Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP044978 Bacillus thuringiensis strain BT62 chromosome, complete genome 4 crisprs csa3,DEDDh,cas14k,cas14j,cas3,DinG,Cas14u_CAS-V,WYL 1 6 7 0
NZ_CP044981 Bacillus thuringiensis strain BT62 plasmid pBT62C, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP044982 Bacillus thuringiensis strain BT62 plasmid pBT62D, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP044980 Bacillus thuringiensis strain BT62 plasmid pBT62B, complete sequence 0 crisprs csa3,cas6,cas8b1,cas7b,cas5,cas14j 0 0 0 0
NZ_CP044979 Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence 0 crisprs cas14j,csa3 0 0 40 0

Results visualization

1. NZ_CP044978
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044978_1 574383-574516 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044978_2 3136600-3136961 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044978_3 3488000-3488185 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044978_4 4042199-4042306 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP044978_4 4.1|4042225|56|NZ_CP044978|CRISPRCasFinder 4042225-4042280 56 NZ_CP044978.1 4042184-4042239 1 0.982
NZ_CP044978_4 4.1|4042225|56|NZ_CP044978|CRISPRCasFinder 4042225-4042280 56 NZ_CP044978.1 5047459-5047514 1 0.982
NZ_CP044978_4 4.1|4042225|56|NZ_CP044978|CRISPRCasFinder 4042225-4042280 56 NZ_CP044978.1 5047500-5047555 1 0.982
NZ_CP044978_4 4.1|4042225|56|NZ_CP044978|CRISPRCasFinder 4042225-4042280 56 NZ_CP044978.1 268865-268920 2 0.964

1. spacer 4.1|4042225|56|NZ_CP044978|CRISPRCasFinder matches to position: 4042184-4042239, mismatch: 1, identity: 0.982

caaatatatctatcacaacttacaatatatcaacgatttttcaaatatatctatca	CRISPR spacer
caaatatatctatcgcaacttacaatatatcaacgatttttcaaatatatctatca	Protospacer
**************.*****************************************

2. spacer 4.1|4042225|56|NZ_CP044978|CRISPRCasFinder matches to position: 5047459-5047514, mismatch: 1, identity: 0.982

caaatatatctatcacaacttacaatatatcaacgatttttcaaatatatctatca	CRISPR spacer
caaatatatctatcacaacttgcaatatatcaacgatttttcaaatatatctatca	Protospacer
*********************.**********************************

3. spacer 4.1|4042225|56|NZ_CP044978|CRISPRCasFinder matches to position: 5047500-5047555, mismatch: 1, identity: 0.982

caaatatatctatcacaacttacaatatatcaacgatttttcaaatatatctatca	CRISPR spacer
caaatatatctatcacaacttgcaatatatcaacgatttttcaaatatatctatca	Protospacer
*********************.**********************************

4. spacer 4.1|4042225|56|NZ_CP044978|CRISPRCasFinder matches to position: 268865-268920, mismatch: 2, identity: 0.964

caaatatatctatcacaacttacaatatatcaacgatttttcaaatatatctatca	CRISPR spacer
caaatatatctatcataacttgcaatatatcaacgatttttcaaatatatctatca	Protospacer
***************.*****.**********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP044978_2 2.1|3136618|21|NZ_CP044978|CRT 3136618-3136638 21 MN693263 Marine virus AFVG_25M296, complete genome 12051-12071 1 0.952
NZ_CP044978_2 2.1|3136618|21|NZ_CP044978|CRT 3136618-3136638 21 MN693263 Marine virus AFVG_25M296, complete genome 13692-13712 1 0.952
NZ_CP044978_2 2.1|3136618|21|NZ_CP044978|CRT 3136618-3136638 21 MN693383 Marine virus AFVG_25M295, complete genome 21445-21465 1 0.952
NZ_CP044978_2 2.1|3136618|21|NZ_CP044978|CRT 3136618-3136638 21 MN693383 Marine virus AFVG_25M295, complete genome 19805-19825 1 0.952
NZ_CP044978_4 4.1|4042225|56|NZ_CP044978|CRISPRCasFinder 4042225-4042280 56 NZ_CP050185 Bacillus thuringiensis strain HER1410 plasmid pLUSID2, complete sequence 93760-93815 3 0.946
NZ_CP044978_2 2.3|3136726|27|NZ_CP044978|CRT 3136726-3136752 27 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 472800-472826 4 0.852
NZ_CP044978_2 2.3|3136726|27|NZ_CP044978|CRT 3136726-3136752 27 MN694632 Marine virus AFVG_250M389, complete genome 26322-26348 5 0.815
NZ_CP044978_2 2.3|3136726|27|NZ_CP044978|CRT 3136726-3136752 27 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 1292006-1292032 6 0.778
NZ_CP044978_2 2.3|3136726|27|NZ_CP044978|CRT 3136726-3136752 27 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 350645-350671 6 0.778
NZ_CP044978_1 1.1|574406|31|NZ_CP044978|CRISPRCasFinder 574406-574436 31 JX238501 Bacillus phage phiAGATE, complete genome 124559-124589 8 0.742
NZ_CP044978_3 3.2|3488087|30|NZ_CP044978|CRISPRCasFinder 3488087-3488116 30 CP011075 Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence 733417-733446 8 0.733
NZ_CP044978_3 3.2|3488087|30|NZ_CP044978|CRISPRCasFinder 3488087-3488116 30 MH617454 Microviridae sp. isolate ctig683, complete genome 1051-1080 8 0.733
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 MN812210 Flavobacterium phage vB_FspS_hemulen9-1, complete genome 22854-22887 9 0.735
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 MN812215 Flavobacterium phage vB_FspS_lillamy9-4, complete genome 22191-22224 9 0.735
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 MN812216 Flavobacterium phage vB_FspS_lillamy9-5, complete genome 22191-22224 9 0.735
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 NC_048835 Flavobacterium phage vB_FspS_lillamy9-1, complete genome 22191-22224 9 0.735
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 MN812213 Flavobacterium phage vB_FspS_lillamy9-2, complete genome 22191-22224 9 0.735
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 MN812230 Flavobacterium phage vB_FspS_sniff9-2, complete genome 21831-21864 9 0.735
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 MN812209 Flavobacterium phage vB_FspS_hemulen6-2, complete genome 22983-23016 9 0.735
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 MN812218 Flavobacterium phage vB_FspS_lillamy9-7, complete genome 21454-21487 9 0.735
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 MN812233 Flavobacterium phage vB_FspS_snork9-1, complete genome 22007-22040 9 0.735
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 MN812219 Flavobacterium phage vB_FspS_morran9-1, complete genome 22308-22341 9 0.735
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 MN812217 Flavobacterium phage vB_FspS_lillamy9-6, complete genome 21930-21963 9 0.735
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 NC_048840 Flavobacterium phage vB_FspS_snork6-1, complete genome 22137-22170 9 0.735
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 NC_048839 Flavobacterium phage vB_FspS_sniff9-1, complete genome 22057-22090 9 0.735
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 NC_048842 Flavobacterium phage vB_FspS_stinky9-1, complete genome 21673-21706 9 0.735
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 MN812232 Flavobacterium phage vB_FspS_snork6-2, complete genome 21655-21688 9 0.735
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 MN812208 Flavobacterium phage vB_FspS_hemulen6-1, complete genome 22983-23016 9 0.735
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 47181-47214 11 0.676
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 47565-47598 11 0.676
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 47949-47982 11 0.676
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 48333-48366 11 0.676
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 48717-48750 11 0.676
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 49101-49134 11 0.676
NZ_CP044978_1 1.2|574460|34|NZ_CP044978|CRISPRCasFinder 574460-574493 34 NZ_HG813246 Staphylococcus epidermidis PM221 plasmid 1, complete sequence 49485-49518 11 0.676

1. spacer 2.1|3136618|21|NZ_CP044978|CRT matches to MN693263 (Marine virus AFVG_25M296, complete genome) position: , mismatch: 1, identity: 0.952

agcaacaggcccaacaggtcc	CRISPR spacer
cgcaacaggcccaacaggtcc	Protospacer
 ********************

2. spacer 2.1|3136618|21|NZ_CP044978|CRT matches to MN693263 (Marine virus AFVG_25M296, complete genome) position: , mismatch: 1, identity: 0.952

agcaacaggcccaacaggtcc	CRISPR spacer
agcaacaggcccaacagggcc	Protospacer
****************** **

3. spacer 2.1|3136618|21|NZ_CP044978|CRT matches to MN693383 (Marine virus AFVG_25M295, complete genome) position: , mismatch: 1, identity: 0.952

agcaacaggcccaacaggtcc	CRISPR spacer
cgcaacaggcccaacaggtcc	Protospacer
 ********************

4. spacer 2.1|3136618|21|NZ_CP044978|CRT matches to MN693383 (Marine virus AFVG_25M295, complete genome) position: , mismatch: 1, identity: 0.952

agcaacaggcccaacaggtcc	CRISPR spacer
agcaacaggcccaacagggcc	Protospacer
****************** **

5. spacer 4.1|4042225|56|NZ_CP044978|CRISPRCasFinder matches to NZ_CP050185 (Bacillus thuringiensis strain HER1410 plasmid pLUSID2, complete sequence) position: , mismatch: 3, identity: 0.946

caaatatatctatcacaacttacaatatatcaacgatttttcaaatatatctatca	CRISPR spacer
cgaatatatctatcataacttacaatatatcaacgatttttaaaatatatctatca	Protospacer
*.*************.************************* **************

6. spacer 2.3|3136726|27|NZ_CP044978|CRT matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

cacaggtctagcaggagcaactggagc	CRISPR spacer
aacaggtctaacaggagcaacgggagt	Protospacer
 *********.********** ****.

7. spacer 2.3|3136726|27|NZ_CP044978|CRT matches to MN694632 (Marine virus AFVG_250M389, complete genome) position: , mismatch: 5, identity: 0.815

cacaggtctagcaggagcaactggagc	CRISPR spacer
aaaaggtatagcaggagcaactagaga	Protospacer
 * **** **************.*** 

8. spacer 2.3|3136726|27|NZ_CP044978|CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 6, identity: 0.778

cacaggtctagcaggagcaactggagc	CRISPR spacer
agaagggcgagcaggagcaactggagg	Protospacer
 . *** * ***************** 

9. spacer 2.3|3136726|27|NZ_CP044978|CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 6, identity: 0.778

cacaggtctagcaggagcaactggagc	CRISPR spacer
agaagggcgagcaggagcaactggagg	Protospacer
 . *** * ***************** 

10. spacer 1.1|574406|31|NZ_CP044978|CRISPRCasFinder matches to JX238501 (Bacillus phage phiAGATE, complete genome) position: , mismatch: 8, identity: 0.742

ttcttcttttttgtcactagttgaaccgctt	CRISPR spacer
ctaaccttttttgccactagttaaaccgccc	Protospacer
.*  .********.********.******..

11. spacer 3.2|3488087|30|NZ_CP044978|CRISPRCasFinder matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

gacactggaccgaccggaagtactggtctc	CRISPR spacer
gctactggacctaccggaggtactggcgct	Protospacer
* .******** ******.*******. ..

12. spacer 3.2|3488087|30|NZ_CP044978|CRISPRCasFinder matches to MH617454 (Microviridae sp. isolate ctig683, complete genome) position: , mismatch: 8, identity: 0.733

gacactggaccgaccggaagtactggtctc	CRISPR spacer
caaactggaccgaccggaacaactggagct	Protospacer
 * ****************  *****  ..

13. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to MN812210 (Flavobacterium phage vB_FspS_hemulen9-1, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

14. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to MN812215 (Flavobacterium phage vB_FspS_lillamy9-4, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

15. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to MN812216 (Flavobacterium phage vB_FspS_lillamy9-5, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

16. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to NC_048835 (Flavobacterium phage vB_FspS_lillamy9-1, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

17. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to MN812213 (Flavobacterium phage vB_FspS_lillamy9-2, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

18. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to MN812230 (Flavobacterium phage vB_FspS_sniff9-2, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

19. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to MN812209 (Flavobacterium phage vB_FspS_hemulen6-2, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

20. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to MN812218 (Flavobacterium phage vB_FspS_lillamy9-7, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

21. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to MN812233 (Flavobacterium phage vB_FspS_snork9-1, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

22. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to MN812219 (Flavobacterium phage vB_FspS_morran9-1, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

23. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to MN812217 (Flavobacterium phage vB_FspS_lillamy9-6, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

24. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to NC_048840 (Flavobacterium phage vB_FspS_snork6-1, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

25. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to NC_048839 (Flavobacterium phage vB_FspS_sniff9-1, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

26. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to NC_048842 (Flavobacterium phage vB_FspS_stinky9-1, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

27. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to MN812232 (Flavobacterium phage vB_FspS_snork6-2, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

28. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to MN812208 (Flavobacterium phage vB_FspS_hemulen6-1, complete genome) position: , mismatch: 9, identity: 0.735

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
ttcggcttctgttttattttctggttgcgatatt	Protospacer
.*.* ***********.********* **   *.

29. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

30. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

31. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

32. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

33. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

34. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

35. spacer 1.2|574460|34|NZ_CP044978|CRISPRCasFinder matches to NZ_HG813246 (Staphylococcus epidermidis PM221 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.676

cttgtcttctgttttactttctggtttcgtgctc	CRISPR spacer
tatgtcttctgtttttgtttctggttccccagct	Protospacer
. *************  *********.* .. ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1043206 : 1051154 6 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_2 1096765 : 1105741 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_3 2459096 : 2475864 11 Brevibacillus_phage(100.0%) tail NA
DBSCAN-SWA_4 2488834 : 2503399 12 Brevibacillus_phage(55.56%) NA NA
DBSCAN-SWA_5 2511522 : 2520910 9 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_6 2720738 : 2729409 8 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_7 5169892 : 5177578 9 Staphylococcus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP044982
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP044982_1 1608-1688 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP044982_1 1.1|1636|25|NZ_CP044982|CRISPRCasFinder 1636-1660 25 NZ_CP044982 Bacillus thuringiensis strain BT62 plasmid pBT62D, complete sequence 1636-1660 0 1.0

1. spacer 1.1|1636|25|NZ_CP044982|CRISPRCasFinder matches to NZ_CP044982 (Bacillus thuringiensis strain BT62 plasmid pBT62D, complete sequence) position: , mismatch: 0, identity: 1.0

taaaccgatacaagacacggagcgt	CRISPR spacer
taaaccgatacaagacacggagcgt	Protospacer
*************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP044979
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 29178 20 Vibrio_phage(33.33%) transposase NA
DBSCAN-SWA_2 32825 : 37288 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_3 50777 : 51203 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_4 55750 : 56842 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_5 62126 : 63650 1 Liberibacter_phage(100.0%) NA NA
DBSCAN-SWA_6 82733 : 83443 2 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_7 99877 : 102433 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_8 108444 : 108771 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_9 114654 : 122253 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_10 132181 : 133987 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_11 139030 : 142111 2 Aureococcus_anophage(50.0%) NA NA
DBSCAN-SWA_12 147065 : 148166 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_13 164521 : 165286 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_14 169738 : 170812 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_15 177886 : 192158 11 Bacillus_phage(60.0%) integrase,transposase attL 172732:172752|attR 204845:204865
DBSCAN-SWA_16 206023 : 209204 2 Geobacillus_virus(50.0%) NA NA
DBSCAN-SWA_17 213384 : 216932 2 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_18 219992 : 223980 4 Brevibacillus_phage(50.0%) NA NA
DBSCAN-SWA_19 247173 : 251171 4 Bacillus_phage(50.0%) integrase,transposase attL 237327:237343|attR 262597:262613
DBSCAN-SWA_20 256991 : 260411 2 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_21 266491 : 267481 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_22 279527 : 280460 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_23 289651 : 325639 8 Paenibacillus_phage(66.67%) NA NA
DBSCAN-SWA_24 329768 : 331865 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_25 341705 : 357728 6 Paenibacillus_phage(66.67%) NA NA
DBSCAN-SWA_26 366238 : 366877 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_27 375141 : 379442 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_28 384793 : 385072 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_29 394845 : 401848 6 Bacillus_phage(20.0%) NA NA
DBSCAN-SWA_30 405237 : 406374 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_31 412208 : 412631 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_32 431489 : 437751 6 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_33 497969 : 499619 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_34 504081 : 504804 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_35 512074 : 520231 6 Enterobacteria_phage(25.0%) tRNA NA
DBSCAN-SWA_36 524182 : 524398 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_37 527463 : 535461 5 uncultured_Caudovirales_phage(50.0%) transposase NA
DBSCAN-SWA_38 543048 : 548171 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_39 552116 : 555735 5 Tupanvirus(50.0%) protease NA
DBSCAN-SWA_40 561004 : 561721 1 Bacillus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage