Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP027606 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 4 0
NZ_CP027605 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed1, complete sequence 0 crisprs DEDDh 0 0 2 0
NZ_CP027604 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome 2 crisprs RT,cas3,DEDDh,WYL,csa3,DinG 0 1 9 0

Results visualization

1. NZ_CP027604
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027604_1 2113958-2114072 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027604_2 2893798-2893921 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP027604_2 2.1|2893841|38|NZ_CP027604|CRISPRCasFinder 2893841-2893878 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947

1. spacer 2.1|2893841|38|NZ_CP027604|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cagacgcaagatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
********..****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 592203 : 615524 17 Liberibacter_phage(33.33%) integrase,transposase attL 598401:598425|attR 615618:615642
DBSCAN-SWA_2 1850000 : 1857595 10 Enterobacteria_phage(30.0%) integrase attL 1842416:1842430|attR 1868109:1868123
DBSCAN-SWA_3 2336724 : 2367754 37 Cronobacter_phage(80.0%) portal,head,terminase,tail,holin,capsid,integrase attL 2336029:2336043|attR 2345190:2345204
DBSCAN-SWA_4 2705945 : 2766199 79 Enterobacterial_phage(26.92%) portal,protease,head,terminase,tail,holin,tRNA,capsid,integrase attL 2699623:2699640|attR 2773969:2773986
DBSCAN-SWA_5 3000724 : 3007973 8 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_6 3329464 : 3405906 79 Enterobacteria_phage(29.41%) plate,terminase,tail,holin,tRNA,integrase attL 3328105:3328120|attR 3353632:3353647
DBSCAN-SWA_7 3686494 : 3738836 75 Escherichia_phage(23.33%) integrase,terminase,tail,holin attL 3688408:3688436|attR 3736623:3736651
DBSCAN-SWA_8 3919341 : 3927087 7 Bodo_saltans_virus(16.67%) NA NA
DBSCAN-SWA_9 4373970 : 4459592 91 Enterobacteria_phage(19.15%) portal,plate,protease,terminase,tail,holin,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP027606
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 63477 60 Escherichia_phage(22.22%) integrase,transposase attL 33454:33513|attR 60555:61337
DBSCAN-SWA_2 69468 : 74107 4 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_3 77514 : 80413 3 Enterobacteria_phage(66.67%) NA NA
DBSCAN-SWA_4 85018 : 86358 2 Emiliania_huxleyi_virus(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP027605
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1579 : 19938 21 Salmonella_phage(73.68%) tail,transposase NA
DBSCAN-SWA_2 25574 : 111198 102 Salmonella_phage(93.62%) tail,integrase,terminase,portal attL 26450:26465|attR 36135:36150
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage