1. spacer 2.1|4471416|33|NZ_CP028176|PILER-CR,CRT matches to LR134212 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3) position: , mismatch: 0, identity: 1.0
tgcctccaatgcaatcaccggcctgctaaccgg CRISPR spacer
tgcctccaatgcaatcaccggcctgctaaccgg Protospacer
*********************************
2. spacer 2.7|4471417|32|NZ_CP028176|CRISPRCasFinder matches to LR134212 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3) position: , mismatch: 0, identity: 1.0
gcctccaatgcaatcaccggcctgctaaccgg CRISPR spacer
gcctccaatgcaatcaccggcctgctaaccgg Protospacer
********************************
3. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg Protospacer
********************************
4. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 0, identity: 1.0
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg Protospacer
********************************
5. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 0, identity: 1.0
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg Protospacer
********************************
6. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg Protospacer
********************************
7. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 0, identity: 1.0
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg Protospacer
********************************
8. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 0, identity: 1.0
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg Protospacer
********************************
9. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 0, identity: 1.0
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg Protospacer
********************************
10. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg Protospacer
********************************
11. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026212 (Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence) position: , mismatch: 0, identity: 1.0
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg Protospacer
********************************
12. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg Protospacer
********************************
13. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 0, identity: 1.0
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg Protospacer
********************************
14. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 0, identity: 1.0
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg Protospacer
********************************
15. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 0, identity: 1.0
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg Protospacer
********************************
16. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_LR130540 (Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2) position: , mismatch: 0, identity: 1.0
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg Protospacer
********************************
17. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_019390 (Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence) position: , mismatch: 0, identity: 1.0
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg Protospacer
********************************
18. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 0, identity: 1.0
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg Protospacer
********************************
19. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_MG288676 (Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence) position: , mismatch: 0, identity: 1.0
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggatgccgg Protospacer
********************************
20. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg Protospacer
*********************************
21. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 0, identity: 1.0
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg Protospacer
*********************************
22. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 0, identity: 1.0
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg Protospacer
*********************************
23. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg Protospacer
*********************************
24. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 0, identity: 1.0
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg Protospacer
*********************************
25. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 0, identity: 1.0
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg Protospacer
*********************************
26. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 0, identity: 1.0
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg Protospacer
*********************************
27. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg Protospacer
*********************************
28. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026212 (Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence) position: , mismatch: 0, identity: 1.0
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg Protospacer
*********************************
29. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 0, identity: 1.0
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg Protospacer
*********************************
30. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 0, identity: 1.0
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg Protospacer
*********************************
31. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 0, identity: 1.0
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg Protospacer
*********************************
32. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP035211 (Klebsiella pneumoniae strain TH164 plasmid pTH164-2, complete sequence) position: , mismatch: 0, identity: 1.0
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg Protospacer
*********************************
33. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_LR130540 (Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2) position: , mismatch: 0, identity: 1.0
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg Protospacer
*********************************
34. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NC_019390 (Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence) position: , mismatch: 0, identity: 1.0
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg Protospacer
*********************************
35. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 0, identity: 1.0
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg Protospacer
*********************************
36. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MG288676 (Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence) position: , mismatch: 0, identity: 1.0
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggatgccgg Protospacer
*********************************
37. spacer 3.6|4481052|33|NZ_CP028176|PILER-CR matches to MK422450 (Klebsiella phage ST13-OXA48phi12.4, complete genome) position: , mismatch: 0, identity: 1.0
tacactgagcatgtacgccgtggatgcagtagc CRISPR spacer
tacactgagcatgtacgccgtggatgcagtagc Protospacer
*********************************
38. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
39. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
40. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
41. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
42. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
43. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
44. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
45. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KY271405 (Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
46. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
47. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
48. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
49. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
50. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
51. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052485 (Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
52. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
53. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
54. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
55. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
56. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
57. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP040994 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
58. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
59. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
60. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
61. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
62. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
63. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
64. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP037444 (Klebsiella sp. PO552 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
65. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP037744 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
66. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
67. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
68. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
69. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
70. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
71. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
72. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052572 (Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
73. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
74. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
75. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
76. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
77. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
78. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
79. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
80. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
81. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
82. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP028955 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
83. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
84. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
85. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
86. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
87. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
88. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
89. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
90. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
91. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
92. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
93. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
94. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
95. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
96. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
97. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
98. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
99. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
100. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
101. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
102. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
103. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MG700549 (Klebsiella pneumoniae strain st015256/1 plasmid pUJ-83KPC, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
104. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MG700550 (Klebsiella pneumoniae strain st015788/2 plasmid pUJ-84KPC, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
105. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MG700550 (Klebsiella pneumoniae strain st015788/2 plasmid pUJ-84KPC, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
106. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
107. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
108. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
109. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
110. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
111. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
112. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
113. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
114. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP037964 (Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
115. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
116. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
117. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
118. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
119. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
120. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
121. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052559 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
122. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052270 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
123. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
124. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
125. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
126. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
127. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
128. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
129. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
130. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
131. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
132. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP034325 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
133. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
134. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
135. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
136. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
137. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
138. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
139. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
140. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
141. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
142. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
143. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP028991 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
144. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
145. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
146. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
147. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
148. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP045217 (Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
149. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
150. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
151. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
152. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
153. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
154. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052561 (Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
155. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052209 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
156. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
157. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
158. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
159. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
160. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
161. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
162. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
163. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
164. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
165. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP021166 (Klebsiella pneumoniae strain 203 plasmid p203, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
166. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
167. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
168. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
169. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
170. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
171. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
172. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
173. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
174. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP028553 (Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
175. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
176. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
177. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
178. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP046952 (Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
179. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP046940 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
180. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP046942 (Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
181. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP008932 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
182. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
183. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
184. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
185. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP048381 (Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
186. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP026396 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
187. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
188. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
189. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
190. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP025966 (Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
191. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
192. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
193. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP038279 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
194. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
195. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
196. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
197. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
198. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
199. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
200. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
201. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
202. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
203. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
204. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
205. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
206. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP046384 (Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
207. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
208. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
209. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
210. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP030342 (Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
211. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
212. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
213. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP023725 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
214. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MF116002 (Uncultured bacterium plasmid pLGP4 clone J53, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
215. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
216. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
217. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
218. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP045678 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
219. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP026163 (Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
220. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
221. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
222. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
223. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
224. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP013339 (Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
225. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP024500 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
226. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP029723 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
227. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
228. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN823996 (Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
229. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN824001 (Klebsiella pneumoniae strain N201205880 plasmid p205880-1FIIK, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
230. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
231. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052370 (Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
232. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP011630 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-49, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
233. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
234. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP024508 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
235. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
236. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP032189 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
237. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
238. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
239. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
240. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
241. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
242. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052214 (Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
243. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
244. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP044390 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
245. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
246. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP044394 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
247. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP044395 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
248. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
249. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
250. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
251. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052263 (Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
252. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
253. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
254. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP027158 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
255. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP044378 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
256. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP044382 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
257. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP025010 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
258. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
259. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
260. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
261. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052237 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
262. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
263. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP023947 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
264. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
265. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
266. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
267. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
268. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
269. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
270. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
271. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP035124 (Escherichia coli strain EC25 plasmid pEC25-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
272. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
273. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
274. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
275. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP024483 (Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
276. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP034085 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
277. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
278. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
279. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
280. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
281. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP044387 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
282. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP028717 (Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
283. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
284. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
285. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
286. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
287. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
288. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP028389 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
289. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
290. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MK649827 (Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
291. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
292. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MK649829 (Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
293. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP015383 (Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
294. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP030071 (Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
295. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
296. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP037930 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid p8788-IT, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
297. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_LT994840 (Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
298. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP019904 (Escherichia coli strain MDR_56 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
299. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
300. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052173 (Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
301. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
302. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP015395 (Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
303. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP047634 (Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
304. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052337 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
305. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052307 (Klebsiella pneumoniae strain E16KP0133 plasmid pE16KP0133-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
306. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
307. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
308. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_MN543570 (Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
309. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN657251 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
310. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052279 (Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
311. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
312. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
313. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
314. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_MH464586 (Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
315. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_MH745929 (Klebsiella pneumoniae strain VRES1611 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
316. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
317. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
318. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
319. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
320. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052489 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
321. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KY271404 (Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
322. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KY271406 (Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
323. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KY495890 (Klebsiella pneumoniae strain 301 plasmid pKP301cro, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
324. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_MG764551 (Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
325. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to LR134219 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
326. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP029441 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
327. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP032169 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
328. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
329. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
330. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP054304 (Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence) position: , mismatch: 0, identity: 1.0
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccggca Protospacer
*********************************
331. spacer 3.16|4481053|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MK422450 (Klebsiella phage ST13-OXA48phi12.4, complete genome) position: , mismatch: 0, identity: 1.0
acactgagcatgtacgccgtggatgcagtagc CRISPR spacer
acactgagcatgtacgccgtggatgcagtagc Protospacer
********************************
332. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
333. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
334. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
335. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
336. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
337. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
338. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
339. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KY271405 (Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
340. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
341. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
342. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
343. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
344. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
345. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052485 (Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
346. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
347. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
348. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
349. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
350. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
351. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP040994 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
352. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
353. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
354. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
355. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
356. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
357. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
358. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
359. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
360. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP037444 (Klebsiella sp. PO552 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
361. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP037744 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
362. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
363. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
364. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
365. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
366. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
367. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
368. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052572 (Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
369. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
370. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
371. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
372. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
373. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
374. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
375. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
376. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
377. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
378. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP028955 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
379. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
380. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
381. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
382. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
383. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
384. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
385. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
386. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
387. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
388. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
389. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
390. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
391. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
392. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
393. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_LR134255 (Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
394. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
395. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
396. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
397. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
398. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
399. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
400. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MG700549 (Klebsiella pneumoniae strain st015256/1 plasmid pUJ-83KPC, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
401. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MG700550 (Klebsiella pneumoniae strain st015788/2 plasmid pUJ-84KPC, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
402. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MG700550 (Klebsiella pneumoniae strain st015788/2 plasmid pUJ-84KPC, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
403. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
404. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
405. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
406. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
407. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
408. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
409. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
410. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
411. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP037964 (Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
412. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
413. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
414. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
415. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
416. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
417. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
418. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052559 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
419. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052270 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
420. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
421. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
422. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
423. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
424. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
425. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
426. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
427. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
428. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
429. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP034325 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
430. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
431. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
432. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
433. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
434. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
435. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
436. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
437. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
438. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
439. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
440. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP028991 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
441. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
442. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
443. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
444. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
445. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP045217 (Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
446. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
447. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
448. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
449. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
450. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
451. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052561 (Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
452. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052209 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
453. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
454. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
455. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
456. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
457. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
458. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
459. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
460. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
461. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
462. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP021166 (Klebsiella pneumoniae strain 203 plasmid p203, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
463. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
464. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
465. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
466. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
467. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
468. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
469. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
470. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
471. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP028553 (Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
472. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
473. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
474. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
475. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP046952 (Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
476. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP046940 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
477. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP046942 (Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
478. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP008932 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
479. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
480. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
481. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
482. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP048381 (Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
483. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP026396 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
484. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
485. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
486. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
487. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP025966 (Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
488. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
489. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
490. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP038279 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
491. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
492. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
493. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
494. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
495. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
496. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
497. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
498. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
499. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
500. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
501. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
502. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
503. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP046384 (Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
504. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
505. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
506. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
507. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP030342 (Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
508. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
509. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
510. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP023725 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
511. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MF116002 (Uncultured bacterium plasmid pLGP4 clone J53, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
512. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
513. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
514. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
515. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP045678 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
516. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP026163 (Klebsiella pneumoniae strain F13 plasmid pF13_1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
517. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
518. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
519. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
520. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
521. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP013339 (Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
522. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP024500 (Klebsiella pneumoniae strain KSB1_4E plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
523. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP029723 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
524. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
525. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN823996 (Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
526. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN824001 (Klebsiella pneumoniae strain N201205880 plasmid p205880-1FIIK, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
527. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
528. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052370 (Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
529. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP011630 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-49, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
530. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
531. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP024508 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
532. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
533. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP032189 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
534. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
535. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
536. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
537. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
538. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
539. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052214 (Klebsiella pneumoniae strain E17KP0079 plasmid pE17KP0079-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
540. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
541. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP044390 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
542. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
543. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP044394 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
544. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP044395 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
545. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
546. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
547. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
548. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
549. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052263 (Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
550. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
551. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
552. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP027158 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
553. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP044378 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
554. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP044382 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
555. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP025010 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
556. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
557. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
558. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
559. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052237 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
560. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
561. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP023947 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
562. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
563. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
564. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
565. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
566. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
567. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
568. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
569. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP035124 (Escherichia coli strain EC25 plasmid pEC25-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
570. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
571. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
572. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
573. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
574. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP024483 (Klebsiella pneumoniae strain INF322 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
575. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP034085 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
576. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
577. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
578. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
579. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
580. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP044387 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
581. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP028717 (Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
582. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
583. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
584. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
585. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
586. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
587. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
588. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP028389 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
589. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
590. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MK649827 (Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
591. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
592. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MK649829 (Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
593. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052316 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
594. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP015383 (Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
595. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP030071 (Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
596. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
597. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP037930 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid p8788-IT, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
598. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_LT994840 (Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
599. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP019904 (Escherichia coli strain MDR_56 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
600. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
601. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052173 (Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
602. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
603. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP015395 (Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
604. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP047634 (Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
605. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052337 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
606. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
607. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052307 (Klebsiella pneumoniae strain E16KP0133 plasmid pE16KP0133-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
608. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
609. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
610. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_MN543570 (Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
611. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN657251 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
612. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052279 (Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
613. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
614. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
615. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
616. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_MH464586 (Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
617. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_MH745929 (Klebsiella pneumoniae strain VRES1611 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
618. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
619. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
620. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
621. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
622. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052489 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
623. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KY271404 (Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
624. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KY271406 (Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
625. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KY495890 (Klebsiella pneumoniae strain 301 plasmid pKP301cro, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
626. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_MG764551 (Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
627. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_MG736312 (Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
628. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to LR134219 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
629. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP029441 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
630. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP032169 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
631. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
632. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
633. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP054304 (Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence) position: , mismatch: 0, identity: 1.0
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggca Protospacer
********************************
634. spacer 2.1|4471416|33|NZ_CP028176|PILER-CR,CRT matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 1, identity: 0.97
tgcctccaatgcaatcaccggcctgctaaccgg CRISPR spacer
tgcttccaatgcaatcaccggcctgctaaccgg Protospacer
***.*****************************
635. spacer 2.4|4471599|33|NZ_CP028176|PILER-CR,CRT matches to LR134212 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3) position: , mismatch: 1, identity: 0.97
tccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
tccagtcgtcgtagtcctcagtaatgtcctcga Protospacer
*******************.*************
636. spacer 2.4|4471599|33|NZ_CP028176|PILER-CR,CRT matches to KY271395 (Klebsiella phage 2b LV-2017, complete genome) position: , mismatch: 1, identity: 0.97
tccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
tccagtcgtcatagtcctcggtaatgtcctcga Protospacer
**********.**********************
637. spacer 2.4|4471599|33|NZ_CP028176|PILER-CR,CRT matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 1, identity: 0.97
tccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
tccagtcgtcatagtcctcggtaatgtcctcga Protospacer
**********.**********************
638. spacer 2.4|4471599|33|NZ_CP028176|PILER-CR,CRT matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 1, identity: 0.97
tccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
tccagtcgtcatagtcctcggtaatgtcctcga Protospacer
**********.**********************
639. spacer 2.4|4471599|33|NZ_CP028176|PILER-CR,CRT matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 1, identity: 0.97
tccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
tccagtcgtcatagtcctcggtaatgtcctcga Protospacer
**********.**********************
640. spacer 2.7|4471417|32|NZ_CP028176|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 1, identity: 0.969
gcctccaatgcaatcaccggcctgctaaccgg CRISPR spacer
gcttccaatgcaatcaccggcctgctaaccgg Protospacer
**.*****************************
641. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to LR134212 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 3) position: , mismatch: 1, identity: 0.969
ccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
ccagtcgtcgtagtcctcagtaatgtcctcga Protospacer
******************.*************
642. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to KY271395 (Klebsiella phage 2b LV-2017, complete genome) position: , mismatch: 1, identity: 0.969
ccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
ccagtcgtcatagtcctcggtaatgtcctcga Protospacer
*********.**********************
643. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 1, identity: 0.969
ccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
ccagtcgtcatagtcctcggtaatgtcctcga Protospacer
*********.**********************
644. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 1, identity: 0.969
ccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
ccagtcgtcatagtcctcggtaatgtcctcga Protospacer
*********.**********************
645. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 1, identity: 0.969
ccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
ccagtcgtcatagtcctcggtaatgtcctcga Protospacer
*********.**********************
646. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
647. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
648. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
649. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
650. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
651. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
652. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP018674 (Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
653. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
654. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
655. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
656. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
657. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
658. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KY271405 (Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
659. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
660. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KX443408 (Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
661. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052485 (Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
662. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
663. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
664. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
665. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KP987215 (Citrobacter freundii strain 112298 plasmid p112298-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
666. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
667. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
668. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
669. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP012428 (Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
670. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP012428 (Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
671. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
672. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
673. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP034040 (Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
674. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
675. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
676. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP044528 (Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
677. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
678. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
679. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
680. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
681. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
682. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
683. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
684. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
685. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
686. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
687. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
688. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
689. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
690. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
691. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
692. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
693. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
694. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
695. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
696. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052572 (Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
697. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_010886 (Klebsiella pneumoniae plasmid pK245, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
698. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
699. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
700. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
701. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
702. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
703. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP029733 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
704. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP035635 (Enterobacter cloacae strain EN3600 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
705. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP035637 (Enterobacter cloacae strain EN3600 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
706. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
707. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
708. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
709. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
710. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP051433 (Escherichia sp. SCLE84 plasmid pSCLE3, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
711. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
712. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP024882 (Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
713. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
714. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP008789 (Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
715. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
716. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
717. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
718. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
719. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
720. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
721. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
722. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP020526 (Enterobacter cloacae strain 109 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
723. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
724. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
725. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
726. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP025042 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_5, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
727. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
728. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
729. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
730. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP011987 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-74.026kb, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
731. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
732. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
733. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
734. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP022275 (Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
735. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
736. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
737. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
738. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
739. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
740. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
741. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
742. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
743. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
744. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
745. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_FO834904 (Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
746. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN310373 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
747. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN310374 (Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
748. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
749. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
750. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
751. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
752. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
753. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
754. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP010385 (Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-106.698kb, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
755. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
756. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
757. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
758. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
759. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
760. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP030079 (Enterobacter hormaechei strain 20710 plasmid p5-20710, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
761. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
762. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026272 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
763. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
764. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
765. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
766. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052559 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
767. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052270 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
768. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
769. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
770. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
771. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
772. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
773. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MK648236 (Klebsiella sp. strain TR5 plasmid pYK5, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
774. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
775. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
776. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
777. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
778. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
779. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
780. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP028792 (Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
781. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
782. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
783. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP022349 (Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
784. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
785. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
786. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
787. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052193 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
788. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
789. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP014124 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed2) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
790. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
791. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
792. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026206 (Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
793. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
794. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
795. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
796. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
797. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
798. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
799. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
800. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052376 (Klebsiella pneumoniae strain D16KP0025 plasmid pD16KP0025-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
801. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052561 (Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
802. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052209 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
803. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
804. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
805. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026182 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
806. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
807. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
808. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
809. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
810. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
811. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
812. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
813. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
814. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to KY930324 (Klebsiella pneumoniae plasmid pUCLAKPC1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
815. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP038468 (Citrobacter sp. SNU WT2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
816. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
817. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
818. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
819. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
820. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP031572 (Enterobacter hormaechei strain N1 plasmid pQnrS1-1502262, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
821. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP010383 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-106.409kb, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
822. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
823. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
824. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP036176 (Klebsiella huaxiensis strain WCHKl090001 plasmid p1_090001, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
825. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
826. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_AP019691 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-4, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
827. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
828. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP030068 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.3, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
829. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
830. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP028551 (Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
831. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP009774 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pNJST258N3-62b, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
832. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
833. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
834. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
835. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP046940 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
836. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP006925 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N3, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
837. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP006927 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
838. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
839. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP008932 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
840. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
841. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP006921 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C3, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
842. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cttcagctggccgtcgagctgacggatgccgg Protospacer
** *****************************
843. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP032180 (Citrobacter freundii strain AR_0116 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
844. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
845. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP029143 (Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
846. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052547 (Klebsiella pneumoniae strain B16KP0089 plasmid pB16KP0089-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
847. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
848. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP036446 (Klebsiella pneumoniae strain KPNIH45 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
849. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_AP019668 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63633, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
850. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP020065 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
851. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
852. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
853. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
854. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
855. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
856. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
857. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
858. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP050170 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
859. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
860. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
861. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP024681 (Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
862. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP034677 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
863. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
864. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
865. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
866. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
867. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP023571 (Enterobacter hormaechei strain BW plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
868. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
869. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
870. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
871. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
872. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
873. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
874. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
875. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
876. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
877. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
878. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
879. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
880. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
881. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
882. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
883. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026151 (Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
884. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
885. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
886. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
887. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
888. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
889. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
890. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP028181 (Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
891. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
892. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
893. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
894. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
895. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP042546 (Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
896. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP045019 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-5, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
897. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021856 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000001_pilon, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
898. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
899. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
900. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
901. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021898 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_3_pilon, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
902. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
903. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
904. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052370 (Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
905. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP011633 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
906. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
907. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
908. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
909. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
910. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
911. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
912. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
913. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
914. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
915. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
916. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
917. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP043319 (Enterobacter chengduensis strain WCHECl-C4 = WCHECh050004 plasmid pLAP2_050004, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
918. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
919. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
920. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052263 (Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
921. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
922. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
923. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
924. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP011577 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
925. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP011646 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
926. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP023186 (Klebsiella michiganensis strain K518 plasmid pK518_KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
927. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
928. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP027161 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
929. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagatgacggatgccgg Protospacer
****************** *************
930. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP025009 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
931. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
932. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
933. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052237 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
934. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
935. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP023947 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
936. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
937. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
938. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
939. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
940. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052437 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-3, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
941. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
942. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP050812 (Yokenella regensburgei strain W13 plasmid pYRW13-125, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
943. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052353 (Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
944. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
945. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
946. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_AP014954 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
947. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP028543 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
948. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
949. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026852 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
950. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
951. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
952. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP054265 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
953. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
954. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
955. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP028781 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
956. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
957. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP030350 (Enterobacter hormaechei strain AR_038 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggacgccgg Protospacer
**************************.*****
958. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052477 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
959. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP025006 (Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
960. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
961. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
962. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026716 (Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
963. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
964. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_LR792630 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
965. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
966. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MK649827 (Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
967. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
968. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
969. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MK649829 (Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
970. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052469 (Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
971. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP023943 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
972. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP030071 (Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
973. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
974. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
975. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP037929 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
976. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN922301 (Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
977. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_LT994840 (Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
978. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052173 (Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
979. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
980. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP015393 (Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
981. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP015396 (Klebsiella pneumoniae strain CR14 plasmid pCR14_4, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
982. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP027696 (Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
983. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
984. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052337 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
985. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_MK167987 (Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
986. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_MN268580 (Klebsiella pneumoniae strain KP13-53 plasmid pKP13-53-tet(A), complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
987. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP028274 (Mixta theicola strain SRCM103227 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcggctggccgtcgagctgacggatgccgg Protospacer
****.***************************
988. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052279 (Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
989. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_MH569712 (Serratia marcescens strain S120 plasmid pPM120-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
990. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
991. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_MH745929 (Klebsiella pneumoniae strain VRES1611 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
992. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
993. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
994. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_MF156696 (Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
995. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_MG764554 (Enterobacter cloacae strain 30860 plasmid p30860-tetA, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
996. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
997. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN823997 (Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
998. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN824000 (Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
999. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052489 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
1000. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KY271404 (Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
1001. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KY271406 (Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
1002. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
1003. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_MG764551 (Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
1004. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to LR134219 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
1005. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026370 (Klebsiella quasipneumoniae strain A708 plasmid pA708-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
1006. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
1007. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
1008. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN661403 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
1009. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MT108213 (Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
1010. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP033774 (Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
1011. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP054255 (Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
1012. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP054304 (Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence) position: , mismatch: 1, identity: 0.969
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggccgg Protospacer
************************** *****
1013. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1014. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1015. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1016. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1017. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1018. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1019. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP018674 (Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1020. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1021. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1022. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1023. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1024. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1025. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KY271405 (Klebsiella pneumoniae strain H151440672 plasmid pKPN3-307_typeB, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1026. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1027. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KX443408 (Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1028. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052485 (Klebsiella pneumoniae strain C16KP0036 plasmid pC16KP0036-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1029. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1030. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1031. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1032. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KP987215 (Citrobacter freundii strain 112298 plasmid p112298-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1033. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1034. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1035. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1036. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP012428 (Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1037. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP012428 (Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1038. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1039. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1040. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP034040 (Klebsiella pneumoniae subsp. pneumoniae strain CRK0298 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1041. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1042. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1043. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP044528 (Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1044. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1045. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1046. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1047. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1048. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1049. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1050. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1051. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1052. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1053. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1054. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1055. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1056. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1057. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1058. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1059. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1060. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1061. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1062. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1063. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052572 (Klebsiella pneumoniae strain A16KP0016 plasmid pA16KP0016-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1064. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NC_010886 (Klebsiella pneumoniae plasmid pK245, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1065. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1066. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1067. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1068. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1069. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1070. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP029733 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1071. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP035635 (Enterobacter cloacae strain EN3600 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1072. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP035637 (Enterobacter cloacae strain EN3600 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1073. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1074. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1075. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1076. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1077. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP051433 (Escherichia sp. SCLE84 plasmid pSCLE3, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1078. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1079. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP024882 (Citrobacter freundii strain AR_0022 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1080. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1081. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP008789 (Klebsiella oxytoca KONIH1 plasmid pKOX-137, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1082. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1083. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1084. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1085. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1086. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1087. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1088. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1089. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP020526 (Enterobacter cloacae strain 109 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1090. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1091. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1092. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1093. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP025042 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_5, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1094. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1095. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1096. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1097. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP011987 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-74.026kb, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1098. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1099. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1100. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1101. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP022275 (Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1102. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1103. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1104. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1105. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1106. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1107. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1108. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1109. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1110. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1111. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1112. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_FO834904 (Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1113. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN310373 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1114. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN310374 (Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1115. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1116. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1117. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1118. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1119. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1120. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1121. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP010385 (Enterobacter hormaechei subsp. xiangfangensis strain 34399 plasmid p34399-106.698kb, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1122. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1123. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1124. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1125. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1126. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1127. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP030079 (Enterobacter hormaechei strain 20710 plasmid p5-20710, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1128. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1129. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026272 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1130. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1131. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1132. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1133. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052559 (Klebsiella pneumoniae strain A17KP0008 plasmid pA17KP0008-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1134. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052270 (Klebsiella pneumoniae strain E16KP0268 plasmid pE16K0268-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1135. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1136. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1137. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1138. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1139. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1140. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MK648236 (Klebsiella sp. strain TR5 plasmid pYK5, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1141. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1142. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1143. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1144. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1145. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1146. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1147. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP028792 (Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1148. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP033823 (Klebsiella sp. FDAARGOS_511 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1149. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1150. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP022349 (Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1151. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1152. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1153. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1154. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052193 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1155. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1156. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP014124 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed2) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1157. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1158. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1159. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026206 (Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1160. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1161. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1162. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1163. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1164. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1165. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1166. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1167. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052376 (Klebsiella pneumoniae strain D16KP0025 plasmid pD16KP0025-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1168. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052561 (Klebsiella pneumoniae strain A17KP0004 plasmid pA17KP0004-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1169. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052209 (Klebsiella pneumoniae strain E17KP0085 plasmid pE17KP0085-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1170. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1171. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1172. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026182 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-0c4e, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1173. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1174. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1175. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1176. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1177. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1178. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1179. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1180. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1181. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to KY930324 (Klebsiella pneumoniae plasmid pUCLAKPC1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1182. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP038468 (Citrobacter sp. SNU WT2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1183. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1184. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1185. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1186. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1187. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP031572 (Enterobacter hormaechei strain N1 plasmid pQnrS1-1502262, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1188. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP010383 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-106.409kb, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1189. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1190. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1191. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP036176 (Klebsiella huaxiensis strain WCHKl090001 plasmid p1_090001, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1192. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1193. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_AP019691 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-4, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1194. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1195. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP030068 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.3, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1196. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1197. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP028551 (Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1198. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP009774 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pNJST258N3-62b, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1199. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1200. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1201. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1202. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP046940 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1203. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP006925 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N3, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1204. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP006927 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1205. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1206. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP008932 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1207. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1208. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP006921 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C3, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1209. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ccttcagctggccgtcgagctgacggatgccgg Protospacer
*** *****************************
1210. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP032180 (Citrobacter freundii strain AR_0116 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1211. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1212. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP029143 (Klebsiella michiganensis strain AR375 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1213. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052547 (Klebsiella pneumoniae strain B16KP0089 plasmid pB16KP0089-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1214. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1215. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP036446 (Klebsiella pneumoniae strain KPNIH45 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1216. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_AP019668 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63633, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1217. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP020065 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1218. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1219. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1220. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1221. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1222. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1223. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1224. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1225. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP050170 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1226. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1227. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1228. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP024681 (Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1229. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP034677 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1230. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1231. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1232. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1233. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1234. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP023571 (Enterobacter hormaechei strain BW plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1235. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1236. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1237. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1238. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1239. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1240. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1241. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1242. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1243. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1244. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1245. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1246. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1247. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1248. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1249. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1250. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026151 (Klebsiella pneumoniae strain F138 plasmid pF138_2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1251. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1252. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1253. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1254. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1255. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1256. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1257. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP028181 (Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1258. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052441 (Klebsiella pneumoniae strain C16KP0102 plasmid pC16KP0102-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1259. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1260. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1261. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_LR025093 (Klebsiella pneumoniae isolate KP9201 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1262. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP042546 (Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1263. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP045019 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-5, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1264. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021856 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000001_pilon, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1265. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1266. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP029724 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1267. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1268. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021898 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0050 plasmid unitig_3_pilon, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1269. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1270. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1271. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052370 (Klebsiella pneumoniae strain D16KP0087 plasmid pD16KP0087-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1272. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP011633 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-150, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1273. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1274. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1275. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1276. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1277. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1278. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1279. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1280. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052506 (Klebsiella pneumoniae strain B16KP0226 plasmid pB16KP0226-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1281. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1282. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1283. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1284. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP043319 (Enterobacter chengduensis strain WCHECl-C4 = WCHECh050004 plasmid pLAP2_050004, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1285. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1286. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1287. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052263 (Klebsiella pneumoniae strain E16KP0288 plasmid pE16K0288-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1288. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1289. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1290. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1291. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP011577 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1292. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP011646 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1293. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP023186 (Klebsiella michiganensis strain K518 plasmid pK518_KPC, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1294. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1295. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP027161 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1296. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP018361 (Klebsiella oxytoca strain CAV1752 plasmid pCAV1752-278, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagatgacggatgccgg Protospacer
******************* *************
1297. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP025009 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1298. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1299. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1300. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052237 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1301. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1302. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP023947 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1303. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP042883 (Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1304. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1305. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1306. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052435 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1307. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052437 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-3, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1308. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052140 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1309. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP050812 (Yokenella regensburgei strain W13 plasmid pYRW13-125, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1310. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052353 (Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1311. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052499 (Klebsiella pneumoniae strain B17KP0021 plasmid pB17KP0021-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1312. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1313. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_AP014954 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1314. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP028543 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p1_020143, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1315. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1316. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026852 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1317. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1318. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1319. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP054265 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1320. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1321. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1322. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP028781 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pNDM5_020046, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1323. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP027425 (Klebsiella oxytoca strain FDAARGOS_335 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1324. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP030350 (Enterobacter hormaechei strain AR_038 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggacgccgg Protospacer
***************************.*****
1325. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052477 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1326. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP025006 (Klebsiella pneumoniae strain AUSMDU00003562 plasmid pAUSMDU3562-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1327. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1328. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1329. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026716 (Klebsiella oxytoca strain AR_0028 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1330. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052243 (Klebsiella pneumoniae strain E17KP0019 plasmid pE17KP0019-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1331. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_LR792630 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1332. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1333. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MK649827 (Klebsiella pneumoniae strain 1675474 plasmid p1675474_1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1334. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1335. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MK649828 (Klebsiella pneumoniae strain 1675479 plasmid p1675479_1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1336. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MK649829 (Klebsiella pneumoniae strain 16114547 plasmid p16114547_1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1337. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052469 (Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1338. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP023943 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1339. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP030071 (Klebsiella pneumoniae strain DA12090 plasmid pDA12090.1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1340. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1341. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1342. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP037929 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1343. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN922301 (Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1344. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_LT994840 (Klebsiella pneumoniae isolate CNR48 plasmid CNR48, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1345. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052173 (Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1346. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1347. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP015393 (Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1348. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP015396 (Klebsiella pneumoniae strain CR14 plasmid pCR14_4, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1349. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP027696 (Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1350. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1351. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052337 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1352. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MK167987 (Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1353. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MN268580 (Klebsiella pneumoniae strain KP13-53 plasmid pKP13-53-tet(A), complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1354. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP028274 (Mixta theicola strain SRCM103227 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcggctggccgtcgagctgacggatgccgg Protospacer
*****.***************************
1355. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052279 (Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1356. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MH569712 (Serratia marcescens strain S120 plasmid pPM120-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1357. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1358. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MH745929 (Klebsiella pneumoniae strain VRES1611 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1359. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1360. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1361. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MF156696 (Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1362. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MG764554 (Enterobacter cloacae strain 30860 plasmid p30860-tetA, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1363. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1364. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN823997 (Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1365. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN824000 (Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1366. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052489 (Klebsiella pneumoniae strain C16KP0024 plasmid pC16KP0024-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1367. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KY271404 (Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1368. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KY271406 (Klebsiella pneumoniae strain H150820806 plasmid pKPN3-307_TypeC, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1369. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1370. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MG764551 (Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1371. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to LR134219 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1372. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026370 (Klebsiella quasipneumoniae strain A708 plasmid pA708-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1373. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1374. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1375. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN661403 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1376. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MT108213 (Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1377. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP033774 (Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1378. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP054255 (Klebsiella variicola strain FH-1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1379. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP054304 (Klebsiella pneumoniae strain MS14393 plasmid pMS14393A, complete sequence) position: , mismatch: 1, identity: 0.97
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggccgg Protospacer
*************************** *****
1380. spacer 3.3|4480869|33|NZ_CP028176|PILER-CR matches to MN013086 (Klebsiella phage vB_Kpn_Chronis, complete genome) position: , mismatch: 1, identity: 0.97
ccgttggcgggacagttttttcactgacaggta CRISPR spacer
ccgttggcgggacagttttttcactgaccggta Protospacer
**************************** ****
1381. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
cccgccgtttaatcgcggtgatgatatccggca Protospacer
.********************************
1382. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
cccgccgtttaatcgcggtgatgatatccggca Protospacer
.********************************
1383. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_LR134255 (Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
cccgccgtttaatcgcggtgatgatatccggca Protospacer
.********************************
1384. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
cccgccgtttaatcgcggtgatgatatccggca Protospacer
.********************************
1385. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
cccgccgtttaatcgcggtgatgatatccggca Protospacer
.********************************
1386. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
cccgccgtttaatcgcggtgatgatatccggca Protospacer
.********************************
1387. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052316 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
cccgccgtttaatcgcggtgatgatatccggca Protospacer
.********************************
1388. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
cccgccgtttaatcgcggtgatgatatccggca Protospacer
.********************************
1389. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_MG736312 (Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
cccgccgtttaatcgcggtgatgatatccggca Protospacer
.********************************
1390. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1391. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1392. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1393. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1394. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KY689238 (Klebsiella pneumoniae strain TP-P16 plasmid pKPC_P16, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1395. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KY270850 (Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1396. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1397. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KY174332 (Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1398. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1399. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1400. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1401. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1402. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1403. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1404. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1405. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1406. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1407. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca Protospacer
******************************.**
1408. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1409. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1410. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1411. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1412. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1413. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tcctccgtttaatcgcggtgatgatatccggca Protospacer
*** *****************************
1414. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1415. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_020893 (Klebsiella pneumoniae plasmid pKPC-LK30, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1416. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1417. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_009651 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN5, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca Protospacer
******************************.**
1418. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1419. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP045264 (Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1420. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_AP018754 (Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1421. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1422. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1423. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1424. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1425. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1426. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1427. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1428. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1429. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP033395 (Klebsiella pneumoniae strain WCHKP015625 plasmid pKPC12_015625, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1430. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1431. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1432. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1433. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca Protospacer
******************************.**
1434. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1435. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca Protospacer
******************************.**
1436. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1437. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1438. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP036362 (Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1439. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1440. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MT066418 (Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1441. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1442. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca Protospacer
******************************.**
1443. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to HG969998 (Klebsiella pneumoniae plasmid pIT-11C07, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1444. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1445. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1446. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1447. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1448. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1449. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP034777 (Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1450. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1451. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1452. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1453. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1454. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1455. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1456. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1457. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1458. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1459. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1460. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tcctccgtttaatcgcggtgatgatatccggca Protospacer
*** *****************************
1461. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tcctccgtttaatcgcggtgatgatatccggca Protospacer
*** *****************************
1462. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN891681 (Klebsiella pneumoniae strain 14899 plasmid p14899-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1463. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1464. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN891684 (Klebsiella pneumoniae strain BJ107 plasmid pBJ107-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1465. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN891686 (Klebsiella pneumoniae strain ZZ58 plasmid pZZ58-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1466. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1467. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1468. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1469. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1470. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1471. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1472. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1473. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052219 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca Protospacer
******************************.**
1474. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1475. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1476. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1477. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP018818 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1478. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccaccgtttaatcgcggtgatgatatccggca Protospacer
***.*****************************
1479. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccaccgtttaatcgcggtgatgatatccggca Protospacer
***.*****************************
1480. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1481. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1482. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1483. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1484. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1485. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1486. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1487. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1488. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1489. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1490. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1491. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1492. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1493. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1494. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1495. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1496. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1497. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1498. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1499. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1500. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1501. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1502. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1503. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1504. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP038003 (Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1505. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP007736 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1506. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1507. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1508. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP026180 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1509. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1510. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1511. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca Protospacer
******************************.**
1512. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1513. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1514. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP027044 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1515. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1516. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1517. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca Protospacer
******************************.**
1518. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1519. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1520. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1521. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1522. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP033947 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1523. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP036306 (Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1524. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1525. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052526 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1526. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1527. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1528. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1529. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tcctccgtttaatcgcggtgatgatatccggca Protospacer
*** *****************************
1530. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1531. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1532. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1533. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP006663 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1534. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP041250 (Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1535. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1536. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1537. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1538. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1539. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1540. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1541. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1542. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1543. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1544. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1545. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP028930 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1546. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1547. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1548. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP050170 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1549. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP050168 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFIB, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1550. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1551. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1552. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1553. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP016922 (Klebsiella pneumoniae isolate 11 plasmid pIncFIB_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1554. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca Protospacer
******************************.**
1555. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca Protospacer
******************************.**
1556. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1557. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1558. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca Protospacer
******************************.**
1559. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP022613 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1560. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP050373 (Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1561. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1562. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1563. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1564. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1565. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1566. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1567. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1568. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP026141 (Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1569. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1570. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1571. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1572. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP026584 (Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1573. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP020904 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1574. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP028181 (Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1575. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1576. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP047161 (Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1577. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca Protospacer
******************************.**
1578. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1579. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1580. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1581. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_AP018749 (Klebsiella pneumoniae strain KP33 plasmid pKP3302, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1582. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1583. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1584. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1585. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1586. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP036367 (Klebsiella pneumoniae strain WCHKP115068 plasmid pKPC12_115068, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1587. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN842291 (Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1588. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN842292 (Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1589. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1590. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1591. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP015824 (Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1592. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1593. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1594. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1595. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1596. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttaatcgcggtgatgatatccgaca Protospacer
******************************.**
1597. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1598. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1599. spacer 3.10|4481296|33|NZ_CP028176|PILER-CR matches to NZ_CP011577 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-131, complete sequence) position: , mismatch: 1, identity: 0.97
tccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
tccgccgtttcatcgcggtgatgatatccggca Protospacer
********** **********************
1600. spacer 3.13|4480870|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN013086 (Klebsiella phage vB_Kpn_Chronis, complete genome) position: , mismatch: 1, identity: 0.969
cgttggcgggacagttttttcactgacaggta CRISPR spacer
cgttggcgggacagttttttcactgaccggta Protospacer
*************************** ****
1601. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1602. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1603. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1604. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1605. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KY689238 (Klebsiella pneumoniae strain TP-P16 plasmid pKPC_P16, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1606. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KY270850 (Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1607. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1608. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KY174332 (Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1609. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1610. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1611. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1612. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1613. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1614. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1615. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1616. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1617. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1618. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca Protospacer
*****************************.**
1619. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1620. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1621. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1622. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1623. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1624. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
cctccgtttaatcgcggtgatgatatccggca Protospacer
** *****************************
1625. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1626. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_020893 (Klebsiella pneumoniae plasmid pKPC-LK30, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1627. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1628. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_009651 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN5, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca Protospacer
*****************************.**
1629. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1630. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP045264 (Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1631. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_AP018754 (Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1632. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1633. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1634. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1635. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1636. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1637. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1638. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1639. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1640. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP033395 (Klebsiella pneumoniae strain WCHKP015625 plasmid pKPC12_015625, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1641. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1642. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1643. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1644. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca Protospacer
*****************************.**
1645. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1646. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca Protospacer
*****************************.**
1647. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052145 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccggta Protospacer
******************************.*
1648. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1649. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1650. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP036362 (Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1651. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1652. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MT066418 (Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1653. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1654. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca Protospacer
*****************************.**
1655. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to HG969998 (Klebsiella pneumoniae plasmid pIT-11C07, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1656. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1657. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1658. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1659. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1660. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1661. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP034777 (Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1662. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1663. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1664. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1665. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1666. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1667. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1668. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1669. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1670. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1671. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1672. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
cctccgtttaatcgcggtgatgatatccggca Protospacer
** *****************************
1673. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
cctccgtttaatcgcggtgatgatatccggca Protospacer
** *****************************
1674. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN891681 (Klebsiella pneumoniae strain 14899 plasmid p14899-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1675. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1676. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN891684 (Klebsiella pneumoniae strain BJ107 plasmid pBJ107-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1677. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN891686 (Klebsiella pneumoniae strain ZZ58 plasmid pZZ58-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1678. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1679. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1680. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1681. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1682. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1683. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1684. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1685. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052219 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca Protospacer
*****************************.**
1686. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1687. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1688. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1689. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP018818 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1690. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccaccgtttaatcgcggtgatgatatccggca Protospacer
**.*****************************
1691. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccaccgtttaatcgcggtgatgatatccggca Protospacer
**.*****************************
1692. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1693. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1694. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1695. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1696. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1697. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1698. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1699. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1700. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1701. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1702. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1703. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1704. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1705. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1706. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1707. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1708. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1709. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1710. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1711. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1712. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1713. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1714. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1715. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1716. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP038003 (Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1717. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP007736 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1718. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1719. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1720. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP026180 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1721. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1722. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1723. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca Protospacer
*****************************.**
1724. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1725. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1726. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP027044 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1727. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1728. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1729. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca Protospacer
*****************************.**
1730. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1731. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1732. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1733. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1734. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP033947 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1735. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP036306 (Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1736. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1737. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052526 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1738. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1739. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1740. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1741. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
cctccgtttaatcgcggtgatgatatccggca Protospacer
** *****************************
1742. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1743. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1744. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP031793 (Klebsiella pneumoniae strain INF116-sc-2279924 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1745. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP006663 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1746. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP041250 (Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1747. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1748. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1749. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP020062 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1750. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1751. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1752. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1753. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1754. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1755. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1756. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1757. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP028930 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1758. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1759. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1760. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP050170 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1761. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP050168 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFIB, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1762. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1763. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1764. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1765. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP016922 (Klebsiella pneumoniae isolate 11 plasmid pIncFIB_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1766. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca Protospacer
*****************************.**
1767. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca Protospacer
*****************************.**
1768. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1769. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1770. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca Protospacer
*****************************.**
1771. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP022613 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1772. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP050373 (Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1773. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1774. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1775. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1776. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1777. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1778. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP021713 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000000, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1779. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1780. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP026141 (Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1781. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP040030 (Klebsiella pneumoniae strain KPC160121 plasmid pQnr-L121, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1782. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1783. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1784. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP026584 (Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1785. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP020904 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1786. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP028181 (Klebsiella pneumoniae strain CFSAN054110 plasmid pGMI16-005_01, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1787. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP042521 (Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1788. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP047161 (Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1789. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca Protospacer
*****************************.**
1790. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1791. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1792. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1793. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_AP018749 (Klebsiella pneumoniae strain KP33 plasmid pKP3302, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1794. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1795. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP024551 (Klebsiella pneumoniae strain INF163 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1796. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP032209 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1797. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1798. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP036367 (Klebsiella pneumoniae strain WCHKP115068 plasmid pKPC12_115068, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1799. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN842291 (Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1800. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN842292 (Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1801. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1802. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1803. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP015824 (Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1804. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP021710 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000853, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1805. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1806. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1807. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1808. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttaatcgcggtgatgatatccgaca Protospacer
*****************************.**
1809. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1810. spacer 3.20|4481297|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 1, identity: 0.969
ccgccgtttaatcgcggtgatgatatccggca CRISPR spacer
ccgccgtttcatcgcggtgatgatatccggca Protospacer
********* **********************
1811. spacer 2.3|4471538|33|NZ_CP028176|PILER-CR,CRT matches to KC139649 (Salmonella phage FSL SP-069 hypothetical proteins, RdgC exonuclease, hypothetical proteins, TerL, hypothetical proteins, deoxyuridine 5'-triphosphate nucleotidohydrolase, hypothetical proteins, NinH, head morphogenesis protein, hypothetical proteins, capsid related protein, hypothetical proteins, enolase-like protein, hypothetical proteins, tail fiber, hypothetical protein, putative endolysin, hypothetical proteins, and DNA polymerase genes, complete cds) position: , mismatch: 2, identity: 0.939
cgtcatcagcgccttgttccagcggcgaccacc CRISPR spacer
cgtcatcagtgccttgttccagcgacgaccacc Protospacer
*********.**************.********
1812. spacer 2.3|4471538|33|NZ_CP028176|PILER-CR,CRT matches to KC139634 (Salmonella phage FSL SP-062 hypothetical protein gene, partial cds; and capsid related protein, hypothetical proteins, tail length tape measure protein, hypothetical protein, enolase-like protein, hypothetical protein, tail protein, tail fiber, hypothetical protein, putative endolysin, hypothetical proteins, DNA methylase, hypothetical proteins, and DNA polymerase genes, complete cds) position: , mismatch: 2, identity: 0.939
cgtcatcagcgccttgttccagcggcgaccacc CRISPR spacer
cgtcatcagtgccttgttccagcgacgaccacc Protospacer
*********.**************.********
1813. spacer 2.4|4471599|33|NZ_CP028176|PILER-CR,CRT matches to MK714353 (Klebsiella phage ST13-OXA48phi12.5, complete genome) position: , mismatch: 2, identity: 0.939
tccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
tccagttgtcatagtcctcggtaatgtcctcga Protospacer
******.***.**********************
1814. spacer 2.4|4471599|33|NZ_CP028176|PILER-CR,CRT matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 2, identity: 0.939
tccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
tccagtcatcgtagtcctcagtaatgtcctcga Protospacer
*******.***********.*************
1815. spacer 2.9|4471539|32|NZ_CP028176|CRISPRCasFinder matches to KC139649 (Salmonella phage FSL SP-069 hypothetical proteins, RdgC exonuclease, hypothetical proteins, TerL, hypothetical proteins, deoxyuridine 5'-triphosphate nucleotidohydrolase, hypothetical proteins, NinH, head morphogenesis protein, hypothetical proteins, capsid related protein, hypothetical proteins, enolase-like protein, hypothetical proteins, tail fiber, hypothetical protein, putative endolysin, hypothetical proteins, and DNA polymerase genes, complete cds) position: , mismatch: 2, identity: 0.938
gtcatcagcgccttgttccagcggcgaccacc CRISPR spacer
gtcatcagtgccttgttccagcgacgaccacc Protospacer
********.**************.********
1816. spacer 2.9|4471539|32|NZ_CP028176|CRISPRCasFinder matches to KC139634 (Salmonella phage FSL SP-062 hypothetical protein gene, partial cds; and capsid related protein, hypothetical proteins, tail length tape measure protein, hypothetical protein, enolase-like protein, hypothetical protein, tail protein, tail fiber, hypothetical protein, putative endolysin, hypothetical proteins, DNA methylase, hypothetical proteins, and DNA polymerase genes, complete cds) position: , mismatch: 2, identity: 0.938
gtcatcagcgccttgttccagcggcgaccacc CRISPR spacer
gtcatcagtgccttgttccagcgacgaccacc Protospacer
********.**************.********
1817. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MK714353 (Klebsiella phage ST13-OXA48phi12.5, complete genome) position: , mismatch: 2, identity: 0.938
ccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
ccagttgtcatagtcctcggtaatgtcctcga Protospacer
*****.***.**********************
1818. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 2, identity: 0.938
ccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
ccagtcatcgtagtcctcagtaatgtcctcga Protospacer
******.***********.*************
1819. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg Protospacer
************************** * ***
1820. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtagagctgacggaggccgg Protospacer
************** *********** *****
1821. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgatggaggccgg Protospacer
**********************.*** *****
1822. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtagagctgacggaggccgg Protospacer
************** *********** *****
1823. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtagagctgacggaggccgg Protospacer
************** *********** *****
1824. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtagagctgacggaggccgg Protospacer
************** *********** *****
1825. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************ * *****
1826. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgatggaggccgg Protospacer
**********************.*** *****
1827. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN661403 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacgaaggccgg Protospacer
************************.* *****
1828. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP017473 (Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
atgcagctggccgttgagctgacggatgccgg Protospacer
*************.*****************
1829. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP045692 (Klebsiella pneumoniae strain TK421 plasmid pTK421_2, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ttgcagctggccgtcgagctgacggaggccgg Protospacer
.************************* *****
1830. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
atgcagctggccgtggagctgacggatgccgg Protospacer
************* *****************
1831. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP032995 (Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1832. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP041050 (Citrobacter sp. CF971 plasmid pBM527-4, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagcttacggacgccgg Protospacer
******************** *****.*****
1833. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg Protospacer
************************** * ***
1834. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_017627 (Escherichia coli 042 plasmid pAA, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggcagtggagctgacggatgccgg Protospacer
*********** ** *****************
1835. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP025625 (Escherichia coli strain SCEC020007 plasmid pBOKZ_020007, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1836. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MF679144 (Escherichia coli plasmid pBJ114-78, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1837. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP050841 (Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtagagctgacggaggccgg Protospacer
************** *********** *****
1838. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KX058576 (Salmonella enterica strain SJTUF10584 plasmid pS10584, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1839. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KX808482 (Escherichia coli O55:H7 strain 122262 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1840. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KU321583 (Escherichia coli strain E80 plasmid pE80, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1841. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KT282968 (Escherichia coli strain EC012 plasmid pEC012, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1842. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KU043116 (Escherichia coli strain Y5 plasmid pECY56, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1843. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KU130396 (Escherichia coli strain S68 plasmid pS68, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1844. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KX276657 (Escherichia coli strain MRSN388634 plasmid pMR0516mcr, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1845. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP032991 (Escherichia coli strain W2-5 plasmid p2_W2-5, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1846. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052795 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1847. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KM085450 (Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1848. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1849. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KT002541 (Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1850. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KM085449 (Escherichia coli O104:H7 strain RM9387 plasmid pO104_H7, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1851. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KR822246 (Enterobacter hormaechei strain E0083033-1 plasmid pEh1A, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************ * *****
1852. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KM052220 (Escherichia coli strain H18 Hel20 TF1 plasmid pTF_H18 Hel20 TF1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1853. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg Protospacer
************************** * ***
1854. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP010130 (Escherichia coli strain C9 plasmid A, complete genome) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1855. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg Protospacer
************************** * ***
1856. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP010233 (Escherichia coli strain S30 plasmid B, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1857. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg Protospacer
************************** * ***
1858. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_AP023192 (Escherichia coli strain TUM18530 plasmid pMTY18530-2, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1859. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP032799 (Escherichia coli strain ERL06-2497 plasmid pERL06-2497-2, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1860. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP045742 (Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1861. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg Protospacer
************************** * ***
1862. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KT754162 (Shigella dysenteriae 1 strain BU53M1 plasmid pBU53M1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1863. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052804 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1864. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_AP017618 (Escherichia coli strain MRY15-117 plasmid pMRY15-117_1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1865. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP013191 (Escherichia coli strain FORC_031 plasmid pFORC31.1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggcagtggagctgacggatgccgg Protospacer
*********** ** *****************
1866. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP018116 (Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1867. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP018110 (Escherichia coli strain MRSN346595 plasmid pMRSN346595_120.3, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1868. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP038508 (Salmonella enterica subsp. enterica serovar Infantis strain FARPER-219 plasmid p-F219, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1869. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to KY075659 (Escherichia coli strain GD80 plasmid pGD80-2, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1870. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052802 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S976 plasmid pN17S0976, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1871. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP042500 (Enterobacter sp. E76 plasmid pE76_001, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtggagctgacggacgccgg Protospacer
************** ***********.*****
1872. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP019272 (Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1873. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP024468 (Shigella dysenteriae strain BU53M1 plasmid pBU53M1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1874. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP009107 (Escherichia coli strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1875. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP053733 (Escherichia coli strain CP55_Sichuan plasmid pCP55-141k, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1876. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg Protospacer
************************** * ***
1877. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_025106 (Escherichia coli strain NMI5428/11 plasmid pMC-NDM, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1878. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP033963 (Klebsiella pneumoniae strain L482 plasmid p4_L382, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1879. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP009105 (Escherichia coli strain RM9387 plasmid pO104_H7, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1880. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP017848 (Escherichia coli strain FMU073332 plasmid pEcoFMU07332d sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggcagtggagctgacggatgccgg Protospacer
*********** ** *****************
1881. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP017848 (Escherichia coli strain FMU073332 plasmid pEcoFMU07332d sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggcagtggagctgacggatgccgg Protospacer
*********** ** *****************
1882. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP020547 (Escherichia coli strain ZJ3920 plasmid pZJ3920-2, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1883. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP010317 (Escherichia coli strain 789 plasmid pAPEC-O78-2) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1884. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052788 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0611 plasmid pN19S0611, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1885. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052840 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S024 plasmid pN16S024, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1886. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_KJ020575 (Escherichia coli strain FP460 plasmid pHNFP460-1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1887. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP054315 (Escherichia coli strain SCU-483 plasmid pSCU-483-2) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggcagtggagctgacggatgccgg Protospacer
*********** ** *****************
1888. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP054316 (Escherichia coli strain SCU-483 plasmid pSCU-483-1) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1889. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_LN824135 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************ * *****
1890. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_010488 (Escherichia coli SMS-3-5 plasmid pSMS35_130, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1891. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP024277 (Escherichia coli O6:H16 strain M9682-C1 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggcagtggagctgacggatgccgg Protospacer
*********** ** *****************
1892. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP047091 (Salmonella sp. S13 plasmid pS13-2, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1893. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP012835 (Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 plasmid pCFSAN001588_002, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1894. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_009786 (Escherichia coli O139:H28 str. E24377A plasmid pETEC_80, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggcagtggagctgacggatgccgg Protospacer
*********** ** *****************
1895. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to KX023259 (Escherichia coli plasmid pSCE516-4, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1896. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP051431 (Escherichia sp. SCLE84 plasmid pSCLE1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1897. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052786 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0641 plasmid pN19S0641, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1898. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052838 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S097 plasmid pN16S097, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1899. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_AP023150 (Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03M, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg Protospacer
************************** * ***
1900. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP044402 (Escherichia coli strain NMBU-W10C18 plasmid pNMBU-W10C18_02, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1901. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_025198 (Escherichia coli plasmid pJIE512b, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1902. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgttgagctgacggacgccgg Protospacer
**************.***********.*****
1903. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************ * *****
1904. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg Protospacer
************************** * ***
1905. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN158992 (Escherichia coli strain TREC9 plasmid pTREC9, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1906. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN915010 (Escherichia coli strain TJ-33 plasmid pNDM-TJ33, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1907. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN915012 (Escherichia coli strain GD-33 plasmid pNDM33-2, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1908. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN915013 (Escherichia coli strain TD-33 plasmid pNDM-TD33, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1909. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP051676 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1234 plasmid pN16S1234, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1910. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP054942 (Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1911. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP054943 (Escherichia coli strain MS6192 plasmid pMS6192C, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1912. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP024287 (Escherichia albertii strain 2014C-4356 plasmid unnamed5, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1913. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP019248 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-3, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1914. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP019269 (Escherichia coli strain 13C1079T plasmid p13C1079T-2, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1915. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP019269 (Escherichia coli strain 13C1079T plasmid p13C1079T-2, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1916. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP029244 (Escherichia coli strain ECCRA-119 plasmid pTB202, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1917. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP031549 (Escherichia coli strain cq9 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1918. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052783 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0679 plasmid pN19S0679-1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1919. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052784 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0679 plasmid pN19S0679-2, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1920. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052836 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S103 plasmid pN16S103, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1921. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP029748 (Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1922. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************ * *****
1923. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN061455 (Escherichia coli strain EC-15-3 plasmid pEC-15-3-NDM-1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1924. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN086778 (Escherichia coli plasmid p16EC-IncN, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1925. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN891682 (Klebsiella pneumoniae strain 116753 plasmid p116753-KPC, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1926. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP038392 (Escherichia coli O157:H7 strain DEC5B plasmid pDEC5B-4, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1927. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg Protospacer
************************** * ***
1928. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************ * *****
1929. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MH579767 (Salmonella enterica subsp. enterica serovar Typhi strain SAL-18-0989 isolate B plasmid pSTY-blaCTX-M-65, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1930. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN641485 (Escherichia coli strain SDCRK18-7 plasmid pNDM-SDCRK18-7, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1931. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052781 (Salmonella enterica strain CVM N19S0949 plasmid pN19S0949, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1932. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052834 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S041 plasmid pN17S0041, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1933. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP038417 (Escherichia coli O157:H7 strain 3-5-1 plasmid pGM351-2, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1934. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP038388 (Escherichia coli O157:H7 strain DEC5D plasmid pDEC5D-3, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1935. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP040923 (Escherichia coli strain FC853_EC plasmid p853EC4, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1936. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NC_009425 (Enterobacter sp. 638 plasmid pENTE01, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtggaactgacggatgccgg Protospacer
************** **.**************
1937. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP044137 (Escherichia coli O157 strain AR-0430 plasmid pAR-0430-1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1938. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtagagctgacggaggccgg Protospacer
************** *********** *****
1939. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to MN158991 (Escherichia coli strain TREC8 plasmid pTREC8, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1940. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1941. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052793 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0388 plasmid pN19S0388, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1942. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP034251 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1943. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP034252 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64-96, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1944. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP015502 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************ * *****
1945. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP015502 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************ * *****
1946. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP033383 (Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1947. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP044347 (Escherichia coli strain P225M plasmid pP225M-CTX-M-55, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1948. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP041438 (Escherichia coli strain STEC005 plasmid pSTEC005, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1949. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP037964 (Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg Protospacer
************************** * ***
1950. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052779 (Salmonella enterica strain 19TN07GT06K-S plasmid pN19S1233, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1951. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to CP052832 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1040 plasmid pN17S1040, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1952. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP038298 (Escherichia coli O157:H7 strain TB182A plasmid pTB182A-4, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1953. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP042618 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-3_MCR3, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1954. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP042619 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1955. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP041436 (Escherichia coli strain STEC309 plasmid pSTEC309, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1956. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggccgtcgagctgacggaggacgg Protospacer
************************** * ***
1957. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP038397 (Escherichia coli O157:H7 strain DEC5A plasmid pDEC5A-4, complete sequence) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1958. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_LT985283 (Escherichia coli strain 13942-1 genome assembly, plasmid: RCS74_pI) position: , mismatch: 2, identity: 0.938
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacgccgg Protospacer
***********.**************.*****
1959. spacer 2.15|4471906|32|NZ_CP028176|CRISPRCasFinder matches to MN098327 (Klebsiella phage Mulock, complete genome) position: , mismatch: 2, identity: 0.938
tcatcacgtgtgagcggatttggctctatcct CRISPR spacer
tcatcacgtgtgagcggatctggttctatcct Protospacer
*******************.***.********
1960. spacer 2.15|4471906|32|NZ_CP028176|CRISPRCasFinder matches to KY271400 (Klebsiella phage 6 LV-2017, complete genome) position: , mismatch: 2, identity: 0.938
tcatcacgtgtgagcggatttggctctatcct CRISPR spacer
tcatcacgtgtgagcggatctggttctatcct Protospacer
*******************.***.********
1961. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
1962. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg Protospacer
*************** *********** *****
1963. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgatggaggccgg Protospacer
***********************.*** *****
1964. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg Protospacer
*************** *********** *****
1965. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg Protospacer
*************** *********** *****
1966. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg Protospacer
*************** *********** *****
1967. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NC_021198 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-1 DNA, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
1968. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgatggaggccgg Protospacer
***********************.*** *****
1969. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN661403 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgaaggccgg Protospacer
*************************.* *****
1970. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP041050 (Citrobacter sp. CF971 plasmid pBM527-4, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagcttacggacgccgg Protospacer
********************* *****.*****
1971. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
1972. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP050841 (Klebsiella pneumoniae strain Bckp101 plasmid pBckp101-1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg Protospacer
*************** *********** *****
1973. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KR822246 (Enterobacter hormaechei strain E0083033-1 plasmid pEh1A, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
1974. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
1975. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
1976. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
1977. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
1978. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP017473 (Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
catgcagctggccgttgagctgacggatgccgg Protospacer
* *************.*****************
1979. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP042500 (Enterobacter sp. E76 plasmid pE76_001, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtggagctgacggacgccgg Protospacer
*************** ***********.*****
1980. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
1981. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_LN824135 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_B_Kpneumoniae_MS6671) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
1982. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP012835 (Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 plasmid pCFSAN001588_002, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggctgtcgagctgacggacgccgg Protospacer
************.**************.*****
1983. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_AP023150 (Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03M, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
1984. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgttgagctgacggacgccgg Protospacer
***************.***********.*****
1985. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
1986. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
1987. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
1988. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
1989. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
1990. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NC_009425 (Enterobacter sp. 638 plasmid pENTE01, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtggaactgacggatgccgg Protospacer
*************** **.**************
1991. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg Protospacer
*************** *********** *****
1992. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP015502 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
1993. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP015502 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 2, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
1994. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP037964 (Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
1995. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
1996. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
1997. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP034325 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
1998. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
1999. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP024835 (Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2000. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2001. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg Protospacer
*************** *********** *****
2002. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP007736 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2003. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2004. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2005. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021688 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001189, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2006. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021720 (Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2007. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2008. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP033947 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2009. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP028553 (Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2010. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2011. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP024839 (Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2012. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP041250 (Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2013. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgccgagctgacggaggccgg Protospacer
**************.************ *****
2014. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP022825 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2015. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP025966 (Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2016. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2017. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2018. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2019. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2020. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg Protospacer
*************** *********** *****
2021. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2022. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP024431 (Klebsiella pneumoniae strain DA48896 plasmid p48896_2, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2023. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN792917 (Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENM30_NDM1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2024. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP050361 (Klebsiella pneumoniae strain 47733 plasmid p47733_ARR2, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2025. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP045678 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2026. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN823996 (Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2027. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN824001 (Klebsiella pneumoniae strain N201205880 plasmid p205880-1FIIK, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2028. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2029. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP024509 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2030. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP032189 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2031. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg Protospacer
*************** *********** *****
2032. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021946 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2033. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP020050 (Escherichia coli strain AR_0118 plasmid unitig_2, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2034. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg Protospacer
*************** *********** *****
2035. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg Protospacer
*************** *********** *****
2036. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2037. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP035124 (Escherichia coli strain EC25 plasmid pEC25-1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2038. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2039. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021698 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000183, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2040. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP034085 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2041. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP028717 (Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2042. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2043. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg Protospacer
*************** *********** *****
2044. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg Protospacer
*************** *********** *****
2045. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP028389 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2046. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021758 (Klebsiella pneumoniae strain AR_0138 plasmid tig00000001, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2047. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MK649823 (Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2048. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2049. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MK649826 (Klebsiella pneumoniae strain 130411-38618 plasmid p130411-38618_1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2050. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2051. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP021777 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0053 plasmid unitig_2, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggatgttgg Protospacer
*****************************..**
2052. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP047634 (Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2053. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP047635 (Klebsiella pneumoniae strain K2606 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2054. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MK773538 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-D, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2055. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2056. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MN543570 (Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2057. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP044045 (Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2058. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgaactgacggaggccgg Protospacer
******************.******** *****
2059. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
catgcagctggccgtggagctgacggatgccgg Protospacer
* ************* *****************
2060. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MH909329 (Leclercia adecarboxylata strain 150707804 plasmid p707804-3FII, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggcagg Protospacer
*************************** ** **
2061. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2062. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MG764547 (Escherichia coli strain 14E509 plasmid p14E509-CTXM, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2063. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_MH464586 (Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2064. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MN688131 (Enterobacter hormaechei subsp. xiangfangensis strain ST114 plasmid pLAU_ENC1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2065. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP014777 (Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2066. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacggaggacgg Protospacer
*************************** * ***
2067. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP033755 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2068. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP029441 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtcgagctgacgcaggccgg Protospacer
************************* * *****
2069. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP032169 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.939
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
cctgcagctggccgtagagctgacggaggccgg Protospacer
*************** *********** *****
2070. spacer 2.18|4471905|33|NZ_CP028176|CRT matches to MN098327 (Klebsiella phage Mulock, complete genome) position: , mismatch: 2, identity: 0.939
ttcatcacgtgtgagcggatttggctctatcct CRISPR spacer
ttcatcacgtgtgagcggatctggttctatcct Protospacer
********************.***.********
2071. spacer 2.18|4471905|33|NZ_CP028176|CRT matches to KY271400 (Klebsiella phage 6 LV-2017, complete genome) position: , mismatch: 2, identity: 0.939
ttcatcacgtgtgagcggatttggctctatcct CRISPR spacer
ttcatcacgtgtgagcggatctggttctatcct Protospacer
********************.***.********
2072. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP045692 (Klebsiella pneumoniae strain TK421 plasmid pTK421_2, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tttgcagctggccgtcgagctgacggaggccgg Protospacer
..************************* *****
2073. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP032995 (Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2074. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NC_017627 (Escherichia coli 042 plasmid pAA, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggcagtggagctgacggatgccgg Protospacer
.*********** ** *****************
2075. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP025625 (Escherichia coli strain SCEC020007 plasmid pBOKZ_020007, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2076. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to MF679144 (Escherichia coli plasmid pBJ114-78, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2077. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KX058576 (Salmonella enterica strain SJTUF10584 plasmid pS10584, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2078. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KX808482 (Escherichia coli O55:H7 strain 122262 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2079. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KU321583 (Escherichia coli strain E80 plasmid pE80, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2080. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KT282968 (Escherichia coli strain EC012 plasmid pEC012, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2081. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KU043116 (Escherichia coli strain Y5 plasmid pECY56, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2082. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KU130396 (Escherichia coli strain S68 plasmid pS68, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2083. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KX276657 (Escherichia coli strain MRSN388634 plasmid pMR0516mcr, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2084. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP032991 (Escherichia coli strain W2-5 plasmid p2_W2-5, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2085. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052795 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2086. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KM085450 (Escherichia coli O104:H21 strain 94-3024 plasmid pO104_H21, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2087. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2088. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KT002541 (Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2089. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KM085449 (Escherichia coli O104:H7 strain RM9387 plasmid pO104_H7, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2090. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KM052220 (Escherichia coli strain H18 Hel20 TF1 plasmid pTF_H18 Hel20 TF1, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2091. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP010130 (Escherichia coli strain C9 plasmid A, complete genome) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2092. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP010233 (Escherichia coli strain S30 plasmid B, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2093. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_AP023192 (Escherichia coli strain TUM18530 plasmid pMTY18530-2, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2094. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP032799 (Escherichia coli strain ERL06-2497 plasmid pERL06-2497-2, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2095. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP045742 (Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2096. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_KT754162 (Shigella dysenteriae 1 strain BU53M1 plasmid pBU53M1, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2097. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to CP052804 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2098. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_AP017618 (Escherichia coli strain MRY15-117 plasmid pMRY15-117_1, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2099. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP013191 (Escherichia coli strain FORC_031 plasmid pFORC31.1, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggcagtggagctgacggatgccgg Protospacer
.*********** ** *****************
2100. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP018116 (Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence) position: , mismatch: 3, identity: 0.909
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacgccgg Protospacer
.***********.**************.*****
2101. spacer 2.2|4471477|33|NZ_CP028176|PILER-CR,CRT matches to MH153804 (Rhodococcus phage Jace, complete genome) position: , mismatch: 5, identity: 0.848
---cgtgtcgaagcgcacctcgtagccgagccagtc CRISPR spacer
cttcgtgtc---gcgcagctcgtagccgagcgagtc Protospacer
****** ***** ************* ****
2102. spacer 2.8|4471478|32|NZ_CP028176|CRISPRCasFinder matches to MH153804 (Rhodococcus phage Jace, complete genome) position: , mismatch: 5, identity: 0.844
---gtgtcgaagcgcacctcgtagccgagccagtc CRISPR spacer
ttcgtgtc---gcgcagctcgtagccgagcgagtc Protospacer
***** ***** ************* ****
2103. spacer 2.14|4471845|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP041050 (Citrobacter sp. CF971 plasmid pBM527-4, complete sequence) position: , mismatch: 5, identity: 0.844
ctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
ctgcagctggctgtcgagctgacggacagtgg Protospacer
***********.**************.. .**
2104. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP022194 (Yangia pacifica strain YSBP01 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.844
tcgcat-ggcccgatctcggcgccgccggtggc CRISPR spacer
-gacatcggcccgatctcggcgctggcggtggc Protospacer
.*** ****************.* *******
2105. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 5, identity: 0.844
tcgcatggcccgatctcggcgccgccggtggc- CRISPR spacer
ccgcctggcccgatctcggcgccacc-ctggcg Protospacer
.*** ******************.** ****
2106. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 5, identity: 0.844
-tcgcatggcccgatctcggcgccgccggtggc CRISPR spacer
ttcgcgc-gcccgatctcggcgctgccggtgcc Protospacer
****.. ***************.******* *
2107. spacer 2.8|4471478|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP026110 (Paraburkholderia hospita strain DSM 17164 plasmid pEMT1, complete sequence) position: , mismatch: 6, identity: 0.812
gtgtcgaagcgcacctcgtagccgagccagtc- CRISPR spacer
gtgtcgaagcgcaccttgcagccg-tcgagtgc Protospacer
****************.*.***** * ***
2108. spacer 2.8|4471478|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.812
gtgtcgaagcgcacctcgtagccgagccagtc- CRISPR spacer
gtgtcgaagcgcaccttgcagccg-tcgagtgc Protospacer
****************.*.***** * ***
2109. spacer 2.8|4471478|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.812
gtgtcgaagcgcacctcgtagccgagccagtc- CRISPR spacer
gtgtcgaagcgcaccttgcagccg-tcgagtgc Protospacer
****************.*.***** * ***
2110. spacer 2.8|4471478|32|NZ_CP028176|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812
gtgtcgaagcgcacctcgtagccgagccagtc- CRISPR spacer
gtgtcgaagcgcaccttgcagccg-tcgagtgc Protospacer
****************.*.***** * ***
2111. spacer 2.9|4471539|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 6, identity: 0.812
gtcatcagcgccttgttccagcggcgaccacc- CRISPR spacer
gagatcagcgcgttgttccatcggcg-cgaccg Protospacer
* ******** ******** ***** * ***
2112. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to NC_030917 (Gordonia phage OneUp, complete genome) position: , mismatch: 6, identity: 0.812
ccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
ctcgccgtcgtaggcctcggtgatgtcctcgg Protospacer
*. *.******** *******.*********.
2113. spacer 2.17|4471844|33|NZ_CP028176|CRT matches to NZ_CP041050 (Citrobacter sp. CF971 plasmid pBM527-4, complete sequence) position: , mismatch: 6, identity: 0.818
cctgcagctggccgtcgagctgacggatgccgg CRISPR spacer
tctgcagctggctgtcgagctgacggacagtgg Protospacer
.***********.**************.. .**
2114. spacer 3.1|4480747|33|NZ_CP028176|PILER-CR matches to NZ_CP022194 (Yangia pacifica strain YSBP01 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.818
ttcgcat-ggcccgatctcggcgccgccggtggc CRISPR spacer
-ggacatcggcccgatctcggcgctggcggtggc Protospacer
.*** ****************.* *******
2115. spacer 3.1|4480747|33|NZ_CP028176|PILER-CR matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 6, identity: 0.818
ttcgcatggcccgatctcggcgccgccggtggc- CRISPR spacer
gccgcctggcccgatctcggcgccacc-ctggcg Protospacer
.*** ******************.** ****
2116. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 6, identity: 0.812
tcgcatggc-ccgatctcggcgccgccggtggc CRISPR spacer
-tccatgacgccgatctcggcgaggccggtggc Protospacer
. ****.* ************ *********
2117. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MT522001 (Microbacterium phage Karate, complete genome) position: , mismatch: 6, identity: 0.812
--tcgcatggcccgatctcggcgccgccggtggc CRISPR spacer
agtgccatg--ccgatctcggagacgccggtggc Protospacer
* **** ********** * **********
2118. spacer 3.12|4480809|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
gacggacataccgcgctgcccggtctgcggca CRISPR spacer
gccggacataccgcgccgcccggtcttgcgct Protospacer
* **************.********* **
2119. spacer 2.2|4471477|33|NZ_CP028176|PILER-CR,CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.788
---cgtgtcgaagcgcacctcgtagccgagccagtc CRISPR spacer
ttccgtctt---gcgcgcctcgtagccgatccagtc Protospacer
*** *. ****.************ ******
2120. spacer 2.2|4471477|33|NZ_CP028176|PILER-CR,CRT matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.788
cgtgtcgaagcgcacctcgtagccgagccagtc- CRISPR spacer
tgtgtcgaagcgcaccttgcagccg-tcgagtgc Protospacer
.****************.*.***** * ***
2121. spacer 2.2|4471477|33|NZ_CP028176|PILER-CR,CRT matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.788
cgtgtcgaagcgcacctcgtagccgagccagtc- CRISPR spacer
tgtgtcgaagcgcaccttgcagccg-tcgagtgc Protospacer
.****************.*.***** * ***
2122. spacer 2.2|4471477|33|NZ_CP028176|PILER-CR,CRT matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.788
cgtgtcgaagcgcacctcgtagccgagccagtc- CRISPR spacer
tgtgtcgaagcgcaccttgcagccg-tcgagtgc Protospacer
.****************.*.***** * ***
2123. spacer 2.2|4471477|33|NZ_CP028176|PILER-CR,CRT matches to NZ_CP026110 (Paraburkholderia hospita strain DSM 17164 plasmid pEMT1, complete sequence) position: , mismatch: 7, identity: 0.788
cgtgtcgaagcgcacctcgtagccgagccagtc- CRISPR spacer
tgtgtcgaagcgcaccttgcagccg-tcgagtgc Protospacer
.****************.*.***** * ***
2124. spacer 2.4|4471599|33|NZ_CP028176|PILER-CR,CRT matches to NC_030917 (Gordonia phage OneUp, complete genome) position: , mismatch: 7, identity: 0.788
tccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
cctcgccgtcgtaggcctcggtgatgtcctcgg Protospacer
.*. *.******** *******.*********.
2125. spacer 2.8|4471478|32|NZ_CP028176|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.781
---gtgtcgaagcgcacctcgtagccgagccagtc CRISPR spacer
tccgtctt---gcgcgcctcgtagccgatccagtc Protospacer
** *. ****.************ ******
2126. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to NC_048169 (Gordonia phage BrutonGaster, complete genome) position: , mismatch: 7, identity: 0.781
ccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
ctcgccctcgtaggcctcggtgatgtcctcgg Protospacer
*. *.* ****** *******.*********.
2127. spacer 2.13|4471783|33|NZ_CP028176|CRISPRCasFinder matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 7, identity: 0.788
acctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
tccgatcggcgtccgcgccagggcaatcacgac Protospacer
** .******************.******
2128. spacer 2.16|4471782|34|NZ_CP028176|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 7, identity: 0.794
tacctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
ttccgatcggcgtccgcgccagggcaatcacgac Protospacer
* ** .******************.******
2129. spacer 3.2|4480808|33|NZ_CP028176|PILER-CR matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
tgacggacataccgcgctgcccggtctgcggca CRISPR spacer
cgccggacataccgcgccgcccggtcttgcgct Protospacer
.* **************.********* **
2130. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcatggcccgatctcggcgccgccggtggc CRISPR spacer
aacaaattg-ccgatctcggcgccgtgggtggc Protospacer
*. ** * ***************. ******
2131. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcatggc----ccgatctcggcgccgccggtggc CRISPR spacer
----aaggcttttccgatctcggcgccggtggtggc Protospacer
* *** *************** .******
2132. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcatggcccgatctcggcgccgccggtggc CRISPR spacer
aacaaattg-ccgatctcggcgccgtgggtggc Protospacer
*. ** * ***************. ******
2133. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MT639643 (Microbacterium phage FreddieHg, complete genome) position: , mismatch: 7, identity: 0.781
--tcgcatggcccgatctcggcgccgccggtggc CRISPR spacer
agcgccatg--ccgatctcggagacgccggtggc Protospacer
. **** ********** * **********
2134. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MH825699 (Streptomyces phage Darolandstone, complete genome) position: , mismatch: 7, identity: 0.781
tcgcatggc--ccgatctcggcgccgccggtggc CRISPR spacer
--gggtcgccgccggtctcgccgccgccggtggc Protospacer
* .* ** ***.***** *************
2135. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MK737941 (Microbacterium phage Rachella, complete genome) position: , mismatch: 7, identity: 0.781
--tcgcatggcccgatctcggcgccgccggtggc CRISPR spacer
agcgccatg--ccgatctcggagacgccggtggc Protospacer
. **** ********** * **********
2136. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MK801732 (Microbacterium phage NarutoRun, complete genome) position: , mismatch: 7, identity: 0.781
--tcgcatggcccgatctcggcgccgccggtggc CRISPR spacer
agcgccatg--ccgatctcggagacgccggtggc Protospacer
. **** ********** * **********
2137. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_047986 (Microbacterium phage Krampus, complete genome) position: , mismatch: 7, identity: 0.781
--tcgcatggcccgatctcggcgccgccggtggc CRISPR spacer
agcgccatg--ccgatctcggagacgccggtggc Protospacer
. **** ********** * **********
2138. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MK801731 (Microbacterium phage Anakin, complete genome) position: , mismatch: 7, identity: 0.781
--tcgcatggcccgatctcggcgccgccggtggc CRISPR spacer
agcgccatg--ccgatctcggagacgccggtggc Protospacer
. **** ********** * **********
2139. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MN497954 (Microbacterium phage Hiddenleaf, complete genome) position: , mismatch: 7, identity: 0.781
--tcgcatggcccgatctcggcgccgccggtggc CRISPR spacer
agcgccatg--ccgatctcggagacgccggtggc Protospacer
. **** ********** * **********
2140. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MH271292 (Microbacterium phage AnnaSerena, complete genome) position: , mismatch: 7, identity: 0.781
--tcgcatggcccgatctcggcgccgccggtggc CRISPR spacer
agcgccatg--ccgatctcggagacgccggtggc Protospacer
. **** ********** * **********
2141. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MT684591 (Microbacterium phage Chivey, complete genome) position: , mismatch: 7, identity: 0.781
--tcgcatggcccgatctcggcgccgccggtggc CRISPR spacer
agcgccatg--ccgatctcggagacgccggtggc Protospacer
. **** ********** * **********
2142. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to MT684592 (Microbacterium phage Aesir, complete genome) position: , mismatch: 7, identity: 0.781
--tcgcatggcccgatctcggcgccgccggtggc CRISPR spacer
agcgccatg--ccgatctcggagacgccggtggc Protospacer
. **** ********** * **********
2143. spacer 2.4|4471599|33|NZ_CP028176|PILER-CR,CRT matches to NC_048169 (Gordonia phage BrutonGaster, complete genome) position: , mismatch: 8, identity: 0.758
tccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
cctcgccctcgtaggcctcggtgatgtcctcgg Protospacer
.*. *.* ****** *******.*********.
2144. spacer 2.8|4471478|32|NZ_CP028176|CRISPRCasFinder matches to MT684587 (Microbacterium phage Fede, complete genome) position: , mismatch: 8, identity: 0.75
gtgtcgaagcgcacctcgtagccgagccagtc CRISPR spacer
ttgtcgatgcggacctcgtagccgaactgcac Protospacer
****** *** *************.*.. *
2145. spacer 2.8|4471478|32|NZ_CP028176|CRISPRCasFinder matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 8, identity: 0.75
gtgtcgaagcgcacctcgtagccgagccagtc CRISPR spacer
agctcgacgcgcacctcgaagccgaggtagac Protospacer
. **** ********** ******* .** *
2146. spacer 2.8|4471478|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.75
-gtgtcgaagcgcacctcgtagccgagccagtc CRISPR spacer
cgcgac-cagcgcacctcgtcgccgtgccagcg Protospacer
*.* * ************ **** *****.
2147. spacer 2.8|4471478|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 8, identity: 0.75
gtgtcgaagcgcacctcgtagccgagccagtc--- CRISPR spacer
ttgtcgaagcgcacctcgacgccg---caattctg Protospacer
***************** **** **.*.
2148. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to KT373978 (Mycobacterium phage Ukulele, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2149. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MF668277 (Mycobacterium phage MadamMonkfish, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2150. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MK433262 (Mycobacterium phage Nimrod, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2151. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MG872843 (Mycobacterium phage Sotrice96, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2152. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MH651174 (Mycobacterium phage Easy2Say, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2153. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MH000607 (Mycobacterium phage RiverMonster, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2154. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MT723943 (Mycobacterium phage Cactus, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2155. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MT114165 (Mycobacterium phage BadStone, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2156. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MG872831 (Mycobacterium phage Asriel, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2157. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MK757445 (Mycobacterium phage Lilizi, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2158. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MH576953 (Mycobacterium phage Hopey, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2159. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to KX834009 (Mycobacterium phage Goldilocks, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2160. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MG099953 (Mycobacterium phage Youngblood, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2161. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MF919506 (Mycobacterium phage FireRed, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2162. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to AY129331 (Mycobacterium virus Cjw1, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2163. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MN586043 (Mycobacterium phage Buck, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2164. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MH536829 (Mycobacterium phage TBrady12, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2165. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MN096364 (Mycobacterium phage Tomaszewski, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2166. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MH590587 (Mycobacterium phage xkcd, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2167. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MH371112 (Mycobacterium phage Adnama, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2168. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to KX611831 (Mycobacterium phage Pharsalus, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2169. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to NC_042027 (Mycobacterium phage Pumpkin, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2170. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to KF493883 (Mycobacterium phage Mosby, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2171. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MH513978 (Mycobacterium phage Phaja, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2172. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MN428059 (Mycobacterium phage Kanye, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2173. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to KY549152 (Mycobacterium phage Maxxinista, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2174. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MH399778 (Mycobacterium phage Icee, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2175. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MF919529 (Mycobacterium phage Sassay, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2176. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MH513972 (Mycobacterium phage IHOP, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2177. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MN586051 (Mycobacterium phage Myrale, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2178. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MK359309 (Mycobacterium phage Czyszczon1, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2179. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to KU865303 (Mycobacterium phage TeardropMSU, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2180. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MN586041 (Mycobacterium phage Elite2014, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2181. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MF919524 (Mycobacterium phage MISSy, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2182. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to EU816588 (Mycobacterium phage Porky, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2183. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MT952854 (Mycobacterium phage Miniwave, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2184. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2185. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MH536827 (Mycobacterium phage Simpliphy, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2186. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MH669002 (Mycobacterium phage Emmina, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2187. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MN586035 (Mycobacterium phage ChosenOne, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2188. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to KR080204 (Mycobacterium phage Mindy, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2189. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to DQ398041 (Mycobacterium virus 244, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2190. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MG872832 (Mycobacterium phage Barbarian, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2191. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to NC_029079 (Mycobacterium phage Dusk, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2192. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MN586032 (Mycobacterium phage Command613, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2193. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to KC661277 (Mycobacterium phage Phrux, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2194. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to JF937096 (Mycobacterium phage Henry, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2195. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to NC_022065 (Mycobacterium phage Contagion, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2196. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to KX817173 (Mycobacterium phage Tuco, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2197. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2198. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MG757160 (Mycobacterium phage Kimchi, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2199. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MN096361 (Mycobacterium phage Gator, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2200. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MN586013 (Mycobacterium phage Traaww1, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2201. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MH020247 (Mycobacterium phage MPhalcon, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2202. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to JN391441 (Mycobacterium phage Elph10, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2203. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to KF306380 (Mycobacterium phage DrDrey, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2204. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MH576956 (Mycobacterium phage Inca, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2205. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MK620893 (Mycobacterium phage HanKaySha, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2206. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MH779503 (Mycobacterium phage Gemini, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2207. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to NC_022969 (Mycobacterium phage PhatBacter, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2208. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MN586019 (Mycobacterium phage Stark, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2209. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MN586050 (Mycobacterium phage Lilpickle, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2210. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to NC_041850 (Mycobacterium phage Eureka, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2211. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to KF562099 (Mycobacterium phage Bruin, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2212. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MK016491 (Mycobacterium phage BaboJay, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2213. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to NC_028906 (Mycobacterium phage Toto, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2214. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to KY319168 (Mycobacterium phage CrystalP, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2215. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2216. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to NC_008194 (Mycobacterium phage 244, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2217. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to JF937091 (Mycobacterium phage Bask21, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2218. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to KF188414 (Mycobacterium phage ABCat, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2219. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to JN006062 (Mycobacterium phage Rakim, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2220. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MK801726 (Mycobacterium phage ChotaBhai, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2221. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MH727557 (Mycobacterium phage Paperbeatsrock, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2222. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to KF279417 (Mycobacterium phage Quink, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2223. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MH399774 (Mycobacterium phage DoctorDiddles, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2224. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to NC_028785 (Mycobacterium phage NelitzaMV, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2225. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MN586044 (Mycobacterium phage Rimmer, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2226. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MN586017 (Mycobacterium phage OrionPax, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2227. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to KT020852 (Mycobacterium phage NoSleep, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2228. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MK559429 (Mycobacterium phage Moldemort, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2229. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MF919535 (Mycobacterium phage Terminus, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2230. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to NC_022976 (Mycobacterium phage Nala, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2231. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to NC_021305 (Mycobacterium phage Murphy, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2232. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MT522005 (Mycobacterium phage Misfit, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2233. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MN586037 (Mycobacterium phage GooberAzure, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2234. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to KC691255 (Mycobacterium phage Dumbo, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2235. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to EU816591 (Mycobacterium phage Kostya, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2236. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MN586034 (Mycobacterium phage Hoonter, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2237. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to NC_022085 (Mycobacterium phage Goku, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2238. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to NC_004681 (Mycobacterium phage Cjw1, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2239. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to MH513983 (Mycobacterium phage ShereKhan, complete genome) position: , mismatch: 8, identity: 0.75
ccagtcgt--cgtagtcctcggtaatgtcctcga CRISPR spacer
--ggccgcaacgtagtcctctgcaatgtcctcgc Protospacer
.*.**. ********** *.**********
2240. spacer 3.7|4481113|33|NZ_CP028176|PILER-CR matches to NC_048198 (Erwinia phage vB_EhrS_59, complete genome) position: , mismatch: 8, identity: 0.758
tgtcgtcac-atagtgctctatccactggttagc CRISPR spacer
-gcagccctgatagtgctcgatccaccggttagc Protospacer
*. *.* . ********* ******.*******
2241. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP044217 (Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcatggcccgatctcggcgccgccggtggc CRISPR spacer
aggaagcggccgatctcggcgtcgccgttggc Protospacer
* * * ************.***** ****
2242. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcatggcccgatctcggcgccgccggtggc CRISPR spacer
ttgaagcgcacgatctcggcgccgacggtgaa Protospacer
*.* * ** ************** *****.
2243. spacer 3.12|4480809|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gacggacataccgcgctgcccggtctgcggca CRISPR spacer
gacaccaataccgcgctgcccgcactgcggtg Protospacer
***. *************** ******..
2244. spacer 2.2|4471477|33|NZ_CP028176|PILER-CR,CRT matches to MT684587 (Microbacterium phage Fede, complete genome) position: , mismatch: 9, identity: 0.727
cgtgtcgaagcgcacctcgtagccgagccagtc CRISPR spacer
gttgtcgatgcggacctcgtagccgaactgcac Protospacer
****** *** *************.*.. *
2245. spacer 2.8|4471478|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 9, identity: 0.719
gtgtcgaagcgcacctcgtagccgagccagtc CRISPR spacer
cacgcgcagcgcacctcgcagccgagcacggc Protospacer
** ***********.******** * *
2246. spacer 2.8|4471478|32|NZ_CP028176|CRISPRCasFinder matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 9, identity: 0.719
gtgtcgaagcgcacctcgtagccgagccagtc CRISPR spacer
aagtcgaagcgcatctggtagccgaacacgct Protospacer
. ***********.** ********.* *..
2247. spacer 2.8|4471478|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
gtgtcgaagcgcacctcgtagccgagccagtc CRISPR spacer
aaggcgaagcgcggctcgtagccgagcaggcg Protospacer
. * ********. ************* .*.
2248. spacer 2.9|4471539|32|NZ_CP028176|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gtcatcagcgccttgttccagcggcgaccacc CRISPR spacer
gagataaccgccttgttccagcggcgcgcctt Protospacer
* ** * ****************** * ..
2249. spacer 2.10|4471600|32|NZ_CP028176|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 9, identity: 0.719
ccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
ggcgatgtcgtcgtcctcggtgatgtcctcct Protospacer
* .***** *********.********
2250. spacer 2.13|4471783|33|NZ_CP028176|CRISPRCasFinder matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 9, identity: 0.727
acctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca Protospacer
*..****** ******** ******** *..
2251. spacer 2.13|4471783|33|NZ_CP028176|CRISPRCasFinder matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 9, identity: 0.727
acctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca Protospacer
*..****** ******** ******** *..
2252. spacer 2.13|4471783|33|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.727
acctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca Protospacer
*..****** ******** ******** *..
2253. spacer 2.13|4471783|33|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.727
acctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca Protospacer
*..****** ******** ******** *..
2254. spacer 2.13|4471783|33|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.727
acctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca Protospacer
*..****** ******** ******** *..
2255. spacer 2.13|4471783|33|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.727
acctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca Protospacer
*..****** ******** ******** *..
2256. spacer 2.13|4471783|33|NZ_CP028176|CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.727
acctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca Protospacer
*..****** ******** ******** *..
2257. spacer 2.13|4471783|33|NZ_CP028176|CRISPRCasFinder matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.727
acctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca Protospacer
*..****** ******** ******** *..
2258. spacer 2.13|4471783|33|NZ_CP028176|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 9, identity: 0.727
acctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca Protospacer
*..****** ******** ******** *..
2259. spacer 2.13|4471783|33|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.727
acctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca Protospacer
*..****** ******** ******** *..
2260. spacer 2.13|4471783|33|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.727
acctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca Protospacer
*..****** ******** ******** *..
2261. spacer 2.13|4471783|33|NZ_CP028176|CRISPRCasFinder matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.727
acctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca Protospacer
*..****** ******** ******** *..
2262. spacer 2.13|4471783|33|NZ_CP028176|CRISPRCasFinder matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.727
acctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
cctccccggcttccgcgcccgggcgatccagca Protospacer
*..****** ******** ******** *..
2263. spacer 3.12|4480809|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_022590 (Brevibacterium sp. Ap13 plasmid pAP13, complete sequence) position: , mismatch: 9, identity: 0.719
gacggacataccgcgctgcccggtctgcggca CRISPR spacer
aagggacataccgcgcggcccgctctcgctta Protospacer
.* ************* ***** *** .*
2264. spacer 3.17|4481114|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_048198 (Erwinia phage vB_EhrS_59, complete genome) position: , mismatch: 9, identity: 0.719
gtcgtcacatagtgctctatccactggttagc CRISPR spacer
cagccctgatagtgctcgatccaccggttagc Protospacer
.* ********* ******.*******
2265. spacer 2.4|4471599|33|NZ_CP028176|PILER-CR,CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.697
tccagtcgtcgtagtcctcggtaatgtcctcga CRISPR spacer
aggcgatgtcgtcgtcctcggtgatgtcctcct Protospacer
* .***** *********.********
2266. spacer 2.9|4471539|32|NZ_CP028176|CRISPRCasFinder matches to NC_000914 (Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence) position: , mismatch: 10, identity: 0.688
gtcatcagcgccttgttccagcggcgaccacc CRISPR spacer
aaattttgcgtctagttccagcggcgaccagt Protospacer
. *. ***.** **************** .
2267. spacer 2.16|4471782|34|NZ_CP028176|CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 10, identity: 0.706
tacctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca Protospacer
. *..****** ******** ******** *..
2268. spacer 2.16|4471782|34|NZ_CP028176|CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.706
tacctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca Protospacer
. *..****** ******** ******** *..
2269. spacer 2.16|4471782|34|NZ_CP028176|CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.706
tacctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca Protospacer
. *..****** ******** ******** *..
2270. spacer 2.16|4471782|34|NZ_CP028176|CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 10, identity: 0.706
tacctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca Protospacer
. *..****** ******** ******** *..
2271. spacer 2.16|4471782|34|NZ_CP028176|CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.706
tacctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca Protospacer
. *..****** ******** ******** *..
2272. spacer 2.16|4471782|34|NZ_CP028176|CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 10, identity: 0.706
tacctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca Protospacer
. *..****** ******** ******** *..
2273. spacer 2.16|4471782|34|NZ_CP028176|CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.706
tacctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca Protospacer
. *..****** ******** ******** *..
2274. spacer 2.16|4471782|34|NZ_CP028176|CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.706
tacctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca Protospacer
. *..****** ******** ******** *..
2275. spacer 2.16|4471782|34|NZ_CP028176|CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.706
tacctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca Protospacer
. *..****** ******** ******** *..
2276. spacer 2.16|4471782|34|NZ_CP028176|CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.706
tacctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca Protospacer
. *..****** ******** ******** *..
2277. spacer 2.16|4471782|34|NZ_CP028176|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 10, identity: 0.706
tacctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca Protospacer
. *..****** ******** ******** *..
2278. spacer 2.16|4471782|34|NZ_CP028176|CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.706
tacctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca Protospacer
. *..****** ******** ******** *..
2279. spacer 2.16|4471782|34|NZ_CP028176|CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 10, identity: 0.706
tacctcccggcgtccgcgccagggcgatcacgtg CRISPR spacer
ccctccccggcttccgcgcccgggcgatccagca Protospacer
. *..****** ******** ******** *..
2280. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NZ_CP016458 (Blastomonas sp. RAC04 plasmid pBSY18_2, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcatggcccgatctcggcgccgccggtggc CRISPR spacer
cagtctgggccgatctgggcgccgccgggatg Protospacer
. *. *** ******* *********** .
2281. spacer 3.11|4480748|32|NZ_CP028176|CRISPRCasFinder,CRT matches to NC_021347 (Rhodococcus phage E3, complete genome) position: , mismatch: 11, identity: 0.656
tcgcatggcccgatctcggcgccgccggtggc CRISPR spacer
agctccagcccgatctcggcgctgccgttgcg Protospacer
. ..***************.**** **