Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023681 Zymomonas mobilis subsp. mobilis strain ZM4 substr. 2032 plasmid pZM39, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP023677 Zymomonas mobilis subsp. mobilis strain ZM4 substr. 2032 chromosome, complete genome 4 crisprs cas1,cas3f,cas8f,cas5f,cas7f,cas6f,DinG,csa3,PD-DExK 1 5 2 0
NZ_CP023679 Zymomonas mobilis subsp. mobilis strain ZM4 substr. 2032 plasmid pZM33, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP023680 Zymomonas mobilis subsp. mobilis strain ZM4 substr. 2032 plasmid pZM36, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP023678 Zymomonas mobilis subsp. mobilis strain ZM4 substr. 2032 plasmid pZM32, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP023677
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023677_1 113783-114170 Orphan I-F
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023677_2 1245355-1245866 Orphan I-F
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023677_4 1606731-1606819 Orphan I-F
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023677_3 1606170-1606561 Orphan I-F
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP023677_2 2.6|1245684|33|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1245684-1245716 33 NZ_CP023677.1 293330-293362 1 0.97

1. spacer 2.6|1245684|33|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to position: 293330-293362, mismatch: 1, identity: 0.97

atcgaactgcgtgcctgatagccgatacgctga	CRISPR spacer
atcgaactacgtgcctgatagccgatacgctga	Protospacer
********.************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023677_3 3.2|1606258|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606258-1606289 32 NZ_CP021792 Zymomonas mobilis subsp. mobilis strain NRRL B-1960 plasmid pZMO1960_1A, complete sequence 1418-1449 0 1.0
NZ_CP023677_3 3.2|1606258|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606258-1606289 32 NC_019198 Zymomonas mobilis subsp. mobilis NCIMB 11163 plasmid pZMO1A, complete sequence 1479-1510 0 1.0
NZ_CP023677_3 3.2|1606258|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606258-1606289 32 NC_019210 Zymomonas mobilis subsp. mobilis plasmid pZMO1B, complete sequence 1479-1510 0 1.0
NZ_CP023677_3 3.2|1606258|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606258-1606289 32 NC_011363 Zymomonas mobilis subsp. mobilis ATCC 10988 plasmid pZMO1, complete sequence 1482-1513 1 0.969
NZ_CP023677_3 3.6|1606500|33|NZ_CP023677|CRISPRCasFinder,CRT 1606500-1606532 33 NC_001845 Zymomonas mobilis ATCC10988 plasmid pZMO1, complete sequence 653-685 1 0.97
NZ_CP023677_3 3.6|1606500|33|NZ_CP023677|CRISPRCasFinder,CRT 1606500-1606532 33 NC_009716 Escherichia sp. Sflu5 cryptic plasmid pAK51 3617-3649 1 0.97
NZ_CP023677_3 3.6|1606500|33|NZ_CP023677|CRISPRCasFinder,CRT 1606500-1606532 33 NC_005701 Zymomonas mobilis ATCC 10988 plasmid pZMO2, complete sequence 8-40 1 0.97
NZ_CP023677_3 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606198-1606229 32 NC_013784 Zymomonas mobilis subsp. mobilis ZM4 plasmid pZZM401, complete sequence 12257-12288 2 0.938
NZ_CP023677_3 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606198-1606229 32 NZ_CP003712 Zymomonas mobilis subsp. mobilis NRRL B-12526 plasmid pZM1252603, complete sequence 22552-22583 2 0.938
NZ_CP023677_3 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606198-1606229 32 NZ_CP003718 Zymomonas mobilis subsp. mobilis str. CP4 = NRRL B-14023 plasmid pZM1402303, complete sequence 12257-12288 2 0.938
NZ_CP023677_3 3.2|1606258|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606258-1606289 32 NC_019019 Zymomonas mobilis plasmid pZMN1-1, complete sequence 1475-1506 2 0.938
NZ_CP023677_3 3.2|1606258|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606258-1606289 32 NC_009716 Escherichia sp. Sflu5 cryptic plasmid pAK51 4439-4470 4 0.875
NZ_CP023677_3 3.2|1606258|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606258-1606289 32 NC_001845 Zymomonas mobilis ATCC10988 plasmid pZMO1, complete sequence 1513-1544 4 0.875
NZ_CP023677_3 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606198-1606229 32 MK448979 Streptococcus phage Javan534, complete genome 13215-13246 7 0.781
NZ_CP023677_3 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606198-1606229 32 MK448799 Streptococcus phage Javan535, complete genome 13215-13246 7 0.781
NZ_CP023677_3 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606198-1606229 32 MK448800 Streptococcus phage Javan539, complete genome 13216-13247 7 0.781
NZ_CP023677_3 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606198-1606229 32 MT939241 Enterococcus phage 9183, complete genome 69460-69491 7 0.781
NZ_CP023677_1 1.5|114051|32|NZ_CP023677|CRT,PILER-CR 114051-114082 32 NZ_CP018236 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed8 109921-109952 8 0.75
NZ_CP023677_2 2.4|1245564|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1245564-1245595 32 NZ_LR214998 Mycoplasma conjunctivae strain NCTC10147 plasmid 2 1218-1249 8 0.75
NZ_CP023677_2 2.4|1245564|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1245564-1245595 32 NZ_CP049042 Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_5, complete sequence 37299-37330 8 0.75
NZ_CP023677_2 2.4|1245564|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1245564-1245595 32 NZ_CP049700 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence 291573-291604 8 0.75
NZ_CP023677_3 3.2|1606258|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606258-1606289 32 CP053324 Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence 9447-9478 8 0.75
NZ_CP023677_3 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606198-1606229 32 MT446411 UNVERIFIED: Escherichia virus TH40, complete genome 67504-67535 9 0.719
NZ_CP023677_3 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606198-1606229 32 MT446421 UNVERIFIED: Escherichia virus TH55, complete genome 80840-80871 9 0.719
NZ_CP023677_3 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606198-1606229 32 MT446396 UNVERIFIED: Escherichia virus TH22, complete genome 137515-137546 9 0.719
NZ_CP023677_2 2.4|1245564|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1245564-1245595 32 MN692951 Marine virus AFVG_117M12, complete genome 19672-19703 10 0.688
NZ_CP023677_2 2.4|1245564|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1245564-1245595 32 NC_019526 Enterobacteria phage vB_KleM-RaK2, complete genome 67317-67348 10 0.688
NZ_CP023677_2 2.4|1245564|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1245564-1245595 32 MT708547 Klebsiella phage Muenster, complete genome 189204-189235 10 0.688
NZ_CP023677_2 2.4|1245564|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1245564-1245595 32 AB897757 Klebsiella phage K64-1 DNA, complete genome 67288-67319 10 0.688
NZ_CP023677_3 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606198-1606229 32 NC_020292 Clostridium saccharoperbutylacetonicum N1-4(HMT) plasmid Csp_135p, complete sequence 13543-13574 10 0.688
NZ_CP023677_3 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606198-1606229 32 MN583270 Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence 67159-67190 10 0.688
NZ_CP023677_3 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606198-1606229 32 MF360958 Salicola phage SCTP-2, complete genome 175798-175829 10 0.688
NZ_CP023677_3 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606198-1606229 32 JN231330 UNVERIFIED: Uncultured phage contig03 MexF-like gene, complete sequence 1910-1941 10 0.688
NZ_CP023677_2 2.4|1245564|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1245564-1245595 32 KY549443 Enterococcus phage EFP01, complete genome 110490-110521 11 0.656
NZ_CP023677_3 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT 1606198-1606229 32 AP013403 Uncultured Mediterranean phage uvMED DNA, complete genome, group G15, isolate: uvMED-CGR-U-MedDCM-OCT-S41-C7 29040-29071 11 0.656

1. spacer 3.2|1606258|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021792 (Zymomonas mobilis subsp. mobilis strain NRRL B-1960 plasmid pZMO1960_1A, complete sequence) position: , mismatch: 0, identity: 1.0

ttgacgctgtgagcgtgacgatatgctttcac	CRISPR spacer
ttgacgctgtgagcgtgacgatatgctttcac	Protospacer
********************************

2. spacer 3.2|1606258|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to NC_019198 (Zymomonas mobilis subsp. mobilis NCIMB 11163 plasmid pZMO1A, complete sequence) position: , mismatch: 0, identity: 1.0

ttgacgctgtgagcgtgacgatatgctttcac	CRISPR spacer
ttgacgctgtgagcgtgacgatatgctttcac	Protospacer
********************************

3. spacer 3.2|1606258|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to NC_019210 (Zymomonas mobilis subsp. mobilis plasmid pZMO1B, complete sequence) position: , mismatch: 0, identity: 1.0

ttgacgctgtgagcgtgacgatatgctttcac	CRISPR spacer
ttgacgctgtgagcgtgacgatatgctttcac	Protospacer
********************************

4. spacer 3.2|1606258|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to NC_011363 (Zymomonas mobilis subsp. mobilis ATCC 10988 plasmid pZMO1, complete sequence) position: , mismatch: 1, identity: 0.969

ttgacgctgtgagcgtgacgatatgctttcac	CRISPR spacer
ttgacgctgtgagcgtgacgatatgctttcgc	Protospacer
******************************.*

5. spacer 3.6|1606500|33|NZ_CP023677|CRISPRCasFinder,CRT matches to NC_001845 (Zymomonas mobilis ATCC10988 plasmid pZMO1, complete sequence) position: , mismatch: 1, identity: 0.97

atatagaagatttatcagatacgttgagaataa	CRISPR spacer
atatagaagatttgtcagatacgttgagaataa	Protospacer
*************.*******************

6. spacer 3.6|1606500|33|NZ_CP023677|CRISPRCasFinder,CRT matches to NC_009716 (Escherichia sp. Sflu5 cryptic plasmid pAK51) position: , mismatch: 1, identity: 0.97

atatagaagatttatcagatacgttgagaataa	CRISPR spacer
atatagaagatttgtcagatacgttgagaataa	Protospacer
*************.*******************

7. spacer 3.6|1606500|33|NZ_CP023677|CRISPRCasFinder,CRT matches to NC_005701 (Zymomonas mobilis ATCC 10988 plasmid pZMO2, complete sequence) position: , mismatch: 1, identity: 0.97

atatagaagatttatcagatacgttgagaataa	CRISPR spacer
atatagaagatttgtcagatacgttgagaataa	Protospacer
*************.*******************

8. spacer 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to NC_013784 (Zymomonas mobilis subsp. mobilis ZM4 plasmid pZZM401, complete sequence) position: , mismatch: 2, identity: 0.938

gcgcatcttctgatgcttttttagctgcggcc	CRISPR spacer
gcgcttcttctgctgcttttttagctgcggcc	Protospacer
**** ******* *******************

9. spacer 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP003712 (Zymomonas mobilis subsp. mobilis NRRL B-12526 plasmid pZM1252603, complete sequence) position: , mismatch: 2, identity: 0.938

gcgcatcttctgatgcttttttagctgcggcc	CRISPR spacer
gcgcttcttctgctgcttttttagctgcggcc	Protospacer
**** ******* *******************

10. spacer 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP003718 (Zymomonas mobilis subsp. mobilis str. CP4 = NRRL B-14023 plasmid pZM1402303, complete sequence) position: , mismatch: 2, identity: 0.938

gcgcatcttctgatgcttttttagctgcggcc	CRISPR spacer
gcgcttcttctgctgcttttttagctgcggcc	Protospacer
**** ******* *******************

11. spacer 3.2|1606258|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to NC_019019 (Zymomonas mobilis plasmid pZMN1-1, complete sequence) position: , mismatch: 2, identity: 0.938

ttgacgctgtgagcgtgacgatatgctttcac	CRISPR spacer
ttgacgctgtgaccgtgacgatatcctttcac	Protospacer
************ *********** *******

12. spacer 3.2|1606258|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to NC_009716 (Escherichia sp. Sflu5 cryptic plasmid pAK51) position: , mismatch: 4, identity: 0.875

ttgacgctgtgagcgtgacgatatgctttcac	CRISPR spacer
ttgacgctgtgagcgtgacgatatgcttatcg	Protospacer
**************************** .  

13. spacer 3.2|1606258|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to NC_001845 (Zymomonas mobilis ATCC10988 plasmid pZMO1, complete sequence) position: , mismatch: 4, identity: 0.875

ttgacgctgtgagcgtgacgatatgctttcac	CRISPR spacer
ttgacgctgtgagcgtgacgatatgcttatcg	Protospacer
**************************** .  

14. spacer 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to MK448979 (Streptococcus phage Javan534, complete genome) position: , mismatch: 7, identity: 0.781

gcgcatcttctgatgcttttttagctg--cggcc	CRISPR spacer
acccatcttctgatggttttttcgctgactgg--	Protospacer
.* ************ ****** ****  .**  

15. spacer 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to MK448799 (Streptococcus phage Javan535, complete genome) position: , mismatch: 7, identity: 0.781

gcgcatcttctgatgcttttttagctg--cggcc	CRISPR spacer
acccatcttctgatggttttttcgctgactgg--	Protospacer
.* ************ ****** ****  .**  

16. spacer 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to MK448800 (Streptococcus phage Javan539, complete genome) position: , mismatch: 7, identity: 0.781

gcgcatcttctgatgcttttttagctg--cggcc	CRISPR spacer
acccatcttctgatggttttttcgctgactgg--	Protospacer
.* ************ ****** ****  .**  

17. spacer 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to MT939241 (Enterococcus phage 9183, complete genome) position: , mismatch: 7, identity: 0.781

gcgc-atcttctgatgcttttttagctgcggcc	CRISPR spacer
-cgctgtcttctgatgctttcttagccgcacca	Protospacer
 *** .**************.*****.**. * 

18. spacer 1.5|114051|32|NZ_CP023677|CRT,PILER-CR matches to NZ_CP018236 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed8) position: , mismatch: 8, identity: 0.75

acagctaaaacccttttacctttactgtcggc	CRISPR spacer
tgacatcgaaccattttacctttcctgtcggc	Protospacer
  *  * .**** ********** ********

19. spacer 2.4|1245564|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR214998 (Mycoplasma conjunctivae strain NCTC10147 plasmid 2) position: , mismatch: 8, identity: 0.75

ttctcaaaaaggaaaagaaattggaacagatt	CRISPR spacer
ccaacaaaaaggaaaataaaatggaacaaaat	Protospacer
..  ************ *** *******.* *

20. spacer 2.4|1245564|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049042 (Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_5, complete sequence) position: , mismatch: 8, identity: 0.75

---ttctcaaaaaggaaaagaaattggaacagatt	CRISPR spacer
aggtcttc---aaggaaaagatattggaagagatg	Protospacer
   *..**   ********** ******* **** 

21. spacer 2.4|1245564|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 8, identity: 0.75

ttctcaaaaaggaaaagaaattggaacagatt--	CRISPR spacer
gactcaaacaggaaaagaaactgga--cgatcgg	Protospacer
  ****** ***********.****   ***.  

22. spacer 3.2|1606258|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to CP053324 (Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ttgacgctgtgagcgtgacgatatgctttcac	CRISPR spacer
gtcacgctgtgaacgtaacgatatgcgtaaat	Protospacer
 * *********.***.********* *  *.

23. spacer 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to MT446411 (UNVERIFIED: Escherichia virus TH40, complete genome) position: , mismatch: 9, identity: 0.719

gcgcatcttctgatgcttttttagctgcggcc	CRISPR spacer
tcgcatcttctgtttcttttttagacgccatg	Protospacer
 *********** * ********* .** .. 

24. spacer 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to MT446421 (UNVERIFIED: Escherichia virus TH55, complete genome) position: , mismatch: 9, identity: 0.719

gcgcatcttctgatgcttttttagctgcggcc	CRISPR spacer
tcgcatcttctgtttcttttttagacgccatg	Protospacer
 *********** * ********* .** .. 

25. spacer 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to MT446396 (UNVERIFIED: Escherichia virus TH22, complete genome) position: , mismatch: 9, identity: 0.719

gcgcatcttctgatgcttttttagctgcggcc	CRISPR spacer
tcgcatcttctgtttcttttttagacgccatg	Protospacer
 *********** * ********* .** .. 

26. spacer 2.4|1245564|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to MN692951 (Marine virus AFVG_117M12, complete genome) position: , mismatch: 10, identity: 0.688

ttctcaaaaaggaaaagaaattggaacagatt	CRISPR spacer
ggacgcaacaggaaaagaaattggaaaagaaa	Protospacer
   .  ** ***************** ***  

27. spacer 2.4|1245564|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to NC_019526 (Enterobacteria phage vB_KleM-RaK2, complete genome) position: , mismatch: 10, identity: 0.688

ttctcaaaaaggaaaagaaattggaacagatt	CRISPR spacer
agtacaaaaaggacaagaaattggtactgcaa	Protospacer
  . ********* ********** ** *   

28. spacer 2.4|1245564|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to MT708547 (Klebsiella phage Muenster, complete genome) position: , mismatch: 10, identity: 0.688

ttctcaaaaaggaaaagaaattggaacagatt	CRISPR spacer
agtacaaaaaggacaagaaattggtactgcaa	Protospacer
  . ********* ********** ** *   

29. spacer 2.4|1245564|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to AB897757 (Klebsiella phage K64-1 DNA, complete genome) position: , mismatch: 10, identity: 0.688

ttctcaaaaaggaaaagaaattggaacagatt	CRISPR spacer
agtacaaaaaggacaagaaattggtactgcaa	Protospacer
  . ********* ********** ** *   

30. spacer 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to NC_020292 (Clostridium saccharoperbutylacetonicum N1-4(HMT) plasmid Csp_135p, complete sequence) position: , mismatch: 10, identity: 0.688

gcgcatcttctgatgcttttttagctgcggcc	CRISPR spacer
tattatcatctgatgcttctttagctgaattc	Protospacer
   .*** **********.******** . .*

31. spacer 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to MN583270 (Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence) position: , mismatch: 10, identity: 0.688

gcgcatcttctgatgcttttttagctgcggcc	CRISPR spacer
agtgaaggacttatgcttttttagctgaggcc	Protospacer
.   *    ** *************** ****

32. spacer 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 10, identity: 0.688

gcgcatcttctgatgcttttttagctgcggcc	CRISPR spacer
catcatcttctggtgcttttttacctaagaaa	Protospacer
   *********.********** **. *.  

33. spacer 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to JN231330 (UNVERIFIED: Uncultured phage contig03 MexF-like gene, complete sequence) position: , mismatch: 10, identity: 0.688

gcgcatcttctgatgcttttttagctgcggcc	CRISPR spacer
ccccaacttcagatgcttttttagctaatcta	Protospacer
 * ** **** ***************.   . 

34. spacer 2.4|1245564|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to KY549443 (Enterococcus phage EFP01, complete genome) position: , mismatch: 11, identity: 0.656

ttctcaaaaaggaaaagaaattggaacagatt	CRISPR spacer
cgtccaaaatggaaaagaaattgaaacgtgaa	Protospacer
. ..***** *************.***. .  

35. spacer 3.1|1606198|32|NZ_CP023677|PILER-CR,CRISPRCasFinder,CRT matches to AP013403 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G15, isolate: uvMED-CGR-U-MedDCM-OCT-S41-C7) position: , mismatch: 11, identity: 0.656

gcgcatcttctgatgcttttttagctgcggcc	CRISPR spacer
cggcaacttctgatgcttttgtagcaattaat	Protospacer
  *** ************** **** .. . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 383000 : 393484 10 Sinorhizobium_phage(33.33%) terminase NA
DBSCAN-SWA_2 1209064 : 1222272 9 Pseudomonas_phage(12.5%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP023680
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2696 : 14768 13 Burkholderia_phage(27.27%) tail,plate NA
DBSCAN-SWA_2 28793 : 36436 9 Burkholderia_phage(37.5%) head,portal,tail,capsid NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage