Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP028576 Escherichia coli strain WCHEC005784 plasmid pCTXM15_005784, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP028575 Escherichia coli strain WCHEC005784 plasmid p1_005784, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP028577 Escherichia coli strain WCHEC005784 plasmid pNDM5_005784, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP028578 Escherichia coli strain WCHEC005784 chromosome, complete genome 8 crisprs csa3,PD-DExK,RT,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,c2c9_V-U4,DinG 0 11 8 0

Results visualization

1. NZ_CP028576
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1262 : 28311 26 Escherichia_phage(42.86%) transposase,protease,integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP028578
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028578_1 981811-982449 Orphan I-E
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028578_2 1010936-1011571 TypeI-E I-E
10 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028578_3 2212521-2212644 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028578_4 2883658-2883749 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028578_5 3176501-3176645 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028578_6 3426242-3426338 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028578_7 3567159-3567303 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028578_8 4206697-4206846 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP028578_2 2.10|1011511|35|NZ_CP028578|CRT 1011511-1011545 35 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246934-246968 0 1.0
NZ_CP028578_4 4.1|2883684|40|NZ_CP028578|CRISPRCasFinder 2883684-2883723 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP028578_1 1.9|982328|32|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT 982328-982359 32 KT898133 Aeromonas phage phiARM81ld, complete genome 45655-45686 2 0.938
NZ_CP028578_2 2.4|1011145|35|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT 1011145-1011179 35 NZ_CP037443 Klebsiella sp. PO552 plasmid p2, complete sequence 42676-42710 2 0.943
NZ_CP028578_3 3.1|2212564|38|NZ_CP028578|CRISPRCasFinder 2212564-2212601 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP028578_1 1.3|981962|32|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT 981962-981993 32 NC_016040 Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence 37866-37897 6 0.812
NZ_CP028578_1 1.5|982084|32|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT 982084-982115 32 KC821619 Cellulophaga phage phi18:1, complete genome 6924-6955 7 0.781
NZ_CP028578_1 1.5|982084|32|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT 982084-982115 32 KC821627 Cellulophaga phage phi18:2, complete genome 6924-6955 7 0.781
NZ_CP028578_1 1.1|981840|32|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT 981840-981871 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 107507-107538 8 0.75
NZ_CP028578_1 1.1|981840|32|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT 981840-981871 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 199281-199312 8 0.75
NZ_CP028578_1 1.4|982023|32|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT 982023-982054 32 MN855878 Bacteriophage sp. isolate 336, complete genome 5171-5202 8 0.75
NZ_CP028578_1 1.9|982328|32|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT 982328-982359 32 MN901520 Halorubrum coriense virus Hardycor2, complete genome 16524-16555 8 0.75
NZ_CP028578_1 1.5|982084|32|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT 982084-982115 32 NZ_CP020483 Campylobacter helveticus strain ATCC 51209 plasmid pHELV-5, complete sequence 383-414 9 0.719
NZ_CP028578_7 7.1|3567202|59|NZ_CP028578|CRISPRCasFinder 3567202-3567260 59 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 97-155 10 0.831
NZ_CP028578_7 7.1|3567202|59|NZ_CP028578|CRISPRCasFinder 3567202-3567260 59 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40375-40433 11 0.814
NZ_CP028578_2 2.5|1011206|35|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT 1011206-1011240 35 NZ_CP038863 Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence 20152-20186 12 0.657

1. spacer 2.10|1011511|35|NZ_CP028578|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

ccggacgcactggatgcgatgatggacatcacttg	CRISPR spacer
ccggacgcactggatgcgatgatggacatcacttg	Protospacer
***********************************

2. spacer 4.1|2883684|40|NZ_CP028578|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

3. spacer 1.9|982328|32|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT matches to KT898133 (Aeromonas phage phiARM81ld, complete genome) position: , mismatch: 2, identity: 0.938

gacgatgagacgccctggtgtgccgcgttcgt	CRISPR spacer
gacgacgagacgccctggtgcgccgcgttcgt	Protospacer
*****.**************.***********

4. spacer 2.4|1011145|35|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037443 (Klebsiella sp. PO552 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.943

tcggcgagtaagagtactgagtattttaatctcat	CRISPR spacer
acggcgagtaagagtgctgagtattttaatctcat	Protospacer
 **************.*******************

5. spacer 3.1|2212564|38|NZ_CP028578|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

6. spacer 1.3|981962|32|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT matches to NC_016040 (Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence) position: , mismatch: 6, identity: 0.812

tgcacgccctgccggaatctcccctcgctctc	CRISPR spacer
tgcacgccctgccggaagatcccctcacgatt	Protospacer
*****************  *******.*  *.

7. spacer 1.5|982084|32|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT matches to KC821619 (Cellulophaga phage phi18:1, complete genome) position: , mismatch: 7, identity: 0.781

agctttattgttttcagggaaaataacgcggc	CRISPR spacer
ctcttttttcttttcagggaaaataaaaccgc	Protospacer
  **** ** **************** .* **

8. spacer 1.5|982084|32|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT matches to KC821627 (Cellulophaga phage phi18:2, complete genome) position: , mismatch: 7, identity: 0.781

agctttattgttttcagggaaaataacgcggc	CRISPR spacer
ctcttttttcttttcagggaaaataaaaccgc	Protospacer
  **** ** **************** .* **

9. spacer 1.1|981840|32|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 8, identity: 0.75

acattgactgcccgtggcgtccccgcgacctt	CRISPR spacer
ccgtcgactgcccgtggggtcccagcgaaatc	Protospacer
 *.*.************ ***** ****  *.

10. spacer 1.1|981840|32|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

acattgactgcccgtggcgtccccgcgacctt	CRISPR spacer
ccgtcgactgcccgtggggtcccagcgaaatc	Protospacer
 *.*.************ ***** ****  *.

11. spacer 1.4|982023|32|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT matches to MN855878 (Bacteriophage sp. isolate 336, complete genome) position: , mismatch: 8, identity: 0.75

agtaagccggttgattatcgcca----gggatatta	CRISPR spacer
agtaagcaggatgattatcgccaccatggcgt----	Protospacer
******* ** ************    ** .*    

12. spacer 1.9|982328|32|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT matches to MN901520 (Halorubrum coriense virus Hardycor2, complete genome) position: , mismatch: 8, identity: 0.75

--gacgatgagacgccctggtgtgccgcgttcgt	CRISPR spacer
ccgccgcc--gacgctcgggtgtgccgcgttcgg	Protospacer
  * ** .  *****.* *************** 

13. spacer 1.5|982084|32|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020483 (Campylobacter helveticus strain ATCC 51209 plasmid pHELV-5, complete sequence) position: , mismatch: 9, identity: 0.719

agctttattgttttcagggaaaataacgcggc	CRISPR spacer
acttttattgttttgagtgaaaataaaggcta	Protospacer
* .*********** ** ******** *    

14. spacer 7.1|3567202|59|NZ_CP028578|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 10, identity: 0.831

-cggagcacttattgccggatgcggcgtgaacgccttatccggcctacggttctggcacc	CRISPR spacer
tcagtgcac-gatcgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctc	Protospacer
 *.* ****  **.**************************** ************   .*

15. spacer 7.1|3567202|59|NZ_CP028578|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.814

cggagcacttattgccggatgcggcgtgaacgccttatccggcctacggttctggcacc-	CRISPR spacer
ggtacggctttttgccggatgcggcgtaaacgccttatccggcctacggtt-tggtgcga	Protospacer
 * *  .*** ****************.*********************** ***..*  

16. spacer 2.5|1011206|35|NZ_CP028578|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038863 (Campylobacter jejuni strain SCJK2 plasmid unnamed1, complete sequence) position: , mismatch: 12, identity: 0.657

tcggccatagactttattaacttcattgggggtta	CRISPR spacer
atcgccatagaattttttaacttcattgcctaaag	Protospacer
 . ******** *** ************   .  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1027868 : 1035008 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_2 1249630 : 1294007 54 Escherichia_phage(62.0%) holin,terminase,integrase attL 1252729:1252745|attR 1292153:1292169
DBSCAN-SWA_3 1718308 : 1812776 92 Escherichia_phage(18.0%) lysis,capsid,integrase,transposase,protease,terminase,portal,plate,tRNA,tail,head attL 1745550:1745571|attR 1779790:1779811
DBSCAN-SWA_4 1829415 : 1838779 8 Escherichia_phage(37.5%) transposase NA
DBSCAN-SWA_5 2710321 : 2767677 64 Escherichia_phage(42.55%) holin,capsid,transposase,protease,integrase,portal,terminase,tRNA,tail,head attL 2718513:2718527|attR 2767779:2767793
DBSCAN-SWA_6 2932804 : 3059519 116 Escherichia_phage(36.07%) holin,lysis,protease,capsid,integrase,terminase,portal,plate,tRNA,tail,head attL 2944743:2944763|attR 3046250:3046270
DBSCAN-SWA_7 3727242 : 3781439 63 Enterobacteria_phage(35.19%) holin,lysis,capsid,transposase,integrase,portal,terminase,tail,head attL 3729769:3729816|attR 3777536:3777583
DBSCAN-SWA_8 3791573 : 3857387 57 uncultured_Caudovirales_phage(20.0%) plate,tRNA,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage