Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP028186 Campylobacter jejuni strain CFSAN054107 plasmid pGMI16-002, complete sequence 2 crisprs cas14j 0 1 1 0
NZ_CP028185 Campylobacter jejuni strain CFSAN054107 chromosome, complete genome 2 crisprs cas1,cas9,csa3,DEDDh,WYL,cas14j 0 1 137 0

Results visualization

1. NZ_CP028185
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028185_1 252090-252265 TypeII NA
2 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028185_2 280213-280325 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP028185_1 1.1|252135|30|NZ_CP028185|PILER-CR 252135-252164 30 MN530981 Campylobacter phage DA10, complete genome 26598-26627 1 0.967
NZ_CP028185_1 1.1|252135|30|NZ_CP028185|PILER-CR 252135-252164 30 MH107028 Campylobacter phage CP39, partial genome 3865-3894 2 0.933
NZ_CP028185_1 1.1|252135|30|NZ_CP028185|PILER-CR 252135-252164 30 NC_015464 Campylobacter phage NCTC12673, complete genome 114100-114129 2 0.933
NZ_CP028185_1 1.1|252135|30|NZ_CP028185|PILER-CR 252135-252164 30 KX236333 Campylobacter phage PC14, complete genome 14057-14086 2 0.933
NZ_CP028185_1 1.1|252135|30|NZ_CP028185|PILER-CR 252135-252164 30 KX229736 Campylobacter phage PC5, complete genome 33274-33303 2 0.933
NZ_CP028185_1 1.1|252135|30|NZ_CP028185|PILER-CR 252135-252164 30 KC311669 Acinetobacter phage AB3, complete genome 148-177 6 0.8
NZ_CP028185_1 1.1|252135|30|NZ_CP028185|PILER-CR 252135-252164 30 KY082667 Acinetobacter phage SH-Ab 15519, complete genome 26006-26035 6 0.8
NZ_CP028185_1 1.1|252135|30|NZ_CP028185|PILER-CR 252135-252164 30 MK257723 Acinetobacter phage vB_AbaP_APK37, complete genome 40389-40418 6 0.8
NZ_CP028185_1 1.1|252135|30|NZ_CP028185|PILER-CR 252135-252164 30 NZ_CP031220 Arcobacter mytili LMG 24559 plasmid pAMYT, complete sequence 23039-23068 7 0.767
NZ_CP028185_1 1.1|252135|30|NZ_CP028185|PILER-CR 252135-252164 30 MN689526 Lactococcus phage CHPC966, partial genome 5483-5512 8 0.733
NZ_CP028185_1 1.1|252135|30|NZ_CP028185|PILER-CR 252135-252164 30 KT345706 Vibrio phage vB_VorS-PVo5, complete genome 71859-71888 8 0.733
NZ_CP028185_1 1.1|252135|30|NZ_CP028185|PILER-CR 252135-252164 30 MF417890 Uncultured Caudovirales phage clone 7F_15, partial genome 40989-41018 8 0.733
NZ_CP028185_1 1.1|252135|30|NZ_CP028185|PILER-CR 252135-252164 30 NC_048753 Lactobacillus phage 3-521, complete genome 46122-46151 8 0.733
NZ_CP028185_1 1.1|252135|30|NZ_CP028185|PILER-CR 252135-252164 30 NZ_LR134428 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 19 154193-154222 9 0.7

1. spacer 1.1|252135|30|NZ_CP028185|PILER-CR matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 1, identity: 0.967

tatctttgataaacttatttaagttctcat	CRISPR spacer
tatctttgataaacttatttaagttatcat	Protospacer
************************* ****

2. spacer 1.1|252135|30|NZ_CP028185|PILER-CR matches to MH107028 (Campylobacter phage CP39, partial genome) position: , mismatch: 2, identity: 0.933

tatctttgataaacttatttaagttctcat	CRISPR spacer
tatctttgataaacttctttaacttctcat	Protospacer
**************** ***** *******

3. spacer 1.1|252135|30|NZ_CP028185|PILER-CR matches to NC_015464 (Campylobacter phage NCTC12673, complete genome) position: , mismatch: 2, identity: 0.933

tatctttgataaacttatttaagttctcat	CRISPR spacer
tatctttgataaacttctttaacttctcat	Protospacer
**************** ***** *******

4. spacer 1.1|252135|30|NZ_CP028185|PILER-CR matches to KX236333 (Campylobacter phage PC14, complete genome) position: , mismatch: 2, identity: 0.933

tatctttgataaacttatttaagttctcat	CRISPR spacer
tatctttgataaacttctttaacttctcat	Protospacer
**************** ***** *******

5. spacer 1.1|252135|30|NZ_CP028185|PILER-CR matches to KX229736 (Campylobacter phage PC5, complete genome) position: , mismatch: 2, identity: 0.933

tatctttgataaacttatttaagttctcat	CRISPR spacer
tatctttgataaacttctttaacttctcat	Protospacer
**************** ***** *******

6. spacer 1.1|252135|30|NZ_CP028185|PILER-CR matches to KC311669 (Acinetobacter phage AB3, complete genome) position: , mismatch: 6, identity: 0.8

tatctttgataaacttatttaagttctcat	CRISPR spacer
tcttcatgataaccttatttaagttctctt	Protospacer
* *.. ****** *************** *

7. spacer 1.1|252135|30|NZ_CP028185|PILER-CR matches to KY082667 (Acinetobacter phage SH-Ab 15519, complete genome) position: , mismatch: 6, identity: 0.8

tatctttgataaacttatttaagttctcat	CRISPR spacer
tcttcatgataaccttatttaagttctctt	Protospacer
* *.. ****** *************** *

8. spacer 1.1|252135|30|NZ_CP028185|PILER-CR matches to MK257723 (Acinetobacter phage vB_AbaP_APK37, complete genome) position: , mismatch: 6, identity: 0.8

tatctttgataaacttatttaagttctcat	CRISPR spacer
tcttcatgataaccttatttaagttctctt	Protospacer
* *.. ****** *************** *

9. spacer 1.1|252135|30|NZ_CP028185|PILER-CR matches to NZ_CP031220 (Arcobacter mytili LMG 24559 plasmid pAMYT, complete sequence) position: , mismatch: 7, identity: 0.767

tatctttgataaacttatttaagttctcat	CRISPR spacer
tctctttgataaacttttttaattttacta	Protospacer
* ************** ***** **. *  

10. spacer 1.1|252135|30|NZ_CP028185|PILER-CR matches to MN689526 (Lactococcus phage CHPC966, partial genome) position: , mismatch: 8, identity: 0.733

tatctttgataaacttatttaagttctcat	CRISPR spacer
tatctttgatgaacttatataagccattca	Protospacer
**********.******* ****.. *.  

11. spacer 1.1|252135|30|NZ_CP028185|PILER-CR matches to KT345706 (Vibrio phage vB_VorS-PVo5, complete genome) position: , mismatch: 8, identity: 0.733

tatctttgataaacttatttaagttctcat	CRISPR spacer
cttctttgatatacttatctaagtttaagt	Protospacer
. ********* ******.******.  .*

12. spacer 1.1|252135|30|NZ_CP028185|PILER-CR matches to MF417890 (Uncultured Caudovirales phage clone 7F_15, partial genome) position: , mismatch: 8, identity: 0.733

tatctttgataaacttatttaagttctcat	CRISPR spacer
ccaaattgttaaacttatttaagttttctt	Protospacer
.    *** ****************.** *

13. spacer 1.1|252135|30|NZ_CP028185|PILER-CR matches to NC_048753 (Lactobacillus phage 3-521, complete genome) position: , mismatch: 8, identity: 0.733

tatctttgataaacttatttaagttctcat	CRISPR spacer
ataccttaataaacttatttaagttgtcta	Protospacer
   *.**.***************** **  

14. spacer 1.1|252135|30|NZ_CP028185|PILER-CR matches to NZ_LR134428 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 19) position: , mismatch: 9, identity: 0.7

tatctttgataaacttatttaagttctcat	CRISPR spacer
atgttttgataaaattattgaagttcttca	Protospacer
   .********* ***** *******.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 14227 13 Campylobacter_phage(100.0%) terminase,portal NA
DBSCAN-SWA_2 19507 : 26498 7 Tupanvirus(25.0%) tRNA NA
DBSCAN-SWA_3 36320 : 37829 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_4 41903 : 50524 9 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_5 55077 : 58263 3 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_6 77397 : 78405 1 Moraxella_phage(100.0%) tRNA NA
DBSCAN-SWA_7 84954 : 87606 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_8 97644 : 98652 1 Dinoroseobacter_phage(100.0%) NA NA
DBSCAN-SWA_9 104303 : 106100 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_10 109670 : 110990 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_11 115270 : 115873 1 Cassava_brown_streak_virus(100.0%) NA NA
DBSCAN-SWA_12 125225 : 126650 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_13 130994 : 132362 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_14 137348 : 138173 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_15 142463 : 146617 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_16 151054 : 152318 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_17 158753 : 163673 6 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_18 169116 : 173453 4 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_19 177555 : 181953 4 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_20 204853 : 206266 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_21 215620 : 217987 1 Campylobacter_virus(100.0%) NA NA
DBSCAN-SWA_22 225354 : 229303 5 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_23 237843 : 239946 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_24 259870 : 269880 10 Cyanophage(20.0%) NA NA
DBSCAN-SWA_25 276559 : 280077 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_26 285682 : 287167 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_27 291974 : 295924 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_28 311840 : 312506 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_29 319941 : 321573 1 Aureococcus_anophage(100.0%) NA NA
DBSCAN-SWA_30 327374 : 331935 5 Cellulophaga_phage(50.0%) NA NA
DBSCAN-SWA_31 345828 : 353174 7 Brazilian_cedratvirus(33.33%) NA NA
DBSCAN-SWA_32 361513 : 366563 5 Pandoravirus(25.0%) NA NA
DBSCAN-SWA_33 370124 : 370970 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_34 373989 : 374712 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_35 378643 : 381425 3 uncultured_Caudovirales_phage(66.67%) NA NA
DBSCAN-SWA_36 389122 : 396599 10 Planktothrix_phage(25.0%) NA NA
DBSCAN-SWA_37 409226 : 411329 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_38 441109 : 442252 2 Halovirus(50.0%) NA NA
DBSCAN-SWA_39 448215 : 453103 3 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_40 462301 : 463149 2 Emiliania_huxleyi_virus(50.0%) NA NA
DBSCAN-SWA_41 467500 : 483912 13 Streptococcus_virus(12.5%) NA NA
DBSCAN-SWA_42 503870 : 505679 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_43 527848 : 528745 1 Citrobacter_phage(100.0%) NA NA
DBSCAN-SWA_44 536276 : 537074 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_45 541918 : 542614 1 Sphenicid_alphaherpesvirus(100.0%) NA NA
DBSCAN-SWA_46 552767 : 556754 5 Streptococcus_phage(25.0%) tRNA NA
DBSCAN-SWA_47 569184 : 569946 1 Escherichia_phage(100.0%) tRNA NA
DBSCAN-SWA_48 583673 : 598573 12 Cafeteria_roenbergensis_virus(16.67%) NA NA
DBSCAN-SWA_49 603860 : 607778 7 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_50 612937 : 615777 3 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_51 626484 : 629238 4 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_52 632784 : 640681 8 Synechococcus_phage(20.0%) NA NA
DBSCAN-SWA_53 648063 : 651517 3 Tupanvirus(33.33%) tRNA NA
DBSCAN-SWA_54 657422 : 669888 14 uncultured_Mediterranean_phage(28.57%) NA NA
DBSCAN-SWA_55 678960 : 679719 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_56 687028 : 691399 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_57 695539 : 696793 1 Bacillus_virus(100.0%) protease NA
DBSCAN-SWA_58 704132 : 707928 3 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_59 714735 : 728902 15 Campylobacter_phage(14.29%) tRNA NA
DBSCAN-SWA_60 733822 : 737945 4 Bovine_gammaherpesvirus(50.0%) NA NA
DBSCAN-SWA_61 745829 : 751319 8 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_62 755268 : 757908 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_63 762691 : 769633 5 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_64 783980 : 787103 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_65 791402 : 797024 6 Ralstonia_phage(33.33%) NA NA
DBSCAN-SWA_66 800525 : 801802 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_67 805664 : 806900 1 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_68 817101 : 819848 2 Catovirus(50.0%) tRNA NA
DBSCAN-SWA_69 824739 : 826731 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_70 838998 : 843414 6 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_71 855623 : 856367 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_72 866911 : 870167 5 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_73 878263 : 880530 2 Mamastrovirus(50.0%) NA NA
DBSCAN-SWA_74 884781 : 887374 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_75 890758 : 899441 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_76 909946 : 918306 9 Salmonella_phage(40.0%) NA NA
DBSCAN-SWA_77 922529 : 928895 14 Campylobacter_phage(50.0%) NA NA
DBSCAN-SWA_78 932232 : 933525 1 Sinorhizobium_phage(100.0%) terminase NA
DBSCAN-SWA_79 942319 : 943354 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_80 946581 : 950810 7 Campylobacter_phage(100.0%) NA NA
DBSCAN-SWA_81 955600 : 956377 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_82 961220 : 972592 8 Tupanvirus(40.0%) tRNA NA
DBSCAN-SWA_83 975795 : 977622 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_84 989979 : 991143 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_85 998010 : 999720 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_86 1013023 : 1019276 4 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_87 1025700 : 1032063 7 Staphylococcus_phage(25.0%) tRNA NA
DBSCAN-SWA_88 1037658 : 1045478 10 Pseudomonas_phage(25.0%) NA NA
DBSCAN-SWA_89 1057972 : 1059898 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_90 1063448 : 1069292 6 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_91 1084794 : 1086729 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_92 1091681 : 1094536 3 uncultured_Caudovirales_phage(50.0%) tRNA NA
DBSCAN-SWA_93 1099166 : 1101566 3 Pasteurella_phage(33.33%) NA NA
DBSCAN-SWA_94 1105525 : 1108885 2 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_95 1113207 : 1114527 1 Erwinia_phage(100.0%) protease NA
DBSCAN-SWA_96 1117538 : 1118267 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_97 1138755 : 1142508 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_98 1153354 : 1154608 1 Phage_TP(100.0%) NA NA
DBSCAN-SWA_99 1159096 : 1159849 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_100 1166076 : 1169679 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_101 1180409 : 1181399 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_102 1197510 : 1204767 6 Helicobacter_phage(33.33%) transposase NA
DBSCAN-SWA_103 1210332 : 1212601 3 Hokovirus(33.33%) tRNA NA
DBSCAN-SWA_104 1217422 : 1224278 4 Planktothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_105 1232980 : 1236191 3 Vibrio_phage(33.33%) tRNA NA
DBSCAN-SWA_106 1246985 : 1255882 9 Terra1_virus(20.0%) tRNA NA
DBSCAN-SWA_107 1262096 : 1271559 11 Chrysochromulina_ericina_virus(20.0%) tRNA NA
DBSCAN-SWA_108 1277930 : 1282248 5 Hokovirus(66.67%) tRNA NA
DBSCAN-SWA_109 1294483 : 1295332 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_110 1299245 : 1302647 3 Acinetobacter_phage(50.0%) integrase attL 1291980:1291994|attR 1302873:1302887
DBSCAN-SWA_111 1313379 : 1324411 6 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_112 1331121 : 1337974 9 Orpheovirus(33.33%) tRNA NA
DBSCAN-SWA_113 1341101 : 1342424 2 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_114 1347328 : 1360445 15 Hokovirus(20.0%) NA NA
DBSCAN-SWA_115 1377469 : 1389668 11 Vibrio_phage(20.0%) NA NA
DBSCAN-SWA_116 1406156 : 1406684 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_117 1418971 : 1421490 3 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_118 1424910 : 1509763 67 Vibrio_phage(16.67%) plate,protease,integrase,tRNA attL 1429949:1429967|attR 1516162:1516180
DBSCAN-SWA_119 1545747 : 1547200 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_120 1556040 : 1566917 7 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_121 1577958 : 1581354 5 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_122 1592328 : 1599198 5 Klosneuvirus(33.33%) tRNA NA
DBSCAN-SWA_123 1603909 : 1607167 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_124 1617267 : 1618170 1 Rhodococcus_phage(100.0%) NA NA
DBSCAN-SWA_125 1621196 : 1642882 20 Staphylococcus_phage(27.27%) protease,tRNA NA
DBSCAN-SWA_126 1646192 : 1652172 5 Bathycoccus_sp._RCC1105_virus(33.33%) NA NA
DBSCAN-SWA_127 1660972 : 1663647 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_128 1672689 : 1688895 17 uncultured_virus(37.5%) NA NA
DBSCAN-SWA_129 1694063 : 1704719 13 Catovirus(20.0%) tRNA NA
DBSCAN-SWA_130 1707813 : 1717672 8 Salmonella_phage(40.0%) tRNA NA
DBSCAN-SWA_131 1729304 : 1730171 1 uncultured_phage(100.0%) NA NA
DBSCAN-SWA_132 1737721 : 1753022 16 uncultured_virus(20.0%) protease NA
DBSCAN-SWA_133 1757659 : 1758481 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_134 1770325 : 1771861 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_135 1784151 : 1786101 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_136 1793952 : 1804070 9 uncultured_Caudovirales_phage(25.0%) tRNA NA
DBSCAN-SWA_137 1808982 : 1831400 38 Campylobacter_phage(100.0%) integrase,tail,capsid,head attL 1806646:1806663|attR 1823214:1823231
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP028186
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028186_1 37772-37870 TypeV NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028186_2 38086-38151 TypeV NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP028186_1 1.1|37797|48|NZ_CP028186|CRISPRCasFinder 37797-37844 48 NZ_CP022078 Campylobacter jejuni strain FDAARGOS_265 plasmid unnamed1, complete sequence 956-1003 0 1.0
NZ_CP028186_1 1.1|37797|48|NZ_CP028186|CRISPRCasFinder 37797-37844 48 NZ_CP045046 Campylobacter jejuni subsp. jejuni strain NADC 20827 plasmid p20827L, complete sequence 18715-18762 0 1.0
NZ_CP028186_1 1.1|37797|48|NZ_CP028186|CRISPRCasFinder 37797-37844 48 NZ_CP017857 Campylobacter jejuni strain YQ2210 plasmid pCJDM210L, complete sequence 20867-20914 0 1.0
NZ_CP028186_1 1.1|37797|48|NZ_CP028186|CRISPRCasFinder 37797-37844 48 NZ_CP017854 Campylobacter jejuni strain ZP3204 plasmid pCJDM204L, complete sequence 3962-4009 0 1.0
NZ_CP028186_1 1.1|37797|48|NZ_CP028186|CRISPRCasFinder 37797-37844 48 NZ_CP028186 Campylobacter jejuni strain CFSAN054107 plasmid pGMI16-002, complete sequence 37797-37844 0 1.0
NZ_CP028186_1 1.1|37797|48|NZ_CP028186|CRISPRCasFinder 37797-37844 48 CP013735 Campylobacter coli strain OR12 plasmid pOR12TET, complete sequence 3665-3712 0 1.0
NZ_CP028186_1 1.1|37797|48|NZ_CP028186|CRISPRCasFinder 37797-37844 48 CP047483 Campylobacter jejuni strain CFSAN096297 plasmid CFSAN096297, complete sequence 46123-46170 0 1.0
NZ_CP028186_1 1.1|37797|48|NZ_CP028186|CRISPRCasFinder 37797-37844 48 NZ_CP044170 Campylobacter jejuni strain AR-0413 plasmid pAR-0413-1, complete sequence 19101-19148 0 1.0
NZ_CP028186_1 1.1|37797|48|NZ_CP028186|CRISPRCasFinder 37797-37844 48 NZ_MK541987 Campylobacter coli strain CVM N46788F plasmid pN46788F, complete sequence 22344-22391 0 1.0

1. spacer 1.1|37797|48|NZ_CP028186|CRISPRCasFinder matches to NZ_CP022078 (Campylobacter jejuni strain FDAARGOS_265 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

2. spacer 1.1|37797|48|NZ_CP028186|CRISPRCasFinder matches to NZ_CP045046 (Campylobacter jejuni subsp. jejuni strain NADC 20827 plasmid p20827L, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

3. spacer 1.1|37797|48|NZ_CP028186|CRISPRCasFinder matches to NZ_CP017857 (Campylobacter jejuni strain YQ2210 plasmid pCJDM210L, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

4. spacer 1.1|37797|48|NZ_CP028186|CRISPRCasFinder matches to NZ_CP017854 (Campylobacter jejuni strain ZP3204 plasmid pCJDM204L, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

5. spacer 1.1|37797|48|NZ_CP028186|CRISPRCasFinder matches to NZ_CP028186 (Campylobacter jejuni strain CFSAN054107 plasmid pGMI16-002, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

6. spacer 1.1|37797|48|NZ_CP028186|CRISPRCasFinder matches to CP013735 (Campylobacter coli strain OR12 plasmid pOR12TET, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

7. spacer 1.1|37797|48|NZ_CP028186|CRISPRCasFinder matches to CP047483 (Campylobacter jejuni strain CFSAN096297 plasmid CFSAN096297, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

8. spacer 1.1|37797|48|NZ_CP028186|CRISPRCasFinder matches to NZ_CP044170 (Campylobacter jejuni strain AR-0413 plasmid pAR-0413-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

9. spacer 1.1|37797|48|NZ_CP028186|CRISPRCasFinder matches to NZ_MK541987 (Campylobacter coli strain CVM N46788F plasmid pN46788F, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	CRISPR spacer
tcttttaaagtccctattttccatatggggtttccgaaaaaatgtcaa	Protospacer
************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 17366 : 28731 9 Streptococcus_phage(57.14%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage