CP029092 (Pseudomonas aeruginosa strain AR441 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909

tggtccctggagtgacgaaccc	CRISPR spacer
tggtccctggagtgacgaaatc	Protospacer
******************* .*

40. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to NZ_CP027168 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

tggtccctggagtgacgaaccc	CRISPR spacer
tggtccctggagtgacgaaatc	Protospacer
******************* .*

41. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to NZ_KP873171 (Pseudomonas aeruginosa PAO1 plasmid pAMBL2, complete sequence) position: , mismatch: 2, identity: 0.909

tggtccctggagtgacgaaccc	CRISPR spacer
cggtccctggagtgacgaaccg	Protospacer
.******************** 

42. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to NZ_CP016446 (Pseudomonas putida strain IEC33019 plasmid pIEC33019, complete sequence) position: , mismatch: 2, identity: 0.909

tggtccctggagtgacgaaccc	CRISPR spacer
cggtccctggagtgacgaaccg	Protospacer
.******************** 

43. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to NC_019906 (Pseudomonas putida HB3267 plasmid pPC9, complete sequence) position: , mismatch: 2, identity: 0.909

tggtccctggagtgacgaaccc	CRISPR spacer
cggtccctggagtgacgaaccg	Protospacer
.******************** 

44. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to KY630469 (Pseudomonas aeruginosa plasmid pCB58, complete sequence) position: , mismatch: 2, identity: 0.909

tggtccctggagtgacgaaccc	CRISPR spacer
cggtccctggagtgacgaaccg	Protospacer
.******************** 

45. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to NZ_MK671725 (Pseudomonas mosselii strain AM/94 plasmid pMOS94, complete sequence) position: , mismatch: 2, identity: 0.909

tggtccctggagtgacgaaccc	CRISPR spacer
cggtccctggagtgacgaaccg	Protospacer
.******************** 

46. spacer 1.1|41876|22|NZ_CP029092|CRISPRCasFinder matches to NZ_MK671726 (Pseudomonas mendocina strain 57 plasmid pAER57, complete sequence) position: , mismatch: 2, identity: 0.909

tggtccctggagtgacgaaccc	CRISPR spacer
cggtccctggagtgacgaaccg	Protospacer
.******************** 

47. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_KP873171 (Pseudomonas aeruginosa PAO1 plasmid pAMBL2, complete sequence) position: , mismatch: 2, identity: 0.905

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaatgc	Protospacer
*******************  

48. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_CP016446 (Pseudomonas putida strain IEC33019 plasmid pIEC33019, complete sequence) position: , mismatch: 2, identity: 0.905

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaatgc	Protospacer
*******************  

49. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NC_010891 (Pseudomonas sp. CT14 plasmid pCT14, complete sequence) position: , mismatch: 2, identity: 0.905

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaatgc	Protospacer
*******************  

50. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NC_019906 (Pseudomonas putida HB3267 plasmid pPC9, complete sequence) position: , mismatch: 2, identity: 0.905

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaatgc	Protospacer
*******************  

51. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_MK671725 (Pseudomonas mosselii strain AM/94 plasmid pMOS94, complete sequence) position: , mismatch: 2, identity: 0.905

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaatgc	Protospacer
*******************  

52. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_MK671726 (Pseudomonas mendocina strain 57 plasmid pAER57, complete sequence) position: , mismatch: 2, identity: 0.905

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaatgc	Protospacer
*******************  

53. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_MK047610 (Pseudomonas aeruginosa strain 163940 plasmid pTROUS1, complete sequence) position: , mismatch: 2, identity: 0.905

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaatgc	Protospacer
*******************  

54. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_CP029092 (Pseudomonas aeruginosa strain AR441 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.905

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaatgc	Protospacer
*******************  

55. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to NZ_CP027168 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.905

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaatgc	Protospacer
*******************  

56. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to KY630469 (Pseudomonas aeruginosa plasmid pCB58, complete sequence) position: , mismatch: 2, identity: 0.905

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaatgc	Protospacer
*******************  

57. spacer 1.2|41922|21|NZ_CP029092|CRISPRCasFinder matches to MN961669 (Pseudomonas monteilii strain 918607 plasmid p918607-IMP, complete sequence) position: , mismatch: 2, identity: 0.905

ggtccctggagtgacgaattg	CRISPR spacer
ggtccctggagtgacgaatgc	Protospacer
*******************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP029094
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029094_1 46607-46697 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 NZ_KY494864 Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence 210483-210523 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 NZ_LT969519 Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1 261776-261816 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 209981-210021 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 NZ_CP029094 Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence 46632-46672 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 NZ_CP040126 Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence 204332-204372 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 276754-276794 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 26560-26600 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 26718-26758 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 78860-78900 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 43166-43206 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 352191-352231 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 29967-30007 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 MF344571 Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence 28146-28186 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 MF344568 Pseudomonas aeruginosa plasmid p727-IMP, complete sequence 28146-28186 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 27912-27952 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 29321-29361 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 NZ_CP039294 Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence 253492-253532 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 104459-104499 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 NZ_CP027170 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence 312303-312343 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 NZ_CP015879 Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence 330180-330220 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 NZ_KY883660 Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence 29343-29383 0 1.0
NZ_CP029094_1 1.1|46632|41|NZ_CP029094|CRISPRCasFinder 46632-46672 41 NZ_KU130294 Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence 26766-26806 1 0.976

1. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

2. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

3. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

4. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to NZ_CP029094 (Pseudomonas aeruginosa strain AR441 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

5. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to NZ_CP040126 (Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

6. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

7. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

8. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

9. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

10. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

11. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

12. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

13. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

14. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to MF344568 (Pseudomonas aeruginosa plasmid p727-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

15. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

16. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

17. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to NZ_CP039294 (Pseudomonas aeruginosa strain PABL048 plasmid pPABL048, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

18. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

19. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to NZ_CP027170 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

20. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

21. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaagtcatcagccggaaaatttg	Protospacer
*****************************************

22. spacer 1.1|46632|41|NZ_CP029094|CRISPRCasFinder matches to NZ_KU130294 (Pseudomonas putida strain 12969 plasmid p12969-DIM, complete sequence) position: , mismatch: 1, identity: 0.976

aaccggatgctccgcaggaaagtcatcagccggaaaatttg	CRISPR spacer
aaccggatgctccgcaggaaggtcatcagccggaaaatttg	Protospacer
********************.********************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 257617 : 308862 51 Salmonella_phage(21.43%) integrase,transposase attL 253276:253295|attR 308859:308878
DBSCAN-SWA_2 383154 : 390608 9 Acinetobacter_phage(33.33%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP029091
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029091_1 68798-69546 TypeIV-A NA
12 spacers
cas1,csf3gr5,DinG,cas6f,csf2gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP029091_1 1.1|68826|32|NZ_CP029091|CRISPRCasFinder 68826-68857 32 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 68826-68857 0 1.0
NZ_CP029091_1 1.1|68826|32|NZ_CP029091|CRISPRCasFinder 68826-68857 32 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45972-46003 0 1.0
NZ_CP029091_1 1.2|68886|32|NZ_CP029091|CRISPRCasFinder 68886-68917 32 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 68886-68917 0 1.0
NZ_CP029091_1 1.2|68886|32|NZ_CP029091|CRISPRCasFinder 68886-68917 32 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45912-45943 0 1.0
NZ_CP029091_1 1.3|68946|32|NZ_CP029091|CRISPRCasFinder 68946-68977 32 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 68946-68977 0 1.0
NZ_CP029091_1 1.3|68946|32|NZ_CP029091|CRISPRCasFinder 68946-68977 32 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45852-45883 0 1.0
NZ_CP029091_1 1.4|69006|32|NZ_CP029091|CRISPRCasFinder 69006-69037 32 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69006-69037 0 1.0
NZ_CP029091_1 1.4|69006|32|NZ_CP029091|CRISPRCasFinder 69006-69037 32 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45792-45823 0 1.0
NZ_CP029091_1 1.5|69066|30|NZ_CP029091|CRISPRCasFinder 69066-69095 30 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45734-45763 0 1.0
NZ_CP029091_1 1.5|69066|30|NZ_CP029091|CRISPRCasFinder 69066-69095 30 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69066-69095 0 1.0
NZ_CP029091_1 1.6|69124|32|NZ_CP029091|CRISPRCasFinder 69124-69155 32 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69124-69155 0 1.0
NZ_CP029091_1 1.6|69124|32|NZ_CP029091|CRISPRCasFinder 69124-69155 32 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45674-45705 0 1.0
NZ_CP029091_1 1.7|69184|32|NZ_CP029091|CRISPRCasFinder 69184-69215 32 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69184-69215 0 1.0
NZ_CP029091_1 1.7|69184|32|NZ_CP029091|CRISPRCasFinder 69184-69215 32 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45614-45645 0 1.0
NZ_CP029091_1 1.8|69244|33|NZ_CP029091|CRISPRCasFinder 69244-69276 33 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69244-69276 0 1.0
NZ_CP029091_1 1.8|69244|33|NZ_CP029091|CRISPRCasFinder 69244-69276 33 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45553-45585 0 1.0
NZ_CP029091_1 1.9|69305|32|NZ_CP029091|CRISPRCasFinder 69305-69336 32 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69305-69336 0 1.0
NZ_CP029091_1 1.9|69305|32|NZ_CP029091|CRISPRCasFinder 69305-69336 32 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45493-45524 0 1.0
NZ_CP029091_1 1.10|69365|32|NZ_CP029091|CRISPRCasFinder 69365-69396 32 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69365-69396 0 1.0
NZ_CP029091_1 1.10|69365|32|NZ_CP029091|CRISPRCasFinder 69365-69396 32 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45433-45464 0 1.0
NZ_CP029091_1 1.11|69425|33|NZ_CP029091|CRISPRCasFinder 69425-69457 33 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69425-69457 0 1.0
NZ_CP029091_1 1.11|69425|33|NZ_CP029091|CRISPRCasFinder 69425-69457 33 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45372-45404 0 1.0
NZ_CP029091_1 1.12|69486|33|NZ_CP029091|CRISPRCasFinder 69486-69518 33 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69486-69518 0 1.0
NZ_CP029091_1 1.12|69486|33|NZ_CP029091|CRISPRCasFinder 69486-69518 33 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45311-45343 0 1.0
NZ_CP029091_1 1.13|68826|33|NZ_CP029091|CRT 68826-68858 33 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 68826-68858 0 1.0
NZ_CP029091_1 1.13|68826|33|NZ_CP029091|CRT 68826-68858 33 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45971-46003 0 1.0
NZ_CP029091_1 1.14|68886|33|NZ_CP029091|CRT 68886-68918 33 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 68886-68918 0 1.0
NZ_CP029091_1 1.14|68886|33|NZ_CP029091|CRT 68886-68918 33 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45911-45943 0 1.0
NZ_CP029091_1 1.15|68946|33|NZ_CP029091|CRT 68946-68978 33 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 68946-68978 0 1.0
NZ_CP029091_1 1.15|68946|33|NZ_CP029091|CRT 68946-68978 33 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45851-45883 0 1.0
NZ_CP029091_1 1.16|69006|33|NZ_CP029091|CRT 69006-69038 33 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45791-45823 0 1.0
NZ_CP029091_1 1.16|69006|33|NZ_CP029091|CRT 69006-69038 33 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69006-69038 0 1.0
NZ_CP029091_1 1.17|69066|31|NZ_CP029091|CRT 69066-69096 31 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69066-69096 0 1.0
NZ_CP029091_1 1.17|69066|31|NZ_CP029091|CRT 69066-69096 31 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45733-45763 0 1.0
NZ_CP029091_1 1.18|69124|33|NZ_CP029091|CRT 69124-69156 33 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69124-69156 0 1.0
NZ_CP029091_1 1.18|69124|33|NZ_CP029091|CRT 69124-69156 33 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45673-45705 0 1.0
NZ_CP029091_1 1.19|69184|33|NZ_CP029091|CRT 69184-69216 33 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69184-69216 0 1.0
NZ_CP029091_1 1.19|69184|33|NZ_CP029091|CRT 69184-69216 33 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45613-45645 0 1.0
NZ_CP029091_1 1.20|69244|34|NZ_CP029091|CRT 69244-69277 34 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45552-45585 0 1.0
NZ_CP029091_1 1.20|69244|34|NZ_CP029091|CRT 69244-69277 34 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69244-69277 0 1.0
NZ_CP029091_1 1.21|69305|33|NZ_CP029091|CRT 69305-69337 33 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69305-69337 0 1.0
NZ_CP029091_1 1.21|69305|33|NZ_CP029091|CRT 69305-69337 33 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45492-45524 0 1.0
NZ_CP029091_1 1.22|69365|33|NZ_CP029091|CRT 69365-69397 33 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69365-69397 0 1.0
NZ_CP029091_1 1.22|69365|33|NZ_CP029091|CRT 69365-69397 33 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45432-45464 0 1.0
NZ_CP029091_1 1.23|69425|34|NZ_CP029091|CRT 69425-69458 34 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45371-45404 0 1.0
NZ_CP029091_1 1.23|69425|34|NZ_CP029091|CRT 69425-69458 34 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69425-69458 0 1.0
NZ_CP029091_1 1.24|69486|34|NZ_CP029091|CRT 69486-69519 34 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69486-69519 0 1.0
NZ_CP029091_1 1.24|69486|34|NZ_CP029091|CRT 69486-69519 34 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45310-45343 0 1.0
NZ_CP029091_1 1.25|69126|33|NZ_CP029091|PILER-CR 69126-69158 33 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69124-69156 0 1.0
NZ_CP029091_1 1.25|69126|33|NZ_CP029091|PILER-CR 69126-69158 33 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45673-45705 0 1.0
NZ_CP029091_1 1.26|69186|33|NZ_CP029091|PILER-CR 69186-69218 33 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69184-69216 0 1.0
NZ_CP029091_1 1.26|69186|33|NZ_CP029091|PILER-CR 69186-69218 33 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45613-45645 0 1.0
NZ_CP029091_1 1.27|69246|34|NZ_CP029091|PILER-CR 69246-69279 34 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45552-45585 0 1.0
NZ_CP029091_1 1.27|69246|34|NZ_CP029091|PILER-CR 69246-69279 34 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69244-69277 0 1.0
NZ_CP029091_1 1.28|69307|33|NZ_CP029091|PILER-CR 69307-69339 33 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69305-69337 0 1.0
NZ_CP029091_1 1.28|69307|33|NZ_CP029091|PILER-CR 69307-69339 33 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45492-45524 0 1.0
NZ_CP029091_1 1.29|69367|33|NZ_CP029091|PILER-CR 69367-69399 33 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69365-69397 0 1.0
NZ_CP029091_1 1.29|69367|33|NZ_CP029091|PILER-CR 69367-69399 33 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45432-45464 0 1.0
NZ_CP029091_1 1.30|69427|34|NZ_CP029091|PILER-CR 69427-69460 34 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45371-45404 0 1.0
NZ_CP029091_1 1.30|69427|34|NZ_CP029091|PILER-CR 69427-69460 34 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69425-69458 0 1.0
NZ_CP029091_1 1.31|69488|34|NZ_CP029091|PILER-CR 69488-69521 34 NZ_CP029091 Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence 69486-69519 0 1.0
NZ_CP029091_1 1.31|69488|34|NZ_CP029091|PILER-CR 69488-69521 34 NZ_CP027167 Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence 45310-45343 0 1.0
NZ_CP029091_1 1.11|69425|33|NZ_CP029091|CRISPRCasFinder 69425-69457 33 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1566104-1566136 4 0.879
NZ_CP029091_1 1.11|69425|33|NZ_CP029091|CRISPRCasFinder 69425-69457 33 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 41951-41983 4 0.879
NZ_CP029091_1 1.5|69066|30|NZ_CP029091|CRISPRCasFinder 69066-69095 30 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 201612-201641 5 0.833
NZ_CP029091_1 1.5|69066|30|NZ_CP029091|CRISPRCasFinder 69066-69095 30 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 714019-714048 5 0.833
NZ_CP029091_1 1.5|69066|30|NZ_CP029091|CRISPRCasFinder 69066-69095 30 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 714019-714048 5 0.833
NZ_CP029091_1 1.11|69425|33|NZ_CP029091|CRISPRCasFinder 69425-69457 33 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 443820-443852 5 0.848
NZ_CP029091_1 1.11|69425|33|NZ_CP029091|CRISPRCasFinder 69425-69457 33 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 443803-443835 5 0.848
NZ_CP029091_1 1.23|69425|34|NZ_CP029091|CRT 69425-69458 34 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 41950-41983 5 0.853
NZ_CP029091_1 1.23|69425|34|NZ_CP029091|CRT 69425-69458 34 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1566104-1566137 5 0.853
NZ_CP029091_1 1.30|69427|34|NZ_CP029091|PILER-CR 69427-69460 34 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 41950-41983 5 0.853
NZ_CP029091_1 1.30|69427|34|NZ_CP029091|PILER-CR 69427-69460 34 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1566104-1566137 5 0.853
NZ_CP029091_1 1.17|69066|31|NZ_CP029091|CRT 69066-69096 31 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 714019-714049 6 0.806
NZ_CP029091_1 1.17|69066|31|NZ_CP029091|CRT 69066-69096 31 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 201611-201641 6 0.806
NZ_CP029091_1 1.17|69066|31|NZ_CP029091|CRT 69066-69096 31 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 714019-714049 6 0.806
NZ_CP029091_1 1.23|69425|34|NZ_CP029091|CRT 69425-69458 34 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 443819-443852 6 0.824
NZ_CP029091_1 1.23|69425|34|NZ_CP029091|CRT 69425-69458 34 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 443802-443835 6 0.824
NZ_CP029091_1 1.30|69427|34|NZ_CP029091|PILER-CR 69427-69460 34 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 443819-443852 6 0.824
NZ_CP029091_1 1.30|69427|34|NZ_CP029091|PILER-CR 69427-69460 34 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 443802-443835 6 0.824
NZ_CP029091_1 1.3|68946|32|NZ_CP029091|CRISPRCasFinder 68946-68977 32 NZ_CP007257 Rhodococcus erythropolis R138 plasmid pLRE138, complete sequence 285673-285704 7 0.781
NZ_CP029091_1 1.5|69066|30|NZ_CP029091|CRISPRCasFinder 69066-69095 30 NC_011981 Agrobacterium vitis S4 plasmid pAtS4e, complete sequence 323559-323588 7 0.767
NZ_CP029091_1 1.24|69486|34|NZ_CP029091|CRT 69486-69519 34 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 1355518-1355551 7 0.794
NZ_CP029091_1 1.24|69486|34|NZ_CP029091|CRT 69486-69519 34 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 1355496-1355529 7 0.794
NZ_CP029091_1 1.31|69488|34|NZ_CP029091|PILER-CR 69488-69521 34 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 1355518-1355551 7 0.794
NZ_CP029091_1 1.31|69488|34|NZ_CP029091|PILER-CR 69488-69521 34 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 1355496-1355529 7 0.794
NZ_CP029091_1 1.5|69066|30|NZ_CP029091|CRISPRCasFinder 69066-69095 30 NZ_CP034329 Tabrizicola piscis strain K13M18 plasmid unnamed1, complete sequence 100442-100471 8 0.733
NZ_CP029091_1 1.9|69305|32|NZ_CP029091|CRISPRCasFinder 69305-69336 32 NZ_CP009295 Novosphingobium pentaromativorans US6-1 plasmid pLA5, complete sequence 83810-83841 8 0.75
NZ_CP029091_1 1.9|69305|32|NZ_CP029091|CRISPRCasFinder 69305-69336 32 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 441037-441068 8 0.75
NZ_CP029091_1 1.9|69305|32|NZ_CP029091|CRISPRCasFinder 69305-69336 32 NC_008036 Sphingopyxis alaskensis RB2256 F plasmid, complete sequence 16141-16172 8 0.75
NZ_CP029091_1 1.9|69305|32|NZ_CP029091|CRISPRCasFinder 69305-69336 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2615877-2615908 8 0.75
NZ_CP029091_1 1.11|69425|33|NZ_CP029091|CRISPRCasFinder 69425-69457 33 NZ_CP016834 Xanthomonas fragariae isolate Fap29 plasmid pFap29-1, complete sequence 17123-17155 8 0.758
NZ_CP029091_1 1.11|69425|33|NZ_CP029091|CRISPRCasFinder 69425-69457 33 NZ_LT853886 Xanthomonas fragariae strain PD5205 plasmid pPD5205-30, complete sequence 18400-18432 8 0.758
NZ_CP029091_1 1.11|69425|33|NZ_CP029091|CRISPRCasFinder 69425-69457 33 NZ_CP016831 Xanthomonas fragariae isolate Fap21 plasmid pFap21-1, complete sequence 6479-6511 8 0.758
NZ_CP029091_1 1.11|69425|33|NZ_CP029091|CRISPRCasFinder 69425-69457 33 NC_017555 Xanthomonas albilineans str. GPE PC73, plasmid, complete genome 13581-13613 8 0.758
NZ_CP029091_1 1.11|69425|33|NZ_CP029091|CRISPRCasFinder 69425-69457 33 NZ_LT853883 Xanthomonas fragariae strain PD885 plasmid pPD885-29, complete sequence 17163-17195 8 0.758
NZ_CP029091_1 1.12|69486|33|NZ_CP029091|CRISPRCasFinder 69486-69518 33 NC_019408 Caulobacter phage CcrRogue, complete genome 132818-132850 8 0.758
NZ_CP029091_1 1.15|68946|33|NZ_CP029091|CRT 68946-68978 33 NZ_CP007257 Rhodococcus erythropolis R138 plasmid pLRE138, complete sequence 285672-285704 8 0.758
NZ_CP029091_1 1.17|69066|31|NZ_CP029091|CRT 69066-69096 31 NC_011981 Agrobacterium vitis S4 plasmid pAtS4e, complete sequence 323558-323588 8 0.742
NZ_CP029091_1 1.5|69066|30|NZ_CP029091|CRISPRCasFinder 69066-69095 30 MN694322 Marine virus AFVG_250M1032, complete genome 14313-14342 9 0.7
NZ_CP029091_1 1.11|69425|33|NZ_CP029091|CRISPRCasFinder 69425-69457 33 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1449761-1449793 9 0.727
NZ_CP029091_1 1.11|69425|33|NZ_CP029091|CRISPRCasFinder 69425-69457 33 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 363498-363530 9 0.727
NZ_CP029091_1 1.12|69486|33|NZ_CP029091|CRISPRCasFinder 69486-69518 33 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 1355518-1355550 9 0.727
NZ_CP029091_1 1.12|69486|33|NZ_CP029091|CRISPRCasFinder 69486-69518 33 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 1355496-1355528 9 0.727
NZ_CP029091_1 1.17|69066|31|NZ_CP029091|CRT 69066-69096 31 NZ_CP034329 Tabrizicola piscis strain K13M18 plasmid unnamed1, complete sequence 100442-100472 9 0.71
NZ_CP029091_1 1.23|69425|34|NZ_CP029091|CRT 69425-69458 34 NZ_LT853886 Xanthomonas fragariae strain PD5205 plasmid pPD5205-30, complete sequence 18399-18432 9 0.735
NZ_CP029091_1 1.23|69425|34|NZ_CP029091|CRT 69425-69458 34 NZ_CP016831 Xanthomonas fragariae isolate Fap21 plasmid pFap21-1, complete sequence 6478-6511 9 0.735
NZ_CP029091_1 1.23|69425|34|NZ_CP029091|CRT 69425-69458 34 NC_017555 Xanthomonas albilineans str. GPE PC73, plasmid, complete genome 13580-13613 9 0.735
NZ_CP029091_1 1.23|69425|34|NZ_CP029091|CRT 69425-69458 34 NZ_LT853883 Xanthomonas fragariae strain PD885 plasmid pPD885-29, complete sequence 17162-17195 9 0.735
NZ_CP029091_1 1.23|69425|34|NZ_CP029091|CRT 69425-69458 34 NZ_CP016834 Xanthomonas fragariae isolate Fap29 plasmid pFap29-1, complete sequence 17123-17156 9 0.735
NZ_CP029091_1 1.23|69425|34|NZ_CP029091|CRT 69425-69458 34 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 363497-363530 9 0.735
NZ_CP029091_1 1.23|69425|34|NZ_CP029091|CRT 69425-69458 34 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1449761-1449794 9 0.735
NZ_CP029091_1 1.24|69486|34|NZ_CP029091|CRT 69486-69519 34 NC_019408 Caulobacter phage CcrRogue, complete genome 132817-132850 9 0.735
NZ_CP029091_1 1.30|69427|34|NZ_CP029091|PILER-CR 69427-69460 34 NZ_LT853886 Xanthomonas fragariae strain PD5205 plasmid pPD5205-30, complete sequence 18399-18432 9 0.735
NZ_CP029091_1 1.30|69427|34|NZ_CP029091|PILER-CR 69427-69460 34 NZ_CP016831 Xanthomonas fragariae isolate Fap21 plasmid pFap21-1, complete sequence 6478-6511 9 0.735
NZ_CP029091_1 1.30|69427|34|NZ_CP029091|PILER-CR 69427-69460 34 NC_017555 Xanthomonas albilineans str. GPE PC73, plasmid, complete genome 13580-13613 9 0.735
NZ_CP029091_1 1.30|69427|34|NZ_CP029091|PILER-CR 69427-69460 34 NZ_LT853883 Xanthomonas fragariae strain PD885 plasmid pPD885-29, complete sequence 17162-17195 9 0.735
NZ_CP029091_1 1.30|69427|34|NZ_CP029091|PILER-CR 69427-69460 34 NZ_CP016834 Xanthomonas fragariae isolate Fap29 plasmid pFap29-1, complete sequence 17123-17156 9 0.735
NZ_CP029091_1 1.30|69427|34|NZ_CP029091|PILER-CR 69427-69460 34 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 363497-363530 9 0.735
NZ_CP029091_1 1.30|69427|34|NZ_CP029091|PILER-CR 69427-69460 34 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1449761-1449794 9 0.735
NZ_CP029091_1 1.31|69488|34|NZ_CP029091|PILER-CR 69488-69521 34 NC_019408 Caulobacter phage CcrRogue, complete genome 132817-132850 9 0.735
NZ_CP029091_1 1.8|69244|33|NZ_CP029091|CRISPRCasFinder 69244-69276 33 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1025880-1025912 10 0.697
NZ_CP029091_1 1.9|69305|32|NZ_CP029091|CRISPRCasFinder 69305-69336 32 NZ_CP009295 Novosphingobium pentaromativorans US6-1 plasmid pLA5, complete sequence 83624-83655 10 0.688
NZ_CP029091_1 1.9|69305|32|NZ_CP029091|CRISPRCasFinder 69305-69336 32 NC_008036 Sphingopyxis alaskensis RB2256 F plasmid, complete sequence 16327-16358 10 0.688
NZ_CP029091_1 1.17|69066|31|NZ_CP029091|CRT 69066-69096 31 MN694322 Marine virus AFVG_250M1032, complete genome 14312-14342 10 0.677
NZ_CP029091_1 1.20|69244|34|NZ_CP029091|CRT 69244-69277 34 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1025879-1025912 11 0.676
NZ_CP029091_1 1.27|69246|34|NZ_CP029091|PILER-CR 69246-69279 34 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1025879-1025912 11 0.676

1. spacer 1.1|68826|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctagcccgtctgcccctagatcggtcgattat	CRISPR spacer
ctagcccgtctgcccctagatcggtcgattat	Protospacer
********************************

2. spacer 1.1|68826|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ctagcccgtctgcccctagatcggtcgattat	CRISPR spacer
ctagcccgtctgcccctagatcggtcgattat	Protospacer
********************************

3. spacer 1.2|68886|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aaacagggctcacctcccatttcctgcttatg	CRISPR spacer
aaacagggctcacctcccatttcctgcttatg	Protospacer
********************************

4. spacer 1.2|68886|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

aaacagggctcacctcccatttcctgcttatg	CRISPR spacer
aaacagggctcacctcccatttcctgcttatg	Protospacer
********************************

5. spacer 1.3|68946|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aaaagccgtccgatgacgatgccccactggtt	CRISPR spacer
aaaagccgtccgatgacgatgccccactggtt	Protospacer
********************************

6. spacer 1.3|68946|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

aaaagccgtccgatgacgatgccccactggtt	CRISPR spacer
aaaagccgtccgatgacgatgccccactggtt	Protospacer
********************************

7. spacer 1.4|69006|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtatcccagatacgcaaattcccgagatcgta	CRISPR spacer
gtatcccagatacgcaaattcccgagatcgta	Protospacer
********************************

8. spacer 1.4|69006|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gtatcccagatacgcaaattcccgagatcgta	CRISPR spacer
gtatcccagatacgcaaattcccgagatcgta	Protospacer
********************************

9. spacer 1.5|69066|30|NZ_CP029091|CRISPRCasFinder matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

agtttcgcagccgtcttcaacgattccgca	CRISPR spacer
agtttcgcagccgtcttcaacgattccgca	Protospacer
******************************

10. spacer 1.5|69066|30|NZ_CP029091|CRISPRCasFinder matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agtttcgcagccgtcttcaacgattccgca	CRISPR spacer
agtttcgcagccgtcttcaacgattccgca	Protospacer
******************************

11. spacer 1.6|69124|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgcttgcaatcgtcagtgcgctgactatcgca	CRISPR spacer
tgcttgcaatcgtcagtgcgctgactatcgca	Protospacer
********************************

12. spacer 1.6|69124|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tgcttgcaatcgtcagtgcgctgactatcgca	CRISPR spacer
tgcttgcaatcgtcagtgcgctgactatcgca	Protospacer
********************************

13. spacer 1.7|69184|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatggatagctttgcccttggcagccagcct	CRISPR spacer
gaatggatagctttgcccttggcagccagcct	Protospacer
********************************

14. spacer 1.7|69184|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gaatggatagctttgcccttggcagccagcct	CRISPR spacer
gaatggatagctttgcccttggcagccagcct	Protospacer
********************************

15. spacer 1.8|69244|33|NZ_CP029091|CRISPRCasFinder matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cacccaaggcagccagcgcagtggcatcttcct	CRISPR spacer
cacccaaggcagccagcgcagtggcatcttcct	Protospacer
*********************************

16. spacer 1.8|69244|33|NZ_CP029091|CRISPRCasFinder matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

cacccaaggcagccagcgcagtggcatcttcct	CRISPR spacer
cacccaaggcagccagcgcagtggcatcttcct	Protospacer
*********************************

17. spacer 1.9|69305|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcagcagcagatcggttggctggctcagcac	CRISPR spacer
ggcagcagcagatcggttggctggctcagcac	Protospacer
********************************

18. spacer 1.9|69305|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ggcagcagcagatcggttggctggctcagcac	CRISPR spacer
ggcagcagcagatcggttggctggctcagcac	Protospacer
********************************

19. spacer 1.10|69365|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgggcagattagtcacctgatcgaccgactt	CRISPR spacer
ctgggcagattagtcacctgatcgaccgactt	Protospacer
********************************

20. spacer 1.10|69365|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgggcagattagtcacctgatcgaccgactt	CRISPR spacer
ctgggcagattagtcacctgatcgaccgactt	Protospacer
********************************

21. spacer 1.11|69425|33|NZ_CP029091|CRISPRCasFinder matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacagcggccaccccggcgcccccatgggtatg	CRISPR spacer
aacagcggccaccccggcgcccccatgggtatg	Protospacer
*********************************

22. spacer 1.11|69425|33|NZ_CP029091|CRISPRCasFinder matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

aacagcggccaccccggcgcccccatgggtatg	CRISPR spacer
aacagcggccaccccggcgcccccatgggtatg	Protospacer
*********************************

23. spacer 1.12|69486|33|NZ_CP029091|CRISPRCasFinder matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agtcatgccgagaagctgggccggcgtgtcctg	CRISPR spacer
agtcatgccgagaagctgggccggcgtgtcctg	Protospacer
*********************************

24. spacer 1.12|69486|33|NZ_CP029091|CRISPRCasFinder matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

agtcatgccgagaagctgggccggcgtgtcctg	CRISPR spacer
agtcatgccgagaagctgggccggcgtgtcctg	Protospacer
*********************************

25. spacer 1.13|68826|33|NZ_CP029091|CRT matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctagcccgtctgcccctagatcggtcgattatt	CRISPR spacer
ctagcccgtctgcccctagatcggtcgattatt	Protospacer
*********************************

26. spacer 1.13|68826|33|NZ_CP029091|CRT matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ctagcccgtctgcccctagatcggtcgattatt	CRISPR spacer
ctagcccgtctgcccctagatcggtcgattatt	Protospacer
*********************************

27. spacer 1.14|68886|33|NZ_CP029091|CRT matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aaacagggctcacctcccatttcctgcttatgc	CRISPR spacer
aaacagggctcacctcccatttcctgcttatgc	Protospacer
*********************************

28. spacer 1.14|68886|33|NZ_CP029091|CRT matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

aaacagggctcacctcccatttcctgcttatgc	CRISPR spacer
aaacagggctcacctcccatttcctgcttatgc	Protospacer
*********************************

29. spacer 1.15|68946|33|NZ_CP029091|CRT matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aaaagccgtccgatgacgatgccccactggttc	CRISPR spacer
aaaagccgtccgatgacgatgccccactggttc	Protospacer
*********************************

30. spacer 1.15|68946|33|NZ_CP029091|CRT matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

aaaagccgtccgatgacgatgccccactggttc	CRISPR spacer
aaaagccgtccgatgacgatgccccactggttc	Protospacer
*********************************

31. spacer 1.16|69006|33|NZ_CP029091|CRT matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gtatcccagatacgcaaattcccgagatcgtac	CRISPR spacer
gtatcccagatacgcaaattcccgagatcgtac	Protospacer
*********************************

32. spacer 1.16|69006|33|NZ_CP029091|CRT matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtatcccagatacgcaaattcccgagatcgtac	CRISPR spacer
gtatcccagatacgcaaattcccgagatcgtac	Protospacer
*********************************

33. spacer 1.17|69066|31|NZ_CP029091|CRT matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agtttcgcagccgtcttcaacgattccgcag	CRISPR spacer
agtttcgcagccgtcttcaacgattccgcag	Protospacer
*******************************

34. spacer 1.17|69066|31|NZ_CP029091|CRT matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

agtttcgcagccgtcttcaacgattccgcag	CRISPR spacer
agtttcgcagccgtcttcaacgattccgcag	Protospacer
*******************************

35. spacer 1.18|69124|33|NZ_CP029091|CRT matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgcttgcaatcgtcagtgcgctgactatcgcac	CRISPR spacer
tgcttgcaatcgtcagtgcgctgactatcgcac	Protospacer
*********************************

36. spacer 1.18|69124|33|NZ_CP029091|CRT matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tgcttgcaatcgtcagtgcgctgactatcgcac	CRISPR spacer
tgcttgcaatcgtcagtgcgctgactatcgcac	Protospacer
*********************************

37. spacer 1.19|69184|33|NZ_CP029091|CRT matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatggatagctttgcccttggcagccagcctc	CRISPR spacer
gaatggatagctttgcccttggcagccagcctc	Protospacer
*********************************

38. spacer 1.19|69184|33|NZ_CP029091|CRT matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gaatggatagctttgcccttggcagccagcctc	CRISPR spacer
gaatggatagctttgcccttggcagccagcctc	Protospacer
*********************************

39. spacer 1.20|69244|34|NZ_CP029091|CRT matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

cacccaaggcagccagcgcagtggcatcttccta	CRISPR spacer
cacccaaggcagccagcgcagtggcatcttccta	Protospacer
**********************************

40. spacer 1.20|69244|34|NZ_CP029091|CRT matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cacccaaggcagccagcgcagtggcatcttccta	CRISPR spacer
cacccaaggcagccagcgcagtggcatcttccta	Protospacer
**********************************

41. spacer 1.21|69305|33|NZ_CP029091|CRT matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcagcagcagatcggttggctggctcagcaca	CRISPR spacer
ggcagcagcagatcggttggctggctcagcaca	Protospacer
*********************************

42. spacer 1.21|69305|33|NZ_CP029091|CRT matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ggcagcagcagatcggttggctggctcagcaca	CRISPR spacer
ggcagcagcagatcggttggctggctcagcaca	Protospacer
*********************************

43. spacer 1.22|69365|33|NZ_CP029091|CRT matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgggcagattagtcacctgatcgaccgactta	CRISPR spacer
ctgggcagattagtcacctgatcgaccgactta	Protospacer
*********************************

44. spacer 1.22|69365|33|NZ_CP029091|CRT matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgggcagattagtcacctgatcgaccgactta	CRISPR spacer
ctgggcagattagtcacctgatcgaccgactta	Protospacer
*********************************

45. spacer 1.23|69425|34|NZ_CP029091|CRT matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
aacagcggccaccccggcgcccccatgggtatga	Protospacer
**********************************

46. spacer 1.23|69425|34|NZ_CP029091|CRT matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
aacagcggccaccccggcgcccccatgggtatga	Protospacer
**********************************

47. spacer 1.24|69486|34|NZ_CP029091|CRT matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agtcatgccgagaagctgggccggcgtgtcctga	CRISPR spacer
agtcatgccgagaagctgggccggcgtgtcctga	Protospacer
**********************************

48. spacer 1.24|69486|34|NZ_CP029091|CRT matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

agtcatgccgagaagctgggccggcgtgtcctga	CRISPR spacer
agtcatgccgagaagctgggccggcgtgtcctga	Protospacer
**********************************

49. spacer 1.25|69126|33|NZ_CP029091|PILER-CR matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tgcttgcaatcgtcagtgcgctgactatcgcac	CRISPR spacer
tgcttgcaatcgtcagtgcgctgactatcgcac	Protospacer
*********************************

50. spacer 1.25|69126|33|NZ_CP029091|PILER-CR matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tgcttgcaatcgtcagtgcgctgactatcgcac	CRISPR spacer
tgcttgcaatcgtcagtgcgctgactatcgcac	Protospacer
*********************************

51. spacer 1.26|69186|33|NZ_CP029091|PILER-CR matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gaatggatagctttgcccttggcagccagcctc	CRISPR spacer
gaatggatagctttgcccttggcagccagcctc	Protospacer
*********************************

52. spacer 1.26|69186|33|NZ_CP029091|PILER-CR matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gaatggatagctttgcccttggcagccagcctc	CRISPR spacer
gaatggatagctttgcccttggcagccagcctc	Protospacer
*********************************

53. spacer 1.27|69246|34|NZ_CP029091|PILER-CR matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

cacccaaggcagccagcgcagtggcatcttccta	CRISPR spacer
cacccaaggcagccagcgcagtggcatcttccta	Protospacer
**********************************

54. spacer 1.27|69246|34|NZ_CP029091|PILER-CR matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cacccaaggcagccagcgcagtggcatcttccta	CRISPR spacer
cacccaaggcagccagcgcagtggcatcttccta	Protospacer
**********************************

55. spacer 1.28|69307|33|NZ_CP029091|PILER-CR matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcagcagcagatcggttggctggctcagcaca	CRISPR spacer
ggcagcagcagatcggttggctggctcagcaca	Protospacer
*********************************

56. spacer 1.28|69307|33|NZ_CP029091|PILER-CR matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ggcagcagcagatcggttggctggctcagcaca	CRISPR spacer
ggcagcagcagatcggttggctggctcagcaca	Protospacer
*********************************

57. spacer 1.29|69367|33|NZ_CP029091|PILER-CR matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgggcagattagtcacctgatcgaccgactta	CRISPR spacer
ctgggcagattagtcacctgatcgaccgactta	Protospacer
*********************************

58. spacer 1.29|69367|33|NZ_CP029091|PILER-CR matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ctgggcagattagtcacctgatcgaccgactta	CRISPR spacer
ctgggcagattagtcacctgatcgaccgactta	Protospacer
*********************************

59. spacer 1.30|69427|34|NZ_CP029091|PILER-CR matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
aacagcggccaccccggcgcccccatgggtatga	Protospacer
**********************************

60. spacer 1.30|69427|34|NZ_CP029091|PILER-CR matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
aacagcggccaccccggcgcccccatgggtatga	Protospacer
**********************************

61. spacer 1.31|69488|34|NZ_CP029091|PILER-CR matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

agtcatgccgagaagctgggccggcgtgtcctga	CRISPR spacer
agtcatgccgagaagctgggccggcgtgtcctga	Protospacer
**********************************

62. spacer 1.31|69488|34|NZ_CP029091|PILER-CR matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

agtcatgccgagaagctgggccggcgtgtcctga	CRISPR spacer
agtcatgccgagaagctgggccggcgtgtcctga	Protospacer
**********************************

63. spacer 1.11|69425|33|NZ_CP029091|CRISPRCasFinder matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 4, identity: 0.879

aacagcggccaccccggcgcccccatgggtatg	CRISPR spacer
aaatccggccacccaggcgcccccatgggtatg	Protospacer
**   ********* ******************

64. spacer 1.11|69425|33|NZ_CP029091|CRISPRCasFinder matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.879

aacagcggccaccccggcgcccccatgggtatg	CRISPR spacer
aaatccggccatcccggcgcccccatgggtatg	Protospacer
**   ******.*********************

65. spacer 1.5|69066|30|NZ_CP029091|CRISPRCasFinder matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 5, identity: 0.833

agtttcgcagccgtcttcaacgattc-cgca	CRISPR spacer
actttcgccgccgtcttcgacgatttgcgc-	Protospacer
* ****** *********.******. *** 

66. spacer 1.5|69066|30|NZ_CP029091|CRISPRCasFinder matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 5, identity: 0.833

agtttcgcagccgtcttcaacgattc-cgca	CRISPR spacer
actttcgccgccgtcttcgacgatttgcgc-	Protospacer
* ****** *********.******. *** 

67. spacer 1.5|69066|30|NZ_CP029091|CRISPRCasFinder matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 5, identity: 0.833

agtttcgcagccgtcttcaacgattc-cgca	CRISPR spacer
actttcgccgccgtcttcgacgatttgcgc-	Protospacer
* ****** *********.******. *** 

68. spacer 1.11|69425|33|NZ_CP029091|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 5, identity: 0.848

aacagcggccaccccggcgcccccatgggtatg	CRISPR spacer
cgctccggccaccccggcgcccccatgggcatg	Protospacer
 .*  ************************.***

69. spacer 1.11|69425|33|NZ_CP029091|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 5, identity: 0.848

aacagcggccaccccggcgcccccatgggtatg	CRISPR spacer
cgctccggccaccccggcgcccccatgggcatg	Protospacer
 .*  ************************.***

70. spacer 1.23|69425|34|NZ_CP029091|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
aaatccggccatcccggcgcccccatgggtatgg	Protospacer
**   ******.*********************.

71. spacer 1.23|69425|34|NZ_CP029091|CRT matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
aaatccggccacccaggcgcccccatgggtatgg	Protospacer
**   ********* ******************.

72. spacer 1.30|69427|34|NZ_CP029091|PILER-CR matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
aaatccggccatcccggcgcccccatgggtatgg	Protospacer
**   ******.*********************.

73. spacer 1.30|69427|34|NZ_CP029091|PILER-CR matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
aaatccggccacccaggcgcccccatgggtatgg	Protospacer
**   ********* ******************.

74. spacer 1.17|69066|31|NZ_CP029091|CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 6, identity: 0.806

agtttcgcagccgtcttcaacgattc-cgcag	CRISPR spacer
actttcgccgccgtcttcgacgatttgcgcg-	Protospacer
* ****** *********.******. ***. 

75. spacer 1.17|69066|31|NZ_CP029091|CRT matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 6, identity: 0.806

agtttcgcagccgtcttcaacgattc-cgcag	CRISPR spacer
actttcgccgccgtcttcgacgatttgcgcg-	Protospacer
* ****** *********.******. ***. 

76. spacer 1.17|69066|31|NZ_CP029091|CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 6, identity: 0.806

agtttcgcagccgtcttcaacgattc-cgcag	CRISPR spacer
actttcgccgccgtcttcgacgatttgcgcg-	Protospacer
* ****** *********.******. ***. 

77. spacer 1.23|69425|34|NZ_CP029091|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 6, identity: 0.824

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
cgctccggccaccccggcgcccccatgggcatgg	Protospacer
 .*  ************************.***.

78. spacer 1.23|69425|34|NZ_CP029091|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 6, identity: 0.824

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
cgctccggccaccccggcgcccccatgggcatgg	Protospacer
 .*  ************************.***.

79. spacer 1.30|69427|34|NZ_CP029091|PILER-CR matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 6, identity: 0.824

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
cgctccggccaccccggcgcccccatgggcatgg	Protospacer
 .*  ************************.***.

80. spacer 1.30|69427|34|NZ_CP029091|PILER-CR matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 6, identity: 0.824

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
cgctccggccaccccggcgcccccatgggcatgg	Protospacer
 .*  ************************.***.

81. spacer 1.3|68946|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP007257 (Rhodococcus erythropolis R138 plasmid pLRE138, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagccgtccgatgacgatgccccactggtt	CRISPR spacer
accaggactccgacgacgatgccccacaggtt	Protospacer
*  **   *****.************* ****

82. spacer 1.5|69066|30|NZ_CP029091|CRISPRCasFinder matches to NC_011981 (Agrobacterium vitis S4 plasmid pAtS4e, complete sequence) position: , mismatch: 7, identity: 0.767

agtttcgcagccgtcttcaacgattccgca	CRISPR spacer
ggtttcgtcgccgtcttcaacgatcatgcc	Protospacer
.******. ***************. .** 

83. spacer 1.24|69486|34|NZ_CP029091|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 7, identity: 0.794

agtcatgccgagaagctgggccggcg---tgtcctga	CRISPR spacer
cgccatgccgagatgctcggccggcgtcatgtcc---	Protospacer
 *.********** *** ********   *****   

84. spacer 1.24|69486|34|NZ_CP029091|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 7, identity: 0.794

agtcatgccgagaagctgggccggcg---tgtcctga	CRISPR spacer
cgccatgccgagatgctcggccggcgtcatgtcc---	Protospacer
 *.********** *** ********   *****   

85. spacer 1.31|69488|34|NZ_CP029091|PILER-CR matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 7, identity: 0.794

agtcatgccgagaagctgggccggcg---tgtcctga	CRISPR spacer
cgccatgccgagatgctcggccggcgtcatgtcc---	Protospacer
 *.********** *** ********   *****   

86. spacer 1.31|69488|34|NZ_CP029091|PILER-CR matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 7, identity: 0.794

agtcatgccgagaagctgggccggcg---tgtcctga	CRISPR spacer
cgccatgccgagatgctcggccggcgtcatgtcc---	Protospacer
 *.********** *** ********   *****   

87. spacer 1.5|69066|30|NZ_CP029091|CRISPRCasFinder matches to NZ_CP034329 (Tabrizicola piscis strain K13M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

agtttcgcagccgtcttcaacgattccgca	CRISPR spacer
gaggtcgccgccgtcttcaacgatttcgac	Protospacer
..  **** ****************.**  

88. spacer 1.9|69305|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP009295 (Novosphingobium pentaromativorans US6-1 plasmid pLA5, complete sequence) position: , mismatch: 8, identity: 0.75

ggcagcagcagatcggttggctggctcagcac-	CRISPR spacer
cccagcaccagatcggctggctggc-cattgcc	Protospacer
  ***** ********.******** ** ..* 

89. spacer 1.9|69305|32|NZ_CP029091|CRISPRCasFinder matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ggcagcagcagatcggttggctggctcagcac	CRISPR spacer
gatatcagcagaacggttggctggttcacatc	Protospacer
*..* ******* ***********.***   *

90. spacer 1.9|69305|32|NZ_CP029091|CRISPRCasFinder matches to NC_008036 (Sphingopyxis alaskensis RB2256 F plasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ggcagcagcagatcggttggctggctcagcac-	CRISPR spacer
cccagcaccagatcggctggctggc-cattgcc	Protospacer
  ***** ********.******** ** ..* 

91. spacer 1.9|69305|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ggcagcagcagatcggttggctggctcagcac	CRISPR spacer
tgcagcagcagttcggttgcctggaccatcgg	Protospacer
 ********** ******* **** .** *. 

92. spacer 1.11|69425|33|NZ_CP029091|CRISPRCasFinder matches to NZ_CP016834 (Xanthomonas fragariae isolate Fap29 plasmid pFap29-1, complete sequence) position: , mismatch: 8, identity: 0.758

aacagcggccaccccggcgcccccatgggtatg	CRISPR spacer
aacagcggccaccccggcgcgctcaccaccatc	Protospacer
******************** *.**. . .** 

93. spacer 1.11|69425|33|NZ_CP029091|CRISPRCasFinder matches to NZ_LT853886 (Xanthomonas fragariae strain PD5205 plasmid pPD5205-30, complete sequence) position: , mismatch: 8, identity: 0.758

aacagcggccaccccggcgcccccatgggtatg	CRISPR spacer
aacagcggccaccccggcgcgctcaccaccatc	Protospacer
******************** *.**. . .** 

94. spacer 1.11|69425|33|NZ_CP029091|CRISPRCasFinder matches to NZ_CP016831 (Xanthomonas fragariae isolate Fap21 plasmid pFap21-1, complete sequence) position: , mismatch: 8, identity: 0.758

aacagcggccaccccggcgcccccatgggtatg	CRISPR spacer
aacagcggccaccccggcgcgctcaccaccatc	Protospacer
******************** *.**. . .** 

95. spacer 1.11|69425|33|NZ_CP029091|CRISPRCasFinder matches to NC_017555 (Xanthomonas albilineans str. GPE PC73, plasmid, complete genome) position: , mismatch: 8, identity: 0.758

aacagcggccaccccggcgcccccatgggtatg	CRISPR spacer
aacagcggccaccccggcgcgctcaccaccatc	Protospacer
******************** *.**. . .** 

96. spacer 1.11|69425|33|NZ_CP029091|CRISPRCasFinder matches to NZ_LT853883 (Xanthomonas fragariae strain PD885 plasmid pPD885-29, complete sequence) position: , mismatch: 8, identity: 0.758

aacagcggccaccccggcgcccccatgggtatg	CRISPR spacer
aacagcggccaccccggcgcgctcaccaccatc	Protospacer
******************** *.**. . .** 

97. spacer 1.12|69486|33|NZ_CP029091|CRISPRCasFinder matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 8, identity: 0.758

agtcatgccgagaagctgggccggcgtgtcctg	CRISPR spacer
aagcaggccgagaagctgggcctgcgtccgccg	Protospacer
*. ** **************** **** . *.*

98. spacer 1.15|68946|33|NZ_CP029091|CRT matches to NZ_CP007257 (Rhodococcus erythropolis R138 plasmid pLRE138, complete sequence) position: , mismatch: 8, identity: 0.758

aaaagccgtccgatgacgatgccccactggttc	CRISPR spacer
accaggactccgacgacgatgccccacaggttg	Protospacer
*  **   *****.************* **** 

99. spacer 1.17|69066|31|NZ_CP029091|CRT matches to NC_011981 (Agrobacterium vitis S4 plasmid pAtS4e, complete sequence) position: , mismatch: 8, identity: 0.742

agtttcgcagccgtcttcaacgattccgcag	CRISPR spacer
ggtttcgtcgccgtcttcaacgatcatgccc	Protospacer
.******. ***************. .**  

100. spacer 1.5|69066|30|NZ_CP029091|CRISPRCasFinder matches to MN694322 (Marine virus AFVG_250M1032, complete genome) position: , mismatch: 9, identity: 0.7

agtttcgcagccgtcttcaacgattccgca	CRISPR spacer
gagggaacagcggtcttcaacgtttccgca	Protospacer
..    .**** ********** *******

101. spacer 1.11|69425|33|NZ_CP029091|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.727

aacagcggccaccccggcgcccccatgggtatg	CRISPR spacer
accagcggccacaccggcgccgccatccgcgcc	Protospacer
* ********** ******** ****  *... 

102. spacer 1.11|69425|33|NZ_CP029091|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.727

aacagcggccaccccggcgcccccatgggtatg	CRISPR spacer
accagcggccacaccggcgccgccatccgcgcc	Protospacer
* ********** ******** ****  *... 

103. spacer 1.12|69486|33|NZ_CP029091|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 9, identity: 0.727

agtcatgccgagaagctgggccggcgtgtcctg	CRISPR spacer
cgccatgccgagatgctcggccggcgtcatgtc	Protospacer
 *.********** *** *********  . * 

104. spacer 1.12|69486|33|NZ_CP029091|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 9, identity: 0.727

agtcatgccgagaagctgggccggcgtgtcctg	CRISPR spacer
cgccatgccgagatgctcggccggcgtcatgtc	Protospacer
 *.********** *** *********  . * 

105. spacer 1.17|69066|31|NZ_CP029091|CRT matches to NZ_CP034329 (Tabrizicola piscis strain K13M18 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

agtttcgcagccgtcttcaacgattccgcag	CRISPR spacer
gaggtcgccgccgtcttcaacgatttcgact	Protospacer
..  **** ****************.**   

106. spacer 1.23|69425|34|NZ_CP029091|CRT matches to NZ_LT853886 (Xanthomonas fragariae strain PD5205 plasmid pPD5205-30, complete sequence) position: , mismatch: 9, identity: 0.735

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
aacagcggccaccccggcgcgctcaccaccatcc	Protospacer
******************** *.**. . .**  

107. spacer 1.23|69425|34|NZ_CP029091|CRT matches to NZ_CP016831 (Xanthomonas fragariae isolate Fap21 plasmid pFap21-1, complete sequence) position: , mismatch: 9, identity: 0.735

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
aacagcggccaccccggcgcgctcaccaccatcc	Protospacer
******************** *.**. . .**  

108. spacer 1.23|69425|34|NZ_CP029091|CRT matches to NC_017555 (Xanthomonas albilineans str. GPE PC73, plasmid, complete genome) position: , mismatch: 9, identity: 0.735

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
aacagcggccaccccggcgcgctcaccaccatcc	Protospacer
******************** *.**. . .**  

109. spacer 1.23|69425|34|NZ_CP029091|CRT matches to NZ_LT853883 (Xanthomonas fragariae strain PD885 plasmid pPD885-29, complete sequence) position: , mismatch: 9, identity: 0.735

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
aacagcggccaccccggcgcgctcaccaccatcc	Protospacer
******************** *.**. . .**  

110. spacer 1.23|69425|34|NZ_CP029091|CRT matches to NZ_CP016834 (Xanthomonas fragariae isolate Fap29 plasmid pFap29-1, complete sequence) position: , mismatch: 9, identity: 0.735

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
aacagcggccaccccggcgcgctcaccaccatcc	Protospacer
******************** *.**. . .**  

111. spacer 1.23|69425|34|NZ_CP029091|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.735

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
accagcggccacaccggcgccgccatccgcgcca	Protospacer
* ********** ******** ****  *... *

112. spacer 1.23|69425|34|NZ_CP029091|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.735

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
accagcggccacaccggcgccgccatccgcgcca	Protospacer
* ********** ******** ****  *... *

113. spacer 1.24|69486|34|NZ_CP029091|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 9, identity: 0.735

agtcatgccgagaagctgggccggcgtgtcctga	CRISPR spacer
aagcaggccgagaagctgggcctgcgtccgccgg	Protospacer
*. ** **************** **** . *.*.

114. spacer 1.30|69427|34|NZ_CP029091|PILER-CR matches to NZ_LT853886 (Xanthomonas fragariae strain PD5205 plasmid pPD5205-30, complete sequence) position: , mismatch: 9, identity: 0.735

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
aacagcggccaccccggcgcgctcaccaccatcc	Protospacer
******************** *.**. . .**  

115. spacer 1.30|69427|34|NZ_CP029091|PILER-CR matches to NZ_CP016831 (Xanthomonas fragariae isolate Fap21 plasmid pFap21-1, complete sequence) position: , mismatch: 9, identity: 0.735

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
aacagcggccaccccggcgcgctcaccaccatcc	Protospacer
******************** *.**. . .**  

116. spacer 1.30|69427|34|NZ_CP029091|PILER-CR matches to NC_017555 (Xanthomonas albilineans str. GPE PC73, plasmid, complete genome) position: , mismatch: 9, identity: 0.735

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
aacagcggccaccccggcgcgctcaccaccatcc	Protospacer
******************** *.**. . .**  

117. spacer 1.30|69427|34|NZ_CP029091|PILER-CR matches to NZ_LT853883 (Xanthomonas fragariae strain PD885 plasmid pPD885-29, complete sequence) position: , mismatch: 9, identity: 0.735

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
aacagcggccaccccggcgcgctcaccaccatcc	Protospacer
******************** *.**. . .**  

118. spacer 1.30|69427|34|NZ_CP029091|PILER-CR matches to NZ_CP016834 (Xanthomonas fragariae isolate Fap29 plasmid pFap29-1, complete sequence) position: , mismatch: 9, identity: 0.735

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
aacagcggccaccccggcgcgctcaccaccatcc	Protospacer
******************** *.**. . .**  

119. spacer 1.30|69427|34|NZ_CP029091|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.735

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
accagcggccacaccggcgccgccatccgcgcca	Protospacer
* ********** ******** ****  *... *

120. spacer 1.30|69427|34|NZ_CP029091|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.735

aacagcggccaccccggcgcccccatgggtatga	CRISPR spacer
accagcggccacaccggcgccgccatccgcgcca	Protospacer
* ********** ******** ****  *... *

121. spacer 1.31|69488|34|NZ_CP029091|PILER-CR matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 9, identity: 0.735

agtcatgccgagaagctgggccggcgtgtcctga	CRISPR spacer
aagcaggccgagaagctgggcctgcgtccgccgg	Protospacer
*. ** **************** **** . *.*.

122. spacer 1.8|69244|33|NZ_CP029091|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 10, identity: 0.697

cacccaaggcagccagcgcagtggcatcttcct	CRISPR spacer
gtggcacggcagccagcgcagaggcatcgaacc	Protospacer
    ** ************** ******   *.

123. spacer 1.9|69305|32|NZ_CP029091|CRISPRCasFinder matches to NZ_CP009295 (Novosphingobium pentaromativorans US6-1 plasmid pLA5, complete sequence) position: , mismatch: 10, identity: 0.688

ggcagcagcagatcggttggctggctcagcac	CRISPR spacer
cccagcaccagatcggctggctggccggtttc	Protospacer
  ***** ********.********. . . *

124. spacer 1.9|69305|32|NZ_CP029091|CRISPRCasFinder matches to NC_008036 (Sphingopyxis alaskensis RB2256 F plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

ggcagcagcagatcggttggctggctcagcac	CRISPR spacer
cccagcaccagatcggctggctggccggtttc	Protospacer
  ***** ********.********. . . *

125. spacer 1.17|69066|31|NZ_CP029091|CRT matches to MN694322 (Marine virus AFVG_250M1032, complete genome) position: , mismatch: 10, identity: 0.677

agtttcgcagccgtcttcaacgattccgcag	CRISPR spacer
gagggaacagcggtcttcaacgtttccgcat	Protospacer
..    .**** ********** ******* 

126. spacer 1.20|69244|34|NZ_CP029091|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 11, identity: 0.676

cacccaaggcagccagcgcagtggcatcttccta	CRISPR spacer
gtggcacggcagccagcgcagaggcatcgaaccc	Protospacer
    ** ************** ******   *. 

127. spacer 1.27|69246|34|NZ_CP029091|PILER-CR matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 11, identity: 0.676

cacccaaggcagccagcgcagtggcatcttccta	CRISPR spacer
gtggcacggcagccagcgcagaggcatcgaaccc	Protospacer
    ** ************** ******   *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP029093
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029093_1 368823-368936 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029093_2 565008-565112 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029093_3 1124193-1124762 Orphan I-F
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029093_4 2888679-2889006 Unclear I-F
5 spacers
cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029093_5 5297794-5297894 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029093_6 6219439-6220022 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP029093_7 6252582-6252732 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP029093_6 6.1|6219483|19|NZ_CP029093|CRT 6219483-6219501 19 NZ_CP029093.1 4925371-4925389 2 0.895
NZ_CP029093_6 6.1|6219483|19|NZ_CP029093|CRT 6219483-6219501 19 NZ_CP029093.1 6106428-6106446 2 0.895
NZ_CP029093_6 6.1|6219483|19|NZ_CP029093|CRT 6219483-6219501 19 NZ_CP029093.1 6519858-6519876 2 0.895
NZ_CP029093_6 6.7|6219897|19|NZ_CP029093|CRT 6219897-6219915 19 NZ_CP029093.1 4446192-4446210 2 0.895
NZ_CP029093_6 6.8|6219960|19|NZ_CP029093|CRT 6219960-6219978 19 NZ_CP029093.1 1872875-1872893 2 0.895
NZ_CP029093_6 6.8|6219960|19|NZ_CP029093|CRT 6219960-6219978 19 NZ_CP029093.1 5985666-5985684 2 0.895
NZ_CP029093_6 6.8|6219960|19|NZ_CP029093|CRT 6219960-6219978 19 NZ_CP029093.1 6519858-6519876 2 0.895

1. spacer 6.1|6219483|19|NZ_CP029093|CRT matches to position: 4925371-4925389, mismatch: 2, identity: 0.895

ggcggcgggcttcgtggcc	CRISPR spacer
ggcggccggctgcgtggcc	Protospacer
****** **** *******

2. spacer 6.1|6219483|19|NZ_CP029093|CRT matches to position: 6106428-6106446, mismatch: 2, identity: 0.895

ggcggcgggcttcgtggcc	CRISPR spacer
ggcgtcggccttcgtggcc	Protospacer
**** *** **********

3. spacer 6.1|6219483|19|NZ_CP029093|CRT matches to position: 6519858-6519876, mismatch: 2, identity: 0.895

ggcggcgggcttcgtggcc	CRISPR spacer
ggcggcgggctccgcggcc	Protospacer
***********.**.****

4. spacer 6.7|6219897|19|NZ_CP029093|CRT matches to position: 4446192-4446210, mismatch: 2, identity: 0.895

cgcggcagcggtcttcgcc	CRISPR spacer
cgcggcagtggccttcgcc	Protospacer
********.**.*******

5. spacer 6.8|6219960|19|NZ_CP029093|CRT matches to position: 1872875-1872893, mismatch: 2, identity: 0.895

ggcggcaggcttcgcggcc	CRISPR spacer
ggcggcaggcgtggcggcc	Protospacer
********** * ******

6. spacer 6.8|6219960|19|NZ_CP029093|CRT matches to position: 5985666-5985684, mismatch: 2, identity: 0.895

ggcggcaggcttcgcggcc	CRISPR spacer
ggcggccggcttcgcagcc	Protospacer
****** ********.***

7. spacer 6.8|6219960|19|NZ_CP029093|CRT matches to position: 6519858-6519876, mismatch: 2, identity: 0.895

ggcggcaggcttcgcggcc	CRISPR spacer
ggcggcgggctccgcggcc	Protospacer
******.****.*******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NZ_CP030914 Pseudomonas aeruginosa strain Y89 plasmid pY89, complete sequence 46851-46882 0 1.0
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NC_019202 Pseudomonas aeruginosa plasmid pKLC102, complete sequence 38867-38898 0 1.0
NZ_CP029093_4 4.3|2888827|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888827-2888858 32 MF490237 Pseudomonas phage vB_PaeP_E220, complete genome 8804-8835 0 1.0
NZ_CP029093_4 4.3|2888827|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888827-2888858 32 NC_042342 Pseudomonas virus H66, complete genome 64422-64453 0 1.0
NZ_CP029093_4 4.3|2888827|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888827-2888858 32 KM389247 UNVERIFIED: Pseudomonas phage JBD90 clone contig00001 genomic sequence 47514-47545 0 1.0
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 NC_016138 Pseudomonas aeruginosa plasmid pUM505, complete sequence 121582-121613 0 1.0
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 87526-87557 0 1.0
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 NZ_CP030914 Pseudomonas aeruginosa strain Y89 plasmid pY89, complete sequence 27585-27616 0 1.0
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 NC_019202 Pseudomonas aeruginosa plasmid pKLC102, complete sequence 16599-16630 0 1.0
NZ_CP029093_6 6.1|6219483|19|NZ_CP029093|CRT 6219483-6219501 19 NC_022044 Paracoccus aminophilus JCM 7686 plasmid pAMI6, complete sequence 8730-8748 0 1.0
NZ_CP029093_6 6.7|6219897|19|NZ_CP029093|CRT 6219897-6219915 19 MT684592 Microbacterium phage Aesir, complete genome 28306-28324 0 1.0
NZ_CP029093_6 6.8|6219960|19|NZ_CP029093|CRT 6219960-6219978 19 NC_005793 Achromobacter denitrificans plasmid pEST4011, complete sequence 32899-32917 0 1.0
NZ_CP029093_6 6.8|6219960|19|NZ_CP029093|CRT 6219960-6219978 19 NC_005793 Achromobacter denitrificans plasmid pEST4011, complete sequence 39890-39908 0 1.0
NZ_CP029093_6 6.8|6219960|19|NZ_CP029093|CRT 6219960-6219978 19 NC_019378 Burkholderia cepacia plasmid pIJB1, complete sequence 78653-78671 0 1.0
NZ_CP029093_3 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124583-1124614 32 MN096267 Pseudomonas phage vB_PaS_IME307, complete genome 12949-12980 1 0.969
NZ_CP029093_3 3.1|1124221|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124221-1124252 32 NC_023575 Pseudomonas phage vB_PaeP_Tr60_Ab31 37727-37758 2 0.938
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NC_016138 Pseudomonas aeruginosa plasmid pUM505, complete sequence 101193-101224 2 0.938
NZ_CP029093_3 3.9|1124703|32|NZ_CP029093|CRISPRCasFinder,CRT 1124703-1124734 32 MN096267 Pseudomonas phage vB_PaS_IME307, complete genome 12681-12712 2 0.938
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 NZ_CP039632 Pseudomonas veronii strain Pvy plasmid unnamed, complete sequence 176875-176906 2 0.938
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 NC_015727 Cupriavidus necator N-1 plasmid pBB1, complete sequence 1413598-1413629 2 0.938
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 DQ115836 Cyanobacteria phage AS-1 contig_29 genomic sequence 1015-1046 2 0.938
NZ_CP029093_7 7.1|6252616|26|NZ_CP029093|PILER-CR 6252616-6252641 26 NZ_CP028567 Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid pMCR5_045096, complete sequence 179593-179618 2 0.923
NZ_CP029093_7 7.1|6252616|26|NZ_CP029093|PILER-CR 6252616-6252641 26 NZ_CP015000 Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence 2104-2129 2 0.923
NZ_CP029093_7 7.1|6252616|26|NZ_CP029093|PILER-CR 6252616-6252641 26 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 227774-227799 2 0.923
NZ_CP029093_7 7.1|6252616|26|NZ_CP029093|PILER-CR 6252616-6252641 26 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 49256-49281 2 0.923
NZ_CP029093_7 7.1|6252616|26|NZ_CP029093|PILER-CR 6252616-6252641 26 MK947460 Salmonella phage vB_SenS_SB28, complete genome 33185-33210 2 0.923
NZ_CP029093_7 7.1|6252616|26|NZ_CP029093|PILER-CR 6252616-6252641 26 NZ_CP027861 Ahniella affigens strain D13 plasmid unnamed, complete sequence 120873-120898 3 0.885
NZ_CP029093_7 7.1|6252616|26|NZ_CP029093|PILER-CR 6252616-6252641 26 MT075871 Klebsiella phage vB_KleS-HSE3, complete genome 40539-40564 3 0.885
NZ_CP029093_7 7.1|6252616|26|NZ_CP029093|PILER-CR 6252616-6252641 26 NZ_CP034355 Pseudomonas aeruginosa strain IMP-13 plasmid pPYO_TB, complete sequence 90710-90735 3 0.885
NZ_CP029093_7 7.1|6252616|26|NZ_CP029093|PILER-CR 6252616-6252641 26 NZ_CP005987 Acidithiobacillus caldus ATCC 51756 plasmid megap mpAca1.1, complete sequence 4990-5015 4 0.846
NZ_CP029093_7 7.1|6252616|26|NZ_CP029093|PILER-CR 6252616-6252641 26 NZ_LR134425 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 16 1011-1036 4 0.846
NZ_CP029093_7 7.1|6252616|26|NZ_CP029093|PILER-CR 6252616-6252641 26 MH617654 Caudovirales sp. isolate ctbf53, complete genome 19822-19847 5 0.808
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NZ_CP025992 Lactobacillus plantarum subsp. plantarum strain LB1-2 plasmid pLB1-2A, complete sequence 4235-4266 6 0.812
NZ_CP029093_6 6.4|6219672|31|NZ_CP029093|CRT 6219672-6219702 31 MT684592 Microbacterium phage Aesir, complete genome 28306-28336 6 0.806
NZ_CP029093_6 6.4|6219672|31|NZ_CP029093|CRT 6219672-6219702 31 MK359302 Gordonia phage Sombrero, complete genome 53399-53429 6 0.806
NZ_CP029093_6 6.4|6219672|31|NZ_CP029093|CRT 6219672-6219702 31 NZ_CP035506 Haematobacter massiliensis strain OT1 plasmid pOT1-6, complete sequence 83141-83171 6 0.806
NZ_CP029093_6 6.5|6219747|31|NZ_CP029093|CRT 6219747-6219777 31 MT684592 Microbacterium phage Aesir, complete genome 28306-28336 6 0.806
NZ_CP029093_6 6.5|6219747|31|NZ_CP029093|CRT 6219747-6219777 31 MK359302 Gordonia phage Sombrero, complete genome 53399-53429 6 0.806
NZ_CP029093_6 6.5|6219747|31|NZ_CP029093|CRT 6219747-6219777 31 NZ_CP035506 Haematobacter massiliensis strain OT1 plasmid pOT1-6, complete sequence 83141-83171 6 0.806
NZ_CP029093_6 6.6|6219822|31|NZ_CP029093|CRT 6219822-6219852 31 MT684592 Microbacterium phage Aesir, complete genome 28306-28336 6 0.806
NZ_CP029093_6 6.6|6219822|31|NZ_CP029093|CRT 6219822-6219852 31 MK359302 Gordonia phage Sombrero, complete genome 53399-53429 6 0.806
NZ_CP029093_6 6.6|6219822|31|NZ_CP029093|CRT 6219822-6219852 31 NZ_CP035506 Haematobacter massiliensis strain OT1 plasmid pOT1-6, complete sequence 83141-83171 6 0.806
NZ_CP029093_3 3.3|1124341|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124341-1124372 32 NZ_CP016618 Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence 11861-11892 7 0.781
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NZ_CP040453 Halomonas sp. PA16-9 plasmid p_unnamed2, complete sequence 113416-113447 7 0.781
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NC_022533 Plautia stali symbiont plasmid pPstS1 DNA, complete genome 6447-6478 7 0.781
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NZ_KY433363 Proteus mirabilis strain R997 plasmid pR997, complete sequence 36404-36435 7 0.781
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 11604-11635 7 0.781
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NZ_CP040764 Paracoccus sp. 2251 plasmid unnamed3, complete sequence 175163-175194 7 0.781
NZ_CP029093_3 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124583-1124614 32 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 286363-286394 7 0.781
NZ_CP029093_3 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124583-1124614 32 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 533711-533742 7 0.781
NZ_CP029093_3 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124583-1124614 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1606713-1606744 7 0.781
NZ_CP029093_3 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124583-1124614 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1478239-1478270 7 0.781
NZ_CP029093_3 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124583-1124614 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 394763-394794 7 0.781
NZ_CP029093_3 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124583-1124614 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 394759-394790 7 0.781
NZ_CP029093_3 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124583-1124614 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1590177-1590208 7 0.781
NZ_CP029093_6 6.4|6219672|31|NZ_CP029093|CRT 6219672-6219702 31 MT639643 Microbacterium phage FreddieHg, complete genome 27900-27930 7 0.774
NZ_CP029093_6 6.4|6219672|31|NZ_CP029093|CRT 6219672-6219702 31 MN497954 Microbacterium phage Hiddenleaf, complete genome 27884-27914 7 0.774
NZ_CP029093_6 6.4|6219672|31|NZ_CP029093|CRT 6219672-6219702 31 MT684591 Microbacterium phage Chivey, complete genome 27884-27914 7 0.774
NZ_CP029093_6 6.4|6219672|31|NZ_CP029093|CRT 6219672-6219702 31 MT522003 Microbacterium phage Rie18, complete genome 28207-28237 7 0.774
NZ_CP029093_6 6.5|6219747|31|NZ_CP029093|CRT 6219747-6219777 31 MT639643 Microbacterium phage FreddieHg, complete genome 27900-27930 7 0.774
NZ_CP029093_6 6.5|6219747|31|NZ_CP029093|CRT 6219747-6219777 31 MN497954 Microbacterium phage Hiddenleaf, complete genome 27884-27914 7 0.774
NZ_CP029093_6 6.5|6219747|31|NZ_CP029093|CRT 6219747-6219777 31 MT684591 Microbacterium phage Chivey, complete genome 27884-27914 7 0.774
NZ_CP029093_6 6.5|6219747|31|NZ_CP029093|CRT 6219747-6219777 31 MT522003 Microbacterium phage Rie18, complete genome 28207-28237 7 0.774
NZ_CP029093_6 6.6|6219822|31|NZ_CP029093|CRT 6219822-6219852 31 MT639643 Microbacterium phage FreddieHg, complete genome 27900-27930 7 0.774
NZ_CP029093_6 6.6|6219822|31|NZ_CP029093|CRT 6219822-6219852 31 MN497954 Microbacterium phage Hiddenleaf, complete genome 27884-27914 7 0.774
NZ_CP029093_6 6.6|6219822|31|NZ_CP029093|CRT 6219822-6219852 31 MT684591 Microbacterium phage Chivey, complete genome 27884-27914 7 0.774
NZ_CP029093_6 6.6|6219822|31|NZ_CP029093|CRT 6219822-6219852 31 MT522003 Microbacterium phage Rie18, complete genome 28207-28237 7 0.774
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 76322-76353 8 0.75
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 290275-290306 8 0.75
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 796222-796253 8 0.75
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NZ_AP022622 Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1 62899-62930 8 0.75
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NC_021279 Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence 72280-72311 8 0.75
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 26175-26206 8 0.75
NZ_CP029093_4 4.2|2888767|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888767-2888798 32 NZ_CP008954 Amycolatopsis japonica strain DSM 44213 plasmid pAmyja1, complete sequence 81281-81312 8 0.75
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 NC_019487 Bacillus phage SP10, complete genome 60591-60622 8 0.75
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 AB605730 Bacillus phage SP10 DNA, complete sequence 60591-60622 8 0.75
NZ_CP029093_6 6.4|6219672|31|NZ_CP029093|CRT 6219672-6219702 31 NZ_CP017756 Cupriavidus malaysiensis strain USMAA1020 isolate pure plasmid unnamed1, complete sequence 47976-48006 8 0.742
NZ_CP029093_6 6.4|6219672|31|NZ_CP029093|CRT 6219672-6219702 31 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 350058-350088 8 0.742
NZ_CP029093_6 6.5|6219747|31|NZ_CP029093|CRT 6219747-6219777 31 NZ_CP017756 Cupriavidus malaysiensis strain USMAA1020 isolate pure plasmid unnamed1, complete sequence 47976-48006 8 0.742
NZ_CP029093_6 6.5|6219747|31|NZ_CP029093|CRT 6219747-6219777 31 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 350058-350088 8 0.742
NZ_CP029093_6 6.6|6219822|31|NZ_CP029093|CRT 6219822-6219852 31 NZ_CP017756 Cupriavidus malaysiensis strain USMAA1020 isolate pure plasmid unnamed1, complete sequence 47976-48006 8 0.742
NZ_CP029093_6 6.6|6219822|31|NZ_CP029093|CRT 6219822-6219852 31 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 350058-350088 8 0.742
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 106720-106751 9 0.719
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NZ_CP019938 Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence 95023-95054 9 0.719
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NZ_LT703509 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 5 18119-18150 9 0.719
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NZ_CP015274 Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 2, complete sequence 34268-34299 9 0.719
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 487969-488000 9 0.719
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NZ_CP019223 Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_2, complete sequence 39076-39107 9 0.719
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NZ_CP045965 Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_02, complete sequence 25529-25560 9 0.719
NZ_CP029093_3 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124583-1124614 32 NZ_CP040762 Paracoccus sp. 2251 plasmid unnamed2, complete sequence 105809-105840 9 0.719
NZ_CP029093_3 3.9|1124703|32|NZ_CP029093|CRISPRCasFinder,CRT 1124703-1124734 32 NC_022044 Paracoccus aminophilus JCM 7686 plasmid pAMI6, complete sequence 150017-150048 9 0.719
NZ_CP029093_6 6.4|6219672|31|NZ_CP029093|CRT 6219672-6219702 31 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 737485-737515 9 0.71
NZ_CP029093_6 6.4|6219672|31|NZ_CP029093|CRT 6219672-6219702 31 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1206556-1206586 9 0.71
NZ_CP029093_6 6.5|6219747|31|NZ_CP029093|CRT 6219747-6219777 31 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 737485-737515 9 0.71
NZ_CP029093_6 6.5|6219747|31|NZ_CP029093|CRT 6219747-6219777 31 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1206556-1206586 9 0.71
NZ_CP029093_6 6.6|6219822|31|NZ_CP029093|CRT 6219822-6219852 31 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 737485-737515 9 0.71
NZ_CP029093_6 6.6|6219822|31|NZ_CP029093|CRT 6219822-6219852 31 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1206556-1206586 9 0.71
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 AF151676 Bacteriophage P-EibE ORF-191E (orf-191E), immunoglobulin-binding protein EibE (eibE), and ORF-156E (orf-156E) genes, complete cds 2820-2851 10 0.688
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NZ_CP019063 Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence 408134-408165 10 0.688
NZ_CP029093_3 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124523-1124554 32 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 29335-29366 10 0.688
NZ_CP029093_3 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 1124583-1124614 32 NZ_CP018784 Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence 184596-184627 10 0.688
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 NZ_LR134438 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 29 35190-35221 10 0.688
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 AP013686 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S46-C68, *** SEQUENCING IN PROGRESS *** 22014-22045 10 0.688
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 AP013679 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S29-C55, *** SEQUENCING IN PROGRESS *** 25606-25637 10 0.688
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 AP013682 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S36-C62, *** SEQUENCING IN PROGRESS *** 7793-7824 10 0.688
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 AP013421 Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C49A-MedDCM-OCT-S31-C44 5012-5043 10 0.688
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 AP013677 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S25-C56, *** SEQUENCING IN PROGRESS *** 21127-21158 10 0.688
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 AP013683 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S40-C57, *** SEQUENCING IN PROGRESS *** 1283-1314 10 0.688
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 AP013685 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S45-C58, *** SEQUENCING IN PROGRESS *** 3281-3312 10 0.688
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 AP013684 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S44-C58, *** SEQUENCING IN PROGRESS *** 1157-1188 10 0.688
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 AP013676 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S24-C47, *** SEQUENCING IN PROGRESS *** 5408-5439 10 0.688
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 AP013678 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S26-C193, *** SEQUENCING IN PROGRESS *** 2414-2445 10 0.688
NZ_CP029093_4 4.4|2888887|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888887-2888918 32 NZ_CP049749 Rhodococcus fascians A21d2 plasmid pA21d2, complete sequence 187100-187131 11 0.656
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 NZ_CP025860 Escherichia coli strain 504239 plasmid p504239_101, complete sequence 8693-8724 11 0.656
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 NZ_CP025904 Escherichia coli strain 300709 plasmid p300709_97, complete sequence 519-550 11 0.656
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 NZ_CP025858 Escherichia coli strain 504838 plasmid p504838_88, complete sequence 7448-7479 11 0.656
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 NZ_CP024280 Escherichia coli strain ATCC 43896 plasmid unnamed2 8839-8870 11 0.656
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 CP025971 Escherichia coli strain 11573 a-1 plasmid p11573a1_92, complete sequence 72416-72447 11 0.656
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 CP025974 Escherichia coli strain 10802 a plasmid p10802a_92, complete sequence 81068-81099 11 0.656
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 CP025977 Escherichia coli strain 10754 a-1 plasmid p10754a1_92, complete sequence 52629-52660 11 0.656
NZ_CP029093_4 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT 2888947-2888978 32 NC_017724 Escherichia coli ETEC H10407 plasmid p948, complete sequence 4691-4722 11 0.656

1. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030914 (Pseudomonas aeruginosa strain Y89 plasmid pY89, complete sequence) position: , mismatch: 0, identity: 1.0

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
agcggcaacatcaccaccagcgcggacatcag	Protospacer
********************************

2. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NC_019202 (Pseudomonas aeruginosa plasmid pKLC102, complete sequence) position: , mismatch: 0, identity: 1.0

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
agcggcaacatcaccaccagcgcggacatcag	Protospacer
********************************

3. spacer 4.3|2888827|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to MF490237 (Pseudomonas phage vB_PaeP_E220, complete genome) position: , mismatch: 0, identity: 1.0

aaggaggcgacgctccaggcgatagctgcgac	CRISPR spacer
aaggaggcgacgctccaggcgatagctgcgac	Protospacer
********************************

4. spacer 4.3|2888827|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NC_042342 (Pseudomonas virus H66, complete genome) position: , mismatch: 0, identity: 1.0

aaggaggcgacgctccaggcgatagctgcgac	CRISPR spacer
aaggaggcgacgctccaggcgatagctgcgac	Protospacer
********************************

5. spacer 4.3|2888827|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to KM389247 (UNVERIFIED: Pseudomonas phage JBD90 clone contig00001 genomic sequence) position: , mismatch: 0, identity: 1.0

aaggaggcgacgctccaggcgatagctgcgac	CRISPR spacer
aaggaggcgacgctccaggcgatagctgcgac	Protospacer
********************************

6. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NC_016138 (Pseudomonas aeruginosa plasmid pUM505, complete sequence) position: , mismatch: 0, identity: 1.0

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
ttacctttaaaaggctttaaaaggccttttag	Protospacer
********************************

7. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 0, identity: 1.0

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
ttacctttaaaaggctttaaaaggccttttag	Protospacer
********************************

8. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030914 (Pseudomonas aeruginosa strain Y89 plasmid pY89, complete sequence) position: , mismatch: 0, identity: 1.0

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
ttacctttaaaaggctttaaaaggccttttag	Protospacer
********************************

9. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NC_019202 (Pseudomonas aeruginosa plasmid pKLC102, complete sequence) position: , mismatch: 0, identity: 1.0

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
ttacctttaaaaggctttaaaaggccttttag	Protospacer
********************************

10. spacer 6.1|6219483|19|NZ_CP029093|CRT matches to NC_022044 (Paracoccus aminophilus JCM 7686 plasmid pAMI6, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggcgggcttcgtggcc	CRISPR spacer
ggcggcgggcttcgtggcc	Protospacer
*******************

11. spacer 6.7|6219897|19|NZ_CP029093|CRT matches to MT684592 (Microbacterium phage Aesir, complete genome) position: , mismatch: 0, identity: 1.0

cgcggcagcggtcttcgcc	CRISPR spacer
cgcggcagcggtcttcgcc	Protospacer
*******************

12. spacer 6.8|6219960|19|NZ_CP029093|CRT matches to NC_005793 (Achromobacter denitrificans plasmid pEST4011, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggcaggcttcgcggcc	CRISPR spacer
ggcggcaggcttcgcggcc	Protospacer
*******************

13. spacer 6.8|6219960|19|NZ_CP029093|CRT matches to NC_005793 (Achromobacter denitrificans plasmid pEST4011, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggcaggcttcgcggcc	CRISPR spacer
ggcggcaggcttcgcggcc	Protospacer
*******************

14. spacer 6.8|6219960|19|NZ_CP029093|CRT matches to NC_019378 (Burkholderia cepacia plasmid pIJB1, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggcaggcttcgcggcc	CRISPR spacer
ggcggcaggcttcgcggcc	Protospacer
*******************

15. spacer 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to MN096267 (Pseudomonas phage vB_PaS_IME307, complete genome) position: , mismatch: 1, identity: 0.969

ctgcatacgccgacaacgacccgcgcatgatc	CRISPR spacer
ctgcataccccgacaacgacccgcgcatgatc	Protospacer
******** ***********************

16. spacer 3.1|1124221|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NC_023575 (Pseudomonas phage vB_PaeP_Tr60_Ab31) position: , mismatch: 2, identity: 0.938

taggcccgatggacgtttgggacgatgaaacc	CRISPR spacer
ttggcccgatggacgtttgggacgatgaaaca	Protospacer
* ***************************** 

17. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NC_016138 (Pseudomonas aeruginosa plasmid pUM505, complete sequence) position: , mismatch: 2, identity: 0.938

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
agcggaaacatcacgaccagcgcggacatcag	Protospacer
***** ******** *****************

18. spacer 3.9|1124703|32|NZ_CP029093|CRISPRCasFinder,CRT matches to MN096267 (Pseudomonas phage vB_PaS_IME307, complete genome) position: , mismatch: 2, identity: 0.938

atcgtgatcaatgcccgccatgatttcgccgg	CRISPR spacer
atcgtgatcaatgcccgccacgacttcgccgg	Protospacer
********************.**.********

19. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039632 (Pseudomonas veronii strain Pvy plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
ttacccttaaaaggctgtaaaaggccttttag	Protospacer
*****.********** ***************

20. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 2, identity: 0.938

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
ttacctttaaaaggttgtaaaaggccttttag	Protospacer
**************.* ***************

21. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to DQ115836 (Cyanobacteria phage AS-1 contig_29 genomic sequence) position: , mismatch: 2, identity: 0.938

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
ttacccttaaaaggctgtaaaaggccttttag	Protospacer
*****.********** ***************

22. spacer 7.1|6252616|26|NZ_CP029093|PILER-CR matches to NZ_CP028567 (Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid pMCR5_045096, complete sequence) position: , mismatch: 2, identity: 0.923

cgcgatgccactcggtgcgttctttc	CRISPR spacer
cgcgatgccattcagtgcgttctttc	Protospacer
**********.**.************

23. spacer 7.1|6252616|26|NZ_CP029093|PILER-CR matches to NZ_CP015000 (Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence) position: , mismatch: 2, identity: 0.923

cgcgatgccactcggtgcgttctttc	CRISPR spacer
ctcgatgccactcggtgcgctctttc	Protospacer
* *****************.******

24. spacer 7.1|6252616|26|NZ_CP029093|PILER-CR matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.923

cgcgatgccactcggtgcgttctttc	CRISPR spacer
cgcgatgccactcggtgcgttcctgc	Protospacer
**********************.* *

25. spacer 7.1|6252616|26|NZ_CP029093|PILER-CR matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 2, identity: 0.923

cgcgatgccactcggtgcgttctttc	CRISPR spacer
ctcgatgccactcggtgcgctctttc	Protospacer
* *****************.******

26. spacer 7.1|6252616|26|NZ_CP029093|PILER-CR matches to MK947460 (Salmonella phage vB_SenS_SB28, complete genome) position: , mismatch: 2, identity: 0.923

cgcgatgccactcggtgcgttctttc	CRISPR spacer
cgcgatgccactcggtctgttctttc	Protospacer
**************** .********

27. spacer 7.1|6252616|26|NZ_CP029093|PILER-CR matches to NZ_CP027861 (Ahniella affigens strain D13 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgatgccactcggtgcgttctttc	CRISPR spacer
cgcgatgccactcggtgcgctcttgg	Protospacer
*******************.****  

28. spacer 7.1|6252616|26|NZ_CP029093|PILER-CR matches to MT075871 (Klebsiella phage vB_KleS-HSE3, complete genome) position: , mismatch: 3, identity: 0.885

cgcgatgccactcggtgcgttctttc	CRISPR spacer
tgcgatgccactcggtgttttctttc	Protospacer
.****************. *******

29. spacer 7.1|6252616|26|NZ_CP029093|PILER-CR matches to NZ_CP034355 (Pseudomonas aeruginosa strain IMP-13 plasmid pPYO_TB, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgatgccactcggtgcgttctttc	CRISPR spacer
cgcggtgccactcggtacgttcttgc	Protospacer
****.***********.******* *

30. spacer 7.1|6252616|26|NZ_CP029093|PILER-CR matches to NZ_CP005987 (Acidithiobacillus caldus ATCC 51756 plasmid megap mpAca1.1, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgatgccactcggtgcgttctttc	CRISPR spacer
cacgatgccactcggtgcgttcctgg	Protospacer
*.********************.*  

31. spacer 7.1|6252616|26|NZ_CP029093|PILER-CR matches to NZ_LR134425 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 16) position: , mismatch: 4, identity: 0.846

cgcgatgccactcggtgcgttctttc	CRISPR spacer
cgcgatgccattcagtgcgttcttgt	Protospacer
**********.**.********** .

32. spacer 7.1|6252616|26|NZ_CP029093|PILER-CR matches to MH617654 (Caudovirales sp. isolate ctbf53, complete genome) position: , mismatch: 5, identity: 0.808

cgcgatgccactcggtgcgttctttc	CRISPR spacer
tgcgatgccattcggtacgttcttgg	Protospacer
.*********.*****.*******  

33. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025992 (Lactobacillus plantarum subsp. plantarum strain LB1-2 plasmid pLB1-2A, complete sequence) position: , mismatch: 6, identity: 0.812

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
agcggcaacatcaccaccagcacgagcaataa	Protospacer
*********************.**..** .*.

34. spacer 6.4|6219672|31|NZ_CP029093|CRT matches to MT684592 (Microbacterium phage Aesir, complete genome) position: , mismatch: 6, identity: 0.806

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
cggagccttcttcgcggcagcggtcttcgcc	Protospacer
 * .**   **********************

35. spacer 6.4|6219672|31|NZ_CP029093|CRT matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 6, identity: 0.806

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
ggcggcagccttcgcggcagcggcctccttg	Protospacer
******** **************.**.* . 

36. spacer 6.4|6219672|31|NZ_CP029093|CRT matches to NZ_CP035506 (Haematobacter massiliensis strain OT1 plasmid pOT1-6, complete sequence) position: , mismatch: 6, identity: 0.806

-ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
ctgctcca-gcatcgcggcagcggtctccgcc	Protospacer
  **  ** ** ***************.****

37. spacer 6.5|6219747|31|NZ_CP029093|CRT matches to MT684592 (Microbacterium phage Aesir, complete genome) position: , mismatch: 6, identity: 0.806

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
cggagccttcttcgcggcagcggtcttcgcc	Protospacer
 * .**   **********************

38. spacer 6.5|6219747|31|NZ_CP029093|CRT matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 6, identity: 0.806

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
ggcggcagccttcgcggcagcggcctccttg	Protospacer
******** **************.**.* . 

39. spacer 6.5|6219747|31|NZ_CP029093|CRT matches to NZ_CP035506 (Haematobacter massiliensis strain OT1 plasmid pOT1-6, complete sequence) position: , mismatch: 6, identity: 0.806

-ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
ctgctcca-gcatcgcggcagcggtctccgcc	Protospacer
  **  ** ** ***************.****

40. spacer 6.6|6219822|31|NZ_CP029093|CRT matches to MT684592 (Microbacterium phage Aesir, complete genome) position: , mismatch: 6, identity: 0.806

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
cggagccttcttcgcggcagcggtcttcgcc	Protospacer
 * .**   **********************

41. spacer 6.6|6219822|31|NZ_CP029093|CRT matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 6, identity: 0.806

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
ggcggcagccttcgcggcagcggcctccttg	Protospacer
******** **************.**.* . 

42. spacer 6.6|6219822|31|NZ_CP029093|CRT matches to NZ_CP035506 (Haematobacter massiliensis strain OT1 plasmid pOT1-6, complete sequence) position: , mismatch: 6, identity: 0.806

-ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
ctgctcca-gcatcgcggcagcggtctccgcc	Protospacer
  **  ** ** ***************.****

43. spacer 3.3|1124341|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016618 (Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

tttctgtgggatgccctgccatcgc-cctggcg	CRISPR spacer
ggtctgagggaagccctgccatcgcttctcgc-	Protospacer
  **** **** ************* .** ** 

44. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040453 (Halomonas sp. PA16-9 plasmid p_unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
aaggcgaacatcaccaccagcggtgacatcaa	Protospacer
*. *  ****************  *******.

45. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NC_022533 (Plautia stali symbiont plasmid pPstS1 DNA, complete genome) position: , mismatch: 7, identity: 0.781

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
agcggcaacatcaccaccacggcgaccagcgc	Protospacer
*******************  ***. ** *. 

46. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY433363 (Proteus mirabilis strain R997 plasmid pR997, complete sequence) position: , mismatch: 7, identity: 0.781

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
aactgctgcatcacctccagcgcgaacatcat	Protospacer
*.* ** .******* ********.****** 

47. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 7, identity: 0.781

agcggcaacatcaccaccagcgcggacatcag-	CRISPR spacer
atcggcagcatcaccaccagcccgg-cgtcgaa	Protospacer
* *****.************* *** *.**.. 

48. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040764 (Paracoccus sp. 2251 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

-agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
aggccgccg-atcaccaccagcgcggtcagcag	Protospacer
 .** ** . **************** ** ***

49. spacer 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ctgcata-cgccgacaacgacccgcgcatgatc	CRISPR spacer
-tgggcatcgccgacgacgacccgcgcgtgaac	Protospacer
 ** ..* *******.***********.*** *

50. spacer 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781

ctgcata-cgccgacaacgacccgcgcatgatc	CRISPR spacer
-tgggcatcgccgacgacgacccgcgcgtgaac	Protospacer
 ** ..* *******.***********.*** *

51. spacer 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ctgcatacgccgacaacgacccgcgcatgatc	CRISPR spacer
ccgcactgcccgccaacgacccgcgcgtgatc	Protospacer
*.***.   *** *************.*****

52. spacer 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ctgcatacgccgacaacgacccgcgcatgatc	CRISPR spacer
ccgcactgcccgccaacgacccgcgcgtgatc	Protospacer
*.***.   *** *************.*****

53. spacer 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781

ctgcatacgccgacaacgacccgcgcatgatc	CRISPR spacer
ccgcactgcccgccaacgacccgcgcgtgatc	Protospacer
*.***.   *** *************.*****

54. spacer 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ctgcatacgccgacaacgacccgcgcatgatc	CRISPR spacer
ccgcactgcccgccaacgacccgcgcgtgatc	Protospacer
*.***.   *** *************.*****

55. spacer 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781

ctgcatacgccgacaacgacccgcgcatgatc	CRISPR spacer
ccgcactgcccgccaacgacccgcgcgtgatc	Protospacer
*.***.   *** *************.*****

56. spacer 6.4|6219672|31|NZ_CP029093|CRT matches to MT639643 (Microbacterium phage FreddieHg, complete genome) position: , mismatch: 7, identity: 0.774

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
cggagccttcttcgtggcagcggtcttcgcc	Protospacer
 * .**   *****.****************

57. spacer 6.4|6219672|31|NZ_CP029093|CRT matches to MN497954 (Microbacterium phage Hiddenleaf, complete genome) position: , mismatch: 7, identity: 0.774

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
cggagccttcttcgtggcagcggtcttcgcc	Protospacer
 * .**   *****.****************

58. spacer 6.4|6219672|31|NZ_CP029093|CRT matches to MT684591 (Microbacterium phage Chivey, complete genome) position: , mismatch: 7, identity: 0.774

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
cggagccttcttcgtggcagcggtcttcgcc	Protospacer
 * .**   *****.****************

59. spacer 6.4|6219672|31|NZ_CP029093|CRT matches to MT522003 (Microbacterium phage Rie18, complete genome) position: , mismatch: 7, identity: 0.774

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
cggagccttcttcgcggcggcggtcttcgcc	Protospacer
 * .**   *********.************

60. spacer 6.5|6219747|31|NZ_CP029093|CRT matches to MT639643 (Microbacterium phage FreddieHg, complete genome) position: , mismatch: 7, identity: 0.774

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
cggagccttcttcgtggcagcggtcttcgcc	Protospacer
 * .**   *****.****************

61. spacer 6.5|6219747|31|NZ_CP029093|CRT matches to MN497954 (Microbacterium phage Hiddenleaf, complete genome) position: , mismatch: 7, identity: 0.774

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
cggagccttcttcgtggcagcggtcttcgcc	Protospacer
 * .**   *****.****************

62. spacer 6.5|6219747|31|NZ_CP029093|CRT matches to MT684591 (Microbacterium phage Chivey, complete genome) position: , mismatch: 7, identity: 0.774

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
cggagccttcttcgtggcagcggtcttcgcc	Protospacer
 * .**   *****.****************

63. spacer 6.5|6219747|31|NZ_CP029093|CRT matches to MT522003 (Microbacterium phage Rie18, complete genome) position: , mismatch: 7, identity: 0.774

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
cggagccttcttcgcggcggcggtcttcgcc	Protospacer
 * .**   *********.************

64. spacer 6.6|6219822|31|NZ_CP029093|CRT matches to MT639643 (Microbacterium phage FreddieHg, complete genome) position: , mismatch: 7, identity: 0.774

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
cggagccttcttcgtggcagcggtcttcgcc	Protospacer
 * .**   *****.****************

65. spacer 6.6|6219822|31|NZ_CP029093|CRT matches to MN497954 (Microbacterium phage Hiddenleaf, complete genome) position: , mismatch: 7, identity: 0.774

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
cggagccttcttcgtggcagcggtcttcgcc	Protospacer
 * .**   *****.****************

66. spacer 6.6|6219822|31|NZ_CP029093|CRT matches to MT684591 (Microbacterium phage Chivey, complete genome) position: , mismatch: 7, identity: 0.774

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
cggagccttcttcgtggcagcggtcttcgcc	Protospacer
 * .**   *****.****************

67. spacer 6.6|6219822|31|NZ_CP029093|CRT matches to MT522003 (Microbacterium phage Rie18, complete genome) position: , mismatch: 7, identity: 0.774

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
cggagccttcttcgcggcggcggtcttcgcc	Protospacer
 * .**   *********.************

68. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
ggcggcagcttcaccaccagcgcggcggccac	Protospacer
.******.* ***************  ..** 

69. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 8, identity: 0.75

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
cgcggcgacatcaccaccagcgtggtgccgag	Protospacer
 *****.***************.**   . **

70. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
cccgtcgccatcaccagcggcgcggacatcac	Protospacer
  ** *. ******** *.************ 

71. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 8, identity: 0.75

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
agcgccaccatcaccaccagcgccgccgacca	Protospacer
**** ** *************** * *. * .

72. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NC_021279 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
agcgccaccatcaccaccagcgccgccgacca	Protospacer
**** ** *************** * *. * .

73. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
agcggcaacaccaccgccagcgccaagcacaa	Protospacer
**********.****.******* .*   **.

74. spacer 4.2|2888767|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP008954 (Amycolatopsis japonica strain DSM 44213 plasmid pAmyja1, complete sequence) position: , mismatch: 8, identity: 0.75

tttgagtt---ctggtgcggtcattggcggttccc	CRISPR spacer
---aggctcggctggtgcggtcatcggcggttcct	Protospacer
   ..*.*   *************.*********.

75. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NC_019487 (Bacillus phage SP10, complete genome) position: , mismatch: 8, identity: 0.75

----ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
gacactaac----aaaggctttaaaaagccttgtag	Protospacer
    .** *    *************.***** ***

76. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to AB605730 (Bacillus phage SP10 DNA, complete sequence) position: , mismatch: 8, identity: 0.75

----ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
gacactaac----aaaggctttaaaaagccttgtag	Protospacer
    .** *    *************.***** ***

77. spacer 6.4|6219672|31|NZ_CP029093|CRT matches to NZ_CP017756 (Cupriavidus malaysiensis strain USMAA1020 isolate pure plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
tgtctcgggcttcgcggcagcgatcttcgaa	Protospacer
 *.  *.***************.******  

78. spacer 6.4|6219672|31|NZ_CP029093|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 8, identity: 0.742

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
gggggcaggcttcgcggcagggggtgccggt	Protospacer
** ***************** ** . .** .

79. spacer 6.5|6219747|31|NZ_CP029093|CRT matches to NZ_CP017756 (Cupriavidus malaysiensis strain USMAA1020 isolate pure plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
tgtctcgggcttcgcggcagcgatcttcgaa	Protospacer
 *.  *.***************.******  

80. spacer 6.5|6219747|31|NZ_CP029093|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 8, identity: 0.742

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
gggggcaggcttcgcggcagggggtgccggt	Protospacer
** ***************** ** . .** .

81. spacer 6.6|6219822|31|NZ_CP029093|CRT matches to NZ_CP017756 (Cupriavidus malaysiensis strain USMAA1020 isolate pure plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
tgtctcgggcttcgcggcagcgatcttcgaa	Protospacer
 *.  *.***************.******  

82. spacer 6.6|6219822|31|NZ_CP029093|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 8, identity: 0.742

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
gggggcaggcttcgcggcagggggtgccggt	Protospacer
** ***************** ** . .** .

83. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 9, identity: 0.719

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
agcggcaacatcacccgcagcgcgtggttggc	Protospacer
***************  ******* .  * . 

84. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019938 (Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
agcggcaacatcagcagcagcgccagaaagaa	Protospacer
************* ** ****** .. *  *.

85. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT703509 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 5) position: , mismatch: 9, identity: 0.719

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
agcggcaacaacaccagcagcgcagctggtat	Protospacer
********** ***** ******.* .. .* 

86. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015274 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 2, complete sequence) position: , mismatch: 9, identity: 0.719

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
agcggcaacaacaccagcagcgcagctggtat	Protospacer
********** ***** ******.* .. .* 

87. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
agcggcaacatcacggccagcgcacgcgatgg	Protospacer
************** .*******. .*. ..*

88. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019223 (Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_2, complete sequence) position: , mismatch: 9, identity: 0.719

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
agcggcaacaacaccagcagcgcagctggtat	Protospacer
********** ***** ******.* .. .* 

89. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045965 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_02, complete sequence) position: , mismatch: 9, identity: 0.719

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
agcggcaacaacaccagcagcgcagctggtat	Protospacer
********** ***** ******.* .. .* 

90. spacer 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040762 (Paracoccus sp. 2251 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ctgcatacgccgacaacgacccgcgcatgatc	CRISPR spacer
tggggatcgccgacgacgacccgcgcgtgaac	Protospacer
. * .  *******.***********.*** *

91. spacer 3.9|1124703|32|NZ_CP029093|CRISPRCasFinder,CRT matches to NC_022044 (Paracoccus aminophilus JCM 7686 plasmid pAMI6, complete sequence) position: , mismatch: 9, identity: 0.719

atcgtgatcaatgcccgccatgatttcgccgg	CRISPR spacer
atcgagatcaatgcccgccaagacgccacgcc	Protospacer
**** *************** **. .*.*   

92. spacer 6.4|6219672|31|NZ_CP029093|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.71

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
cgcggcaggcttcgcggccgcggcggcgttc	Protospacer
 ***************** ****.  .  .*

93. spacer 6.4|6219672|31|NZ_CP029093|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.71

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
tccggctggcttggcggcagcggtcagatcg	Protospacer
  **** ***** ************    * 

94. spacer 6.5|6219747|31|NZ_CP029093|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.71

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
cgcggcaggcttcgcggccgcggcggcgttc	Protospacer
 ***************** ****.  .  .*

95. spacer 6.5|6219747|31|NZ_CP029093|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.71

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
tccggctggcttggcggcagcggtcagatcg	Protospacer
  **** ***** ************    * 

96. spacer 6.6|6219822|31|NZ_CP029093|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.71

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
cgcggcaggcttcgcggccgcggcggcgttc	Protospacer
 ***************** ****.  .  .*

97. spacer 6.6|6219822|31|NZ_CP029093|CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.71

ggcggcaggcttcgcggcagcggtcttcgcc	CRISPR spacer
tccggctggcttggcggcagcggtcagatcg	Protospacer
  **** ***** ************    * 

98. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to AF151676 (Bacteriophage P-EibE ORF-191E (orf-191E), immunoglobulin-binding protein EibE (eibE), and ORF-156E (orf-156E) genes, complete cds) position: , mismatch: 10, identity: 0.688

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
tatccaaacatcaccaccatctcggacatcgt	Protospacer
 ..   ************* * ********. 

99. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019063 (Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
gtgaaaaacagcaccaccagcgcggccataaa	Protospacer
.  .. **** ************** *** *.

100. spacer 3.6|1124523|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 10, identity: 0.688

agcggcaacatcaccaccagcgcggacatcag	CRISPR spacer
agcggcaacaccaccaacagcgcaccacctac	Protospacer
**********.***** ******.    ..* 

101. spacer 3.7|1124583|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 10, identity: 0.688

ctgcatacgccgacaacgacccgcgcatgatc	CRISPR spacer
cactcgacgctgacaacgaccagcgcatggcg	Protospacer
*  .  ****.********** *******.. 

102. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134438 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 29) position: , mismatch: 10, identity: 0.688

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
tcgatttttaaaggctttaaaaggcgttaata	Protospacer
*.. .*** **************** **   .

103. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to AP013686 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S46-C68, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
gcatacggcaaaggatttaaaagggcttttag	Protospacer
 .*. .   ***** ********* *******

104. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to AP013679 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S29-C55, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
gcatacggcaaaggatttaaaagggcttttag	Protospacer
 .*. .   ***** ********* *******

105. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to AP013682 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S36-C62, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
gcatacggcaaaggatttaaaagggcttttag	Protospacer
 .*. .   ***** ********* *******

106. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to AP013421 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C49A-MedDCM-OCT-S31-C44) position: , mismatch: 10, identity: 0.688

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
gcatacggcaaaggatttaaaagggcttttag	Protospacer
 .*. .   ***** ********* *******

107. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to AP013677 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S25-C56, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
gcatacggcaaaggatttaaaagggcttttag	Protospacer
 .*. .   ***** ********* *******

108. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to AP013683 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S40-C57, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
gcatacggcaaaggatttaaaagggcttttag	Protospacer
 .*. .   ***** ********* *******

109. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to AP013685 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S45-C58, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
gcatacggcaaaggatttaaaagggcttttag	Protospacer
 .*. .   ***** ********* *******

110. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to AP013684 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S44-C58, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
gcatacggcaaaggatttaaaagggcttttag	Protospacer
 .*. .   ***** ********* *******

111. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to AP013676 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S24-C47, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
gcatacggcaaaggatttaaaagggcttttag	Protospacer
 .*. .   ***** ********* *******

112. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to AP013678 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C49A-MedDCM-OCT-S26-C193, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
gcatacggcaaaggatttaaaagggcttttag	Protospacer
 .*. .   ***** ********* *******

113. spacer 4.4|2888887|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049749 (Rhodococcus fascians A21d2 plasmid pA21d2, complete sequence) position: , mismatch: 11, identity: 0.656

atccggcgtatgtcatcccgacaagcgccatt	CRISPR spacer
gctgtgcgtatgccatgccgacaagcgcaccc	Protospacer
...  *******.*** ***********  ..

114. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025860 (Escherichia coli strain 504239 plasmid p504239_101, complete sequence) position: , mismatch: 11, identity: 0.656

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
aagcctataaaaggctttaaaacgcccccctt	Protospacer
  .*** *************** ***....  

115. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025904 (Escherichia coli strain 300709 plasmid p300709_97, complete sequence) position: , mismatch: 11, identity: 0.656

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
aagcctataaaaggctttaaaacgcccccctt	Protospacer
  .*** *************** ***....  

116. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025858 (Escherichia coli strain 504838 plasmid p504838_88, complete sequence) position: , mismatch: 11, identity: 0.656

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
aagcctataaaaggctttaaaacgcccccctt	Protospacer
  .*** *************** ***....  

117. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024280 (Escherichia coli strain ATCC 43896 plasmid unnamed2) position: , mismatch: 11, identity: 0.656

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
aagcctataaaaggctttaaaacgcccccctt	Protospacer
  .*** *************** ***....  

118. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to CP025971 (Escherichia coli strain 11573 a-1 plasmid p11573a1_92, complete sequence) position: , mismatch: 11, identity: 0.656

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
aagcctataaaaggctttaaaacgcccccctt	Protospacer
  .*** *************** ***....  

119. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to CP025974 (Escherichia coli strain 10802 a plasmid p10802a_92, complete sequence) position: , mismatch: 11, identity: 0.656

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
aagcctataaaaggctttaaaacgcccccctt	Protospacer
  .*** *************** ***....  

120. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to CP025977 (Escherichia coli strain 10754 a-1 plasmid p10754a1_92, complete sequence) position: , mismatch: 11, identity: 0.656

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
aagcctataaaaggctttaaaacgcccccctt	Protospacer
  .*** *************** ***....  

121. spacer 4.5|2888947|32|NZ_CP029093|PILER-CR,CRISPRCasFinder,CRT matches to NC_017724 (Escherichia coli ETEC H10407 plasmid p948, complete sequence) position: , mismatch: 11, identity: 0.656

ttacctttaaaaggctttaaaaggccttttag	CRISPR spacer
aagcctataaaaggctttaaaacgcccccctt	Protospacer
  .*** *************** ***....  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 63031 : 112236 47 Clostridioides_phage(25.0%) transposase,plate NA
DBSCAN-SWA_2 651308 : 729619 77 Pseudomonas_phage(21.21%) integrase,tail,plate,holin,tRNA attL 645090:645107|attR 713393:713410
DBSCAN-SWA_3 1463618 : 1472641 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_4 1972768 : 2034549 80 Pseudomonas_phage(91.07%) integrase,terminase,lysis,protease,holin,tRNA,portal attL 1983859:1983875|attR 2003355:2003371
DBSCAN-SWA_5 2440144 : 2447311 7 uncultured_Caudovirales_phage(66.67%) NA NA
DBSCAN-SWA_6 2610636 : 2617528 9 uncultured_Caudovirales_phage(83.33%) tRNA NA
DBSCAN-SWA_7 2668965 : 2674927 9 Pseudomonas_phage(66.67%) NA NA
DBSCAN-SWA_8 3561125 : 3631641 92 Pseudomonas_phage(79.73%) transposase,integrase,tail,head,terminase,protease,tRNA attL 3560794:3560853|attR 3624369:3624454
DBSCAN-SWA_9 4581019 : 4600176 21 Haemophilus_phage(50.0%) tRNA,holin,tail,plate NA
DBSCAN-SWA_10 4689977 : 4760588 57 uncultured_virus(27.27%) transposase,integrase attL 4708455:4708472|attR 4748323:4748340
DBSCAN-SWA_11 6051175 : 6156077 113 Pseudomonas_phage(74.42%) integrase,tail,head,terminase,lysis,protease,capsid,tRNA,portal attL 6085006:6085052|attR 6116940:6116986
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP029093.1|WP_058129723.1|6065183_6065444_-|DUF2164-domain-containing-protein 6065183_6065444_- 86 aa aa NA NA NA 6051175-6156077 yes