Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP022578 Mycobacterium tuberculosis strain WC059 chromosome, complete genome 15 crisprs c2c9_V-U4,cas6,cas10,csm2gr11,csm3gr7,csa3,DEDDh,cas4,WYL,DinG,cas3 14 37 3 0

Results visualization

1. NZ_CP022578
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022578_1 431179-432326 TypeIII II-B,III-A
15 spacers
csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022578_2 1390476-1390617 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022578_3 1499614-1500609 Orphan NA
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022578_4 2711007-2711164 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022578_5 2856730-2856806 TypeV-U4 NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022578_6 3185943-3186039 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022578_7 3186120-3186390 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022578_8 3186660-3187001 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022578_9 3214234-3215281 Orphan NA
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022578_10 3848103-3848191 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022578_11 4009084-4010248 Orphan NA
14 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022578_12 4028963-4029395 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022578_13 4030151-4030830 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022578_14 4159135-4160403 Orphan NA
20 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022578_15 4199806-4199931 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP022578.1 3212192-3212215 0 1.0
NZ_CP022578_11 11.4|4009397|20|NZ_CP022578|CRT 4009397-4009416 20 NZ_CP022578.1 4010612-4010631 0 1.0
NZ_CP022578_11 11.5|4009460|41|NZ_CP022578|CRT 4009460-4009500 41 NZ_CP022578.1 4010675-4010715 0 1.0
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP022578.1 4010759-4010787 0 1.0
NZ_CP022578_11 11.8|4009685|35|NZ_CP022578|CRT 4009685-4009719 35 NZ_CP022578.1 4010294-4010328 0 1.0
NZ_CP022578_11 11.9|4009763|47|NZ_CP022578|CRT 4009763-4009809 47 NZ_CP022578.1 4010372-4010418 0 1.0
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP022578.1 4010462-4010487 0 1.0
NZ_CP022578_11 11.12|4010003|29|NZ_CP022578|CRT 4010003-4010031 29 NZ_CP022578.1 4010612-4010640 0 1.0
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP022578.1 4010684-4010715 0 1.0
NZ_CP022578_11 11.14|4010150|56|NZ_CP022578|CRT 4010150-4010205 56 NZ_CP022578.1 4010759-4010814 0 1.0
NZ_CP022578_3 3.3|1499755|21|NZ_CP022578|CRT 1499755-1499775 21 NZ_CP022578.1 1191147-1191167 1 0.952
NZ_CP022578_3 3.3|1499755|21|NZ_CP022578|CRT 1499755-1499775 21 NZ_CP022578.1 2056047-2056067 1 0.952
NZ_CP022578_8 8.1|3186684|21|NZ_CP022578|CRISPRCasFinder 3186684-3186704 21 NZ_CP022578.1 3416532-3416552 1 0.952
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP022578.1 1125030-1125053 1 0.958
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP022578.1 2707618-2707641 1 0.958
NZ_CP022578_11 11.11|4009922|38|NZ_CP022578|CRT 4009922-4009959 38 NZ_CP022578.1 4010531-4010568 1 0.974
NZ_CP022578_3 3.3|1499755|21|NZ_CP022578|CRT 1499755-1499775 21 NZ_CP022578.1 2056206-2056226 2 0.905
NZ_CP022578_3 3.3|1499755|21|NZ_CP022578|CRT 1499755-1499775 21 NZ_CP022578.1 2387116-2387136 2 0.905
NZ_CP022578_3 3.5|1499854|21|NZ_CP022578|CRT 1499854-1499874 21 NZ_CP022578.1 2457612-2457632 2 0.905
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP022578.1 1688317-1688340 2 0.917
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP022578.1 2621224-2621247 2 0.917

1. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to position: 3212192-3212215, mismatch: 0, identity: 1.0

caacgccgtgctgatcggcaacgg	CRISPR spacer
caacgccgtgctgatcggcaacgg	Protospacer
************************

2. spacer 11.4|4009397|20|NZ_CP022578|CRT matches to position: 4010612-4010631, mismatch: 0, identity: 1.0

ttgaagttggccccgccgct	CRISPR spacer
ttgaagttggccccgccgct	Protospacer
********************

3. spacer 11.5|4009460|41|NZ_CP022578|CRT matches to position: 4010675-4010715, mismatch: 0, identity: 1.0

gtgccgcctttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
gtgccgcctttgccggggtcgccggcgccggtgcctgcgtt	Protospacer
*****************************************

4. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to position: 4010759-4010787, mismatch: 0, identity: 1.0

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
gtgccgccgttgctgccgttgctgaagct	Protospacer
*****************************

5. spacer 11.8|4009685|35|NZ_CP022578|CRT matches to position: 4010294-4010328, mismatch: 0, identity: 1.0

gcaaagccgggctggccgcccaatccggaaccgct	CRISPR spacer
gcaaagccgggctggccgcccaatccggaaccgct	Protospacer
***********************************

6. spacer 11.9|4009763|47|NZ_CP022578|CRT matches to position: 4010372-4010418, mismatch: 0, identity: 1.0

atgcccgcgttgcctgcggtgccgccggtgttggctaggccgccggc	CRISPR spacer
atgcccgcgttgcctgcggtgccgccggtgttggctaggccgccggc	Protospacer
***********************************************

7. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to position: 4010462-4010487, mismatch: 0, identity: 1.0

gcggagtcgtcgccggccccgccggt	CRISPR spacer
gcggagtcgtcgccggccccgccggt	Protospacer
**************************

8. spacer 11.12|4010003|29|NZ_CP022578|CRT matches to position: 4010612-4010640, mismatch: 0, identity: 1.0

ttgaagttggccccgccgctaccgccggc	CRISPR spacer
ttgaagttggccccgccgctaccgccggc	Protospacer
*****************************

9. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to position: 4010684-4010715, mismatch: 0, identity: 1.0

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
ttgccggggtcgccggcgccggtgcctgcgtt	Protospacer
********************************

10. spacer 11.14|4010150|56|NZ_CP022578|CRT matches to position: 4010759-4010814, mismatch: 0, identity: 1.0

gtgccgccgttgctgccgttgctgaagctgatgccagcacccccggcgccgccttg	CRISPR spacer
gtgccgccgttgctgccgttgctgaagctgatgccagcacccccggcgccgccttg	Protospacer
********************************************************

11. spacer 3.3|1499755|21|NZ_CP022578|CRT matches to position: 1191147-1191167, mismatch: 1, identity: 0.952

gccggcgggctgctctacggc	CRISPR spacer
gccggcgggctgctgtacggc	Protospacer
************** ******

12. spacer 3.3|1499755|21|NZ_CP022578|CRT matches to position: 2056047-2056067, mismatch: 1, identity: 0.952

gccggcgggctgctctacggc	CRISPR spacer
gccggcgggctgctgtacggc	Protospacer
************** ******

13. spacer 8.1|3186684|21|NZ_CP022578|CRISPRCasFinder matches to position: 3416532-3416552, mismatch: 1, identity: 0.952

gttgccgaagaacccggcgtt	CRISPR spacer
gttgccgacgaacccggcgtt	Protospacer
******** ************

14. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to position: 1125030-1125053, mismatch: 1, identity: 0.958

caacgccgtgctgatcggcaacgg	CRISPR spacer
caacgccgtggtgatcggcaacgg	Protospacer
********** *************

15. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to position: 2707618-2707641, mismatch: 1, identity: 0.958

caacgccgtgctgatcggcaacgg	CRISPR spacer
cagcgccgtgctgatcggcaacgg	Protospacer
**.*********************

16. spacer 11.11|4009922|38|NZ_CP022578|CRT matches to position: 4010531-4010568, mismatch: 1, identity: 0.974

gtggcgctgctgagtccgtcggtgtttaggccgccgtt	CRISPR spacer
gtggcgctgctgagtccgtcggtgtttaggccgccttt	Protospacer
*********************************** **

17. spacer 3.3|1499755|21|NZ_CP022578|CRT matches to position: 2056206-2056226, mismatch: 2, identity: 0.905

gccggcgggctgctctacggc	CRISPR spacer
gccggcgggctgctgttcggc	Protospacer
************** * ****

18. spacer 3.3|1499755|21|NZ_CP022578|CRT matches to position: 2387116-2387136, mismatch: 2, identity: 0.905

gccggcgggctgctctacggc	CRISPR spacer
gccggcggcctggtctacggc	Protospacer
******** *** ********

19. spacer 3.5|1499854|21|NZ_CP022578|CRT matches to position: 2457612-2457632, mismatch: 2, identity: 0.905

aatggcgggctgctgttcggc	CRISPR spacer
aacggcgggctgctattcggc	Protospacer
**.***********.******

20. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to position: 1688317-1688340, mismatch: 2, identity: 0.917

caacgccgtgctgatcggcaacgg	CRISPR spacer
caacgccctgctgttcggcaacgg	Protospacer
******* ***** **********

21. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to position: 2621224-2621247, mismatch: 2, identity: 0.917

caacgccgtgctgatcggcaacgg	CRISPR spacer
caaggccgggctgatcggcaacgg	Protospacer
*** **** ***************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP022578_3 3.9|1500028|21|NZ_CP022578|CRT 1500028-1500048 21 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 60334-60354 1 0.952
NZ_CP022578_7 7.3|3186282|21|NZ_CP022578|CRISPRCasFinder 3186282-3186302 21 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 162990-163010 1 0.952
NZ_CP022578_7 7.3|3186282|21|NZ_CP022578|CRISPRCasFinder 3186282-3186302 21 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 334397-334417 1 0.952
NZ_CP022578_4 4.1|2711030|25|NZ_CP022578|CRT 2711030-2711054 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 622336-622360 2 0.92
NZ_CP022578_4 4.1|2711030|25|NZ_CP022578|CRT 2711030-2711054 25 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1218692-1218716 2 0.92
NZ_CP022578_4 4.1|2711030|25|NZ_CP022578|CRT 2711030-2711054 25 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 172932-172956 2 0.92
NZ_CP022578_4 4.1|2711030|25|NZ_CP022578|CRT 2711030-2711054 25 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1830573-1830597 2 0.92
NZ_CP022578_4 4.1|2711030|25|NZ_CP022578|CRT 2711030-2711054 25 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 275362-275386 2 0.92
NZ_CP022578_4 4.1|2711030|25|NZ_CP022578|CRT 2711030-2711054 25 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 213084-213108 2 0.92
NZ_CP022578_8 8.1|3186684|21|NZ_CP022578|CRISPRCasFinder 3186684-3186704 21 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 263134-263154 2 0.905
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP032327 Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence 121532-121555 2 0.917
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP007798 Azospirillum brasilense strain Az39 plasmid AbAZ39_p5, complete sequence 102694-102717 2 0.917
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP005087 Sphingobium sp. TKS plasmid pTK3, complete sequence 86260-86283 2 0.917
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 569399-569422 2 0.917
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP033323 Azospirillum brasilense strain Cd plasmid p5, complete sequence 157190-157213 2 0.917
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP033317 Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence 163705-163728 2 0.917
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2209494-2209517 2 0.917
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 247640-247663 2 0.917
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 1138142-1138165 2 0.917
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 195459-195482 2 0.917
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP014802 Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence 15605-15628 2 0.917
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 CU468217 Azospirillum brasilense bacteriophage Cd, complete genome 19538-19561 2 0.917
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NC_010355 Azospirillum phage Cd, complete genome 19538-19561 2 0.917
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_CP010862 Marinovum algicola DG 898 plasmid pMaD7 541-566 2 0.923
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_CP010862 Marinovum algicola DG 898 plasmid pMaD7 115037-115062 2 0.923
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NC_015727 Cupriavidus necator N-1 plasmid pBB1, complete sequence 1393349-1393371 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP025081 Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence 44810-44832 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP031258 Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence 176002-176024 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP011600 Phytobacter ursingii strain CAV1151 plasmid pCAV1151-215, complete sequence 136283-136305 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP011601 Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence 203450-203472 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP030924 Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence 167406-167428 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP014011 Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence 170418-170440 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP037743 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence 43734-43756 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP052159 Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence 43738-43760 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP042506 Leclercia adecarboxylata strain E1 plasmid pE1_001, complete sequence 97842-97864 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP042507 Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence 20012-20034 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP033955 Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence 25318-25340 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MT077884 Escherichia coli plasmid p33, complete sequence 98619-98641 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MT077886 Escherichia coli plasmid p39, complete sequence 97842-97864 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP026170 Leclercia sp. LSNIH1 plasmid pLEC-000f, complete sequence 93378-93400 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP052432 Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence 43745-43767 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP052144 Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence 43738-43760 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP052363 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence 44821-44843 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MN423361 Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence 100130-100152 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP054602 Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed3, complete sequence 107000-107022 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MK347226 Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence 30579-30601 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MK347227 Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence 30578-30600 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MK347228 Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence 30560-30582 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MK347229 Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence 30483-30505 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MK347230 Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence 30571-30593 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MK347231 Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence 30481-30503 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MK347232 Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence 30574-30596 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MK347233 Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence 30479-30501 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MK347234 Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence 30576-30598 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MK347235 Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence 30494-30516 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MK347236 Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence 30476-30498 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MK347237 Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence 30481-30503 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MK347238 Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence 30571-30593 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP034776 Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence 95265-95287 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP052357 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence 43738-43760 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP014009 Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence 105020-105042 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MN310380 Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence 90018-90040 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP008825 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence 102106-102128 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP041374 Klebsiella pneumoniae strain KP58 plasmid pKP58-1, complete sequence 25318-25340 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP052232 Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence 43738-43760 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP040546 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence 49495-49517 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP044215 Klebsiella aerogenes strain KA_P10_L5_03.19 plasmid pIMPIncH12_334kb, complete sequence 131326-131348 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP030355 Novosphingobium sp. P6W plasmid pP6W2, complete sequence 134948-134970 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP036191 Klebsiella pneumoniae strain BA34918 plasmid pvirulence_VBA34918, complete sequence 135541-135563 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP052563 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence 43733-43755 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP042494 Leclercia adecarboxylata strain E61 plasmid pE61_001, complete sequence 97842-97864 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP042495 Leclercia adecarboxylata strain E61 plasmid pE61_002, complete sequence 19986-20008 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP040696 Citrobacter freundii strain R47 plasmid pR47-309, complete sequence 52890-52912 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_AP019666 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence 35068-35090 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP042552 Enterobacter hormaechei strain C45 plasmid pC45_001, complete sequence 97842-97864 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP016526 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence 28882-28904 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP035906 Klebsiella pneumoniae strain BA4656 plasmid unnamed1, complete sequence 70393-70415 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MF943217 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence 200679-200701 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP034416 Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence 45068-45090 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP052190 Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence 43738-43760 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP030270 Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence 43747-43769 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 176160-176182 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP040540 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence 30480-30502 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP045675 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence 48684-48706 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP026166 Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence 49139-49161 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP052304 Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence 45065-45087 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP052037 Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence 86243-86265 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP052204 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence 43738-43760 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP023135 Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence 178730-178752 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 237499-237521 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NC_012556 Enterobacter cloacae plasmid pEC-IMPQ, complete sequence 97842-97864 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NC_012555 Enterobacter cloacae plasmid pEC-IMP, complete sequence 97842-97864 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP042579 Enterobacter kobei strain C16 plasmid pC16_001, complete sequence 100158-100180 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP034124 Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence 25318-25340 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP052178 Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence 43739-43761 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP054751 Klebsiella pneumoniae strain KP20194c3 plasmid pKP20194c3-p1, complete sequence 25317-25339 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP054781 Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p1, complete sequence 25315-25337 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP028390 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence 43745-43767 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP032842 Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence 97842-97864 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP018338 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence 79589-79611 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP034083 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence 43741-43763 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP050281 Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence 36795-36817 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP054763 Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p1, complete sequence 25320-25342 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP026012 Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence 138756-138778 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP026024 Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence 174467-174489 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP042525 Citrobacter freundii strain E11 plasmid pE11_001, complete sequence 97842-97864 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP054745 Klebsiella pneumoniae strain KP20194c4 plasmid pKP20194c4-p1, complete sequence 25317-25339 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP054727 Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p1, complete sequence 25317-25339 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP054739 Klebsiella pneumoniae strain KP20194c5 plasmid pKP20194c5-p1, complete sequence 25318-25340 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP054775 Klebsiella pneumoniae strain KP20194a2 plasmid pKP20194a2-p1, complete sequence 25317-25339 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP054733 Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p1, complete sequence 25316-25338 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP054721 Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p1, complete sequence 25317-25339 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP054757 Klebsiella pneumoniae strain KP20194c plasmid pKP20194c-p1, complete sequence 25316-25338 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP054769 Klebsiella pneumoniae strain KP20194b plasmid pKP20194b-p1, complete sequence 25318-25340 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP022533 Enterobacter hormaechei strain MS7884A plasmid pMS7884A, complete sequence 329552-329574 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP041024 Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence 169697-169719 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP052317 Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-2, complete sequence 43738-43760 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP054064 Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence 41735-41757 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP029717 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed4, complete sequence 189620-189642 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP042489 Enterobacter hormaechei strain C15 plasmid pC15_001, complete sequence 96707-96729 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP052495 Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-1, complete sequence 43738-43760 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 227390-227412 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NC_017541 Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence 71058-71080 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP033103 Enterobacter hormaechei strain L51 plasmid pEHZJ1, complete sequence 103366-103388 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_MH263654 Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence 45068-45090 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_MF398271 Klebsiella pneumoniae subsp. pneumoniae strain 70-2 plasmid pKP70-2, complete sequence 43735-43757 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_MF344580 Enterobacter cloacae strain 30860 plasmid p30860-HI2, complete sequence 98908-98930 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_MH399264 Enterobacter cloacae strain RJ702 plasmid pIMP26, complete sequence 151606-151628 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_KY863418 Enterobacter asburiae strain AMA 497 plasmid pOXA436, complete sequence 98619-98641 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_KY978628 Cronobacter sakazakii strain 505108 plasmid p505108-MDR, complete sequence 99194-99216 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_MF788071 Raoultella ornithinolytica strain 23141 plasmid p23141-3, complete sequence 99072-99094 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP040534 Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-VIR, complete sequence 30480-30502 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MH727545 Mycobacterium phage DismalStressor, complete genome 31436-31458 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MN871473 UNVERIFIED: Pseudomonas virus Pa-Z, complete genome 34302-34324 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 KJ510412 Mycobacterium phage ZoeJ, complete genome 31097-31119 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NC_026598 Mycobacterium phage Milly, complete genome 31409-31431 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 AF068845 Mycobacteriophage TM4, complete genome 31079-31101 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MH834601 Mycobacterium phage BoostSeason, complete genome 31340-31362 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 KX688047 Mycobacterium phage Marcoliusprime, complete genome 31436-31458 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 KX171208 Pseudomonas phage vB_Pae436M-8, complete genome 39845-39867 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NC_028759 Mycobacterium phage Mufasa, complete genome 31330-31352 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MK318076 Pseudomonas phage vB_PaeM_fHoPae01, complete genome 46520-46542 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MF140408 Mycobacterium phage DismalFunk, complete genome 31436-31458 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NC_003387 Mycobacterium phage TM4, complete genome 31079-31101 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MT119369 Pseudomonas phage sortsol, complete genome 39163-39185 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_KX810825 Salmonella enterica subsp. enterica serovar Typhimurium strain MU1 plasmid pIMP4-SEM1, complete sequence 228718-228740 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP028197 Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence 26569-26591 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP052163 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence 135652-135674 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP026022 Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence 13203-13225 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MN200128 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence 152337-152359 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 152320-152342 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP048293 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence 164935-164957 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP019049 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence 70400-70422 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP020529 Enterobacter cloacae strain 174 plasmid unnamed1, complete sequence 35044-35066 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP024708 Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence 129894-129916 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_LR134257 Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence 16145-16167 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP031567 Enterobacter hormaechei strain 2013_1a plasmid pIncHI2-1301491, complete sequence 21993-22015 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP035380 Leclercia adecarboxylata strain R25 plasmid pLA-109, complete sequence 68028-68050 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 LR134211 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2 65988-66010 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NC_005249 Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence 155702-155724 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NC_008573 Shewanella sp. ANA-3 plasmid unnamed1, complete sequence 213321-213343 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP022696 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-1, complete sequence 242447-242469 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP052873 Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence 75515-75537 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP032241 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence 138375-138397 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_AP018757 Metakosakonia sp. MRY16-398 plasmid pMRY16-398_1, complete sequence 71908-71930 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NC_006625 Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence 85374-85396 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP026390 Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence 44008-44030 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP008899 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-8a4, complete sequence 185425-185447 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP047193 Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence 84048-84070 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP031575 Enterobacter hormaechei strain A1 plasmid pIncHI2-1502264, complete sequence 233367-233389 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP032164 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence 101277-101299 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP047678 Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVF1 plasmid unnamed, complete sequence 90058-90080 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP047676 Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVL1 plasmid unnamed, complete sequence 90058-90080 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP025983 Enterobacteriaceae bacterium A-F18 plasmid pAF18_1, complete sequence 101604-101626 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP013215 Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence 250724-250746 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP029383 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence 119413-119435 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_AP019549 Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence 164360-164382 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP050276 Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence 275726-275748 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 52613-52635 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP052259 Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-1, complete sequence 106040-106062 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP026587 Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence 51437-51459 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_LR745046 Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166 96984-97006 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_LR745043 Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154 115656-115678 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_MK715436 Klebsiella pneumoniae subsp. pneumoniae strain SCNJ1 plasmid pVir-SCNJ1, complete sequence 180751-180773 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_MN058044 Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence 140988-141010 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP016815 Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence 73197-73219 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP049047 Enterobacter hormaechei strain Y233 plasmid pIHI2-233, complete sequence 94082-94104 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_MG053312 Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence 67641-67663 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MT090958 Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence 40792-40814 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 MT118290 Pseudomonas phage Epa10, complete genome 14177-14199 2 0.913
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 KC787101 Mycobacterium phage 33D, partial genome 17312-17334 2 0.913
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 21024-21047 2 0.917
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 18854-18877 2 0.917
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1096444-1096467 2 0.917
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2202213-2202236 2 0.917
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 2280709-2280732 2 0.917
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 MT723937 Gordonia phage JKSyngboy, complete genome 20058-20084 3 0.889
NZ_CP022578_3 3.8|1499986|24|NZ_CP022578|CRT 1499986-1500009 24 NZ_CP014599 Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence 110878-110901 3 0.875
NZ_CP022578_3 3.8|1499986|24|NZ_CP022578|CRT 1499986-1500009 24 NZ_CP028945 Vibrio sp. dhg plasmid unnamed1, complete sequence 122425-122448 3 0.875
NZ_CP022578_4 4.1|2711030|25|NZ_CP022578|CRT 2711030-2711054 25 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 196683-196707 3 0.88
NZ_CP022578_4 4.1|2711030|25|NZ_CP022578|CRT 2711030-2711054 25 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 538429-538453 3 0.88
NZ_CP022578_4 4.1|2711030|25|NZ_CP022578|CRT 2711030-2711054 25 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 216008-216032 3 0.88
NZ_CP022578_9 9.12|3215059|24|NZ_CP022578|CRT 3215059-3215082 24 MN103533 Mycobacterium phage Weirdo19, complete genome 26904-26927 3 0.875
NZ_CP022578_9 9.13|3215104|24|NZ_CP022578|CRT 3215104-3215127 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1931013-1931036 3 0.875
NZ_CP022578_9 9.13|3215104|24|NZ_CP022578|CRT 3215104-3215127 24 MN428050 Mycobacterium phage Apex, complete genome 66856-66879 3 0.875
NZ_CP022578_9 9.13|3215104|24|NZ_CP022578|CRT 3215104-3215127 24 NC_042035 Mycobacterium phage Zemanar, complete sequence 66569-66592 3 0.875
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1088836-1088859 3 0.875
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 428271-428294 3 0.875
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NC_022061 Mycobacterium phage KayaCho, complete genome 54386-54409 3 0.875
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP019938 Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence 212659-212682 3 0.875
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 427938-427961 3 0.875
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1996033-1996056 3 0.875
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 985412-985435 3 0.875
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1058931-1058954 3 0.875
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 41184-41207 3 0.875
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP054618 Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence 373463-373486 3 0.875
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 MK415401 Phage apr34_1789, complete genome 11948-11971 3 0.875
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 MK415401 Phage apr34_1789, complete genome 39191-39214 3 0.875
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 MK415401 Phage apr34_1789, complete genome 66320-66343 3 0.875
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 56824-56849 3 0.885
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 360267-360289 3 0.87
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 CP049262 Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence 65353-65375 3 0.87
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 1056097-1056119 3 0.87
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP016024 Ralstonia insidiosa strain ATCC 49129 plasmid pRI-1, complete sequence 164245-164267 3 0.87
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 341625-341647 3 0.87
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 AP014203 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C76-MedDCM-OCT-S35-C25, *** SEQUENCING IN PROGRESS *** 14236-14258 3 0.87
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 887752-887774 3 0.87
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 KJ680225 Uncultured bacterium plasmid PLAsvaD clone PLAsvaD-1, complete sequence 11452-11474 3 0.87
NZ_CP022578_12 12.7|4029351|23|NZ_CP022578|CRT 4029351-4029373 23 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 1528049-1528071 3 0.87
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 35301-35324 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 291387-291410 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 325555-325578 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 655846-655869 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP044989 Deinococcus sp. AJ005 plasmid p380k, complete sequence 267879-267902 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1875698-1875721 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 346568-346591 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP026518 Deinococcus sp. NW-56 plasmid unnamed2, complete sequence 254516-254539 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP020897 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5a, complete sequence 246597-246620 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013524 Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence 327835-327858 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013553 Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence 325066-325089 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013586 Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence 339124-339147 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013559 Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence 335787-335810 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013576 Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence 336568-336591 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013548 Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence 336564-336587 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013528 Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence 334228-334251 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013533 Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence 336564-336587 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013538 Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence 329277-329300 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013543 Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence 340824-340847 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013564 Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence 325066-325089 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP021368 Acidovorax carolinensis strain P4 plasmid pACP4.2, complete sequence 148853-148876 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013581 Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence 334231-334254 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013570 Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence 336568-336591 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP021364 Acidovorax carolinensis strain P3 plasmid pACP3.2, complete sequence 11440-11463 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 21137-21160 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1301930-1301953 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1276369-1276392 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1369478-1369501 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 354438-354461 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1453767-1453790 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1456865-1456888 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 877468-877491 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 14409-14432 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 172006-172029 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 992654-992677 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 111819-111842 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 591834-591857 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 778719-778742 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 18093-18116 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 368858-368881 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1433221-1433244 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1206221-1206244 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1301937-1301960 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 CU468217 Azospirillum brasilense bacteriophage Cd, complete genome 56616-56639 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NC_010355 Azospirillum phage Cd, complete genome 56616-56639 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 1410926-1410949 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 222044-222067 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 427361-427384 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 1410904-1410927 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NC_007764 Rhizobium etli CFN 42 plasmid p42c, complete sequence 228267-228290 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 641369-641392 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP021026 Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence 258025-258048 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP020908 Rhizobium etli strain NXC12 plasmid pRetNXC12b, complete sequence 227510-227533 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 419355-419378 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 373597-373620 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 9852-9875 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013597 Rhizobium sp. N741 plasmid pRspN741b, complete sequence 292136-292159 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 422366-422389 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 416865-416888 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NC_021907 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1b, complete sequence 230035-230058 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013501 Rhizobium esperanzae strain N561 plasmid pRspN561a, complete sequence 292502-292525 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013507 Rhizobium sp. N1341 plasmid pRspN1341b, complete sequence 292136-292159 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013518 Rhizobium sp. N113 plasmid pRspN113a, complete sequence 292502-292525 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 164625-164648 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013491 Rhizobium sp. N6212 plasmid pRspN6212a, complete sequence 292505-292528 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013513 Rhizobium sp. N1314 plasmid pRspN1314b, complete sequence 313384-313407 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013496 Rhizobium sp. N621 plasmid pRspN621a, complete sequence 292505-292528 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013591 Rhizobium sp. N871 plasmid pRspN871a, complete sequence 292505-292528 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1083909-1083932 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 594657-594680 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 772752-772775 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 674210-674233 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 303720-303743 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1205658-1205681 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 568287-568310 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 216443-216466 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 437565-437588 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 447327-447350 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP033323 Azospirillum brasilense strain Cd plasmid p5, complete sequence 182486-182509 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 504090-504113 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP033317 Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence 189001-189024 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013603 Rhizobium sp. N731 plasmid pRspN731b, complete sequence 313384-313407 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 556202-556225 3 0.875
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1944556-1944579 3 0.875
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_LN831788 Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE1, complete sequence 37853-37879 3 0.889
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1404466-1404492 4 0.852
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 408796-408822 4 0.852
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 872965-872991 4 0.852
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 817736-817762 4 0.852
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 NZ_CP050100 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b3, complete sequence 134253-134279 4 0.852
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 NZ_CP009439 Streptomyces glaucescens strain GLA.O plasmid pSglau1, complete sequence 64506-64532 4 0.852
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 448572-448598 4 0.852
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 NZ_CP020371 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence 351850-351876 4 0.852
NZ_CP022578_4 4.1|2711030|25|NZ_CP022578|CRT 2711030-2711054 25 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 126145-126169 4 0.84
NZ_CP022578_4 4.1|2711030|25|NZ_CP022578|CRT 2711030-2711054 25 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 491307-491331 4 0.84
NZ_CP022578_4 4.1|2711030|25|NZ_CP022578|CRT 2711030-2711054 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 791148-791172 4 0.84
NZ_CP022578_4 4.1|2711030|25|NZ_CP022578|CRT 2711030-2711054 25 MH338239 Mycobacterium phage Mryolo, complete genome 49970-49994 4 0.84
NZ_CP022578_4 4.1|2711030|25|NZ_CP022578|CRT 2711030-2711054 25 MK305893 Mycobacterium phage Beatrix, complete genome 51771-51795 4 0.84
NZ_CP022578_4 4.1|2711030|25|NZ_CP022578|CRT 2711030-2711054 25 MN617845 Mycobacterium phage BaconJack, complete genome 53260-53284 4 0.84
NZ_CP022578_4 4.1|2711030|25|NZ_CP022578|CRT 2711030-2711054 25 MK359312 Mycobacterium phage Fushigi, complete genome 49866-49890 4 0.84
NZ_CP022578_9 9.11|3215011|27|NZ_CP022578|CRT 3215011-3215037 27 NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence 57662-57688 4 0.852
NZ_CP022578_9 9.13|3215104|24|NZ_CP022578|CRT 3215104-3215127 24 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 253003-253026 4 0.833
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP033583 Streptomyces sp. ADI95-16 plasmid pADI95-16b, complete sequence 153566-153589 4 0.833
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 2430241-2430264 4 0.833
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 2216018-2216041 4 0.833
NZ_CP022578_9 9.15|3215198|24|NZ_CP022578|CRT 3215198-3215221 24 NZ_CP041162 Leisingera aquaemixtae strain R2C4 plasmid unnamed6 26010-26033 4 0.833
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_DQ996271 Burkholderia glumae BGR1 plasmid pBGF3, complete sequence 15025-15050 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 493185-493210 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 65645-65670 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_CP026546 Cupriavidus metallidurans strain Ni-2 plasmid unnamed2 51548-51573 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 904666-904691 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 1012698-1012723 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 839293-839318 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 274169-274194 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 833395-833420 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 KT281796 Mycobacterium phage Zakhe101, complete genome 31092-31117 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 AY129335 Mycobacterium virus Corndog, complete genome 32037-32062 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 MK493325 Synechococcus phage S-RIM8 isolate RW_62_0316, complete genome 126816-126841 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 MK493322 Synechococcus phage S-RIM8 isolate RW_01_0115_WH8101, complete genome 126232-126257 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 KX349288 Synechococcus phage S-RIM8 isolate RW_08_0711, complete genome 126232-126257 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 MN428058 Mycobacterium phage Krili, complete genome 30504-30529 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 KX349286 Synechococcus phage S-RIM8 isolate RW_03_0807_WH8101, complete genome 126434-126459 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NC_004685 Mycobacterium phage Corndog, complete genome 32037-32062 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 JN698993 Mycobacterium phage Firecracker, complete genome 31190-31215 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 MK493324 Synechococcus phage S-RIM8 isolate RW_22_0214, complete genome 126230-126255 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 KX349290 Synechococcus phage S-RIM8 isolate RW_25_1112, complete genome 126816-126841 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 KX349287 Synechococcus phage S-RIM8 isolate RW_06_0613, complete genome 126816-126841 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 MN585964 Mycobacterium phage Blessica, complete genome 31307-31332 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NC_022057 Mycobacterium phage Catdawg, complete genome 30996-31021 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 MT818425 Mycobacterium phage NiebruSaylor, complete genome 30376-30401 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NC_022325 Mycobacterium phage Dylan, complete genome 31088-31113 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 MN428052 Mycobacterium phage Smooch, complete genome 32708-32733 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 858391-858416 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 857911-857936 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_AP022578 Mycolicibacterium aubagnense strain JCM 15296 plasmid pJCM15296, complete sequence 91147-91172 4 0.846
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NC_017590 Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence 129492-129517 4 0.846
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032344 Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence 72560-72585 4 0.846
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 91819-91844 4 0.846
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 380346-380371 4 0.846
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 373437-373462 4 0.846
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 583543-583568 4 0.846
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 591013-591038 4 0.846
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 1599-1624 4 0.846
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 636379-636404 4 0.846
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 164455-164480 4 0.846
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP033323 Azospirillum brasilense strain Cd plasmid p5, complete sequence 70165-70190 4 0.846
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP033317 Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence 128382-128407 4 0.846
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP012919 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence 110886-110911 4 0.846
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP015441 Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence 172126-172151 4 0.846
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_LR134447 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence 87110-87135 4 0.846
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 282142-282167 4 0.846
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 62657-62682 4 0.846
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 389742-389773 4 0.875
NZ_CP022578_13 13.6|4030672|28|NZ_CP022578|CRT 4030672-4030699 28 NC_008712 Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence 304571-304598 4 0.857
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP035418 Leisingera sp. NJS204 plasmid unnamed1, complete sequence 36671-36694 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP038237 Leisingera sp. NJS201 plasmid unnamed3, complete sequence 98992-99015 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 449137-449160 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1451692-1451715 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 387125-387148 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1744538-1744561 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 LR134132 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12 10708-10731 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 504872-504895 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 413337-413360 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 17298-17321 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 456993-457016 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 267198-267221 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 18955-18978 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 395965-395988 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 195123-195146 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1363739-1363762 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP054618 Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence 209300-209323 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 574427-574450 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP041043 Paracoccus sp. AK26 plasmid pAK3, complete sequence 26178-26201 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1043767-1043790 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP024583 Roseomonas sp. FDAARGOS_362 plasmid unnamed2, complete sequence 120240-120263 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 41515-41538 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 47178-47201 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1043871-1043894 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP022191 Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence 368523-368546 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 43405-43428 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 43405-43428 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 43405-43428 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 122685-122708 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 43405-43428 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 392596-392619 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 409631-409654 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 MK494131 Mycobacterium phage GodPhather, complete genome 23250-23273 4 0.833
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 MH001450 Mycobacterium phage Jeon, complete genome 22992-23015 4 0.833
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 33469-33495 4 0.852
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 110878-110904 4 0.852
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 239569-239595 4 0.852
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 MN586047 Gordonia phage EMoore, complete genome 40681-40707 4 0.852
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 161496-161522 4 0.852
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_LR594663 Variovorax sp. RA8 plasmid 2 378846-378872 4 0.852
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 470375-470401 4 0.852
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 63908-63934 4 0.852
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP024940 Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence 661184-661210 4 0.852
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 MN657133 Cryobacterium sp. strain ANT_H10B plasmid pA10BH1, complete sequence 14846-14872 5 0.815
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 151977-152003 5 0.815
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 44267-44293 5 0.815
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 MK937603 Gordonia phage Bakery, complete genome 37715-37741 5 0.815
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 KM389402 UNVERIFIED: Pseudomonas phage F_HA1961sp/Pa1641 clone contig00002 genomic sequence 1379-1405 5 0.815
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 NC_003278 Pseudomonas phage phiCTX, complete genome 20233-20259 5 0.815
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 Y13918 Pseudomonas aeruginosa phage phi CTX DNA, complete genome 20233-20259 5 0.815
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 AB008550 Pseudomonas phage phiCTX DNA, complete genome 20233-20259 5 0.815
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 MK034952 Pseudomonas phage Dobby, complete genome 21003-21029 5 0.815
NZ_CP022578_3 3.7|1499938|30|NZ_CP022578|CRT 1499938-1499967 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1425504-1425533 5 0.833
NZ_CP022578_3 3.7|1499938|30|NZ_CP022578|CRT 1499938-1499967 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1378155-1378184 5 0.833
NZ_CP022578_9 9.11|3215011|27|NZ_CP022578|CRT 3215011-3215037 27 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 475069-475095 5 0.815
NZ_CP022578_9 9.14|3215149|28|NZ_CP022578|CRT 3215149-3215176 28 NZ_CP011276 Planctomyces sp. SH-PL62 plasmid pPL62-3, complete sequence 45340-45367 5 0.821
NZ_CP022578_9 9.14|3215149|28|NZ_CP022578|CRT 3215149-3215176 28 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 180588-180615 5 0.821
NZ_CP022578_9 9.14|3215149|28|NZ_CP022578|CRT 3215149-3215176 28 CP048434 Collinsella aerofaciens ATCC 25986 strain JCM 10188 plasmid putative_pCaero1, complete sequence 1248-1275 5 0.821
NZ_CP022578_9 9.14|3215149|28|NZ_CP022578|CRT 3215149-3215176 28 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 547608-547635 5 0.821
NZ_CP022578_9 9.14|3215149|28|NZ_CP022578|CRT 3215149-3215176 28 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 46144-46171 5 0.821
NZ_CP022578_9 9.14|3215149|28|NZ_CP022578|CRT 3215149-3215176 28 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 293491-293518 5 0.821
NZ_CP022578_9 9.14|3215149|28|NZ_CP022578|CRT 3215149-3215176 28 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 1836376-1836403 5 0.821
NZ_CP022578_9 9.14|3215149|28|NZ_CP022578|CRT 3215149-3215176 28 JN698994 Mycobacterium phage DS6A, complete genome 26497-26524 5 0.821
NZ_CP022578_11 11.1|4009127|29|NZ_CP022578|CRT 4009127-4009155 29 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 794861-794889 5 0.828
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 622905-622933 5 0.828
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 366233-366261 5 0.828
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350096-350124 5 0.828
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP022195 Yangia pacifica strain YSBP01 plasmid unnamed5, complete sequence 107935-107963 5 0.828
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 1246783-1246811 5 0.828
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1098549-1098577 5 0.828
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 806571-806596 5 0.808
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 450243-450268 5 0.808
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 454769-454794 5 0.808
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 453978-454003 5 0.808
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 364700-364725 5 0.808
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1448373-1448398 5 0.808
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 19670-19695 5 0.808
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 MT855965 Microcystis phage vB_MaeS-yong1, complete genome 36712-36737 5 0.808
NZ_CP022578_11 11.7|4009616|26|NZ_CP022578|CRT 4009616-4009641 26 MN585977 Mycobacterium phage Atcoo, complete genome 13801-13826 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 90829-90854 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 94051-94076 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 90196-90221 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 91954-91979 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 99406-99431 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 378246-378271 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 377376-377401 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 382104-382129 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 580909-580934 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 585397-585422 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 2589-2614 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 637369-637394 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 634147-634172 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 1464-1489 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 3222-3247 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 628792-628817 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 636244-636269 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 638002-638027 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 114567-114592 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 116667-116692 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 118425-118450 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1339243-1339268 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 206048-206073 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032676 Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence 76043-76068 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 941372-941397 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 109907-109932 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 598229-598254 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP014802 Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence 1547-1572 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 147207-147232 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP041042 Paracoccus sp. AK26 plasmid pAK4, complete sequence 65044-65069 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NC_019959 Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence 37871-37896 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_MN366361 Bacterium plasmid pALTS33, complete sequence 14146-14171 5 0.808
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 144699-144724 5 0.808
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 77729-77760 5 0.844
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 475336-475367 5 0.844
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 55536-55567 5 0.844
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 280084-280115 5 0.844
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 254573-254604 5 0.844
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 260674-260705 5 0.844
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 486394-486425 5 0.844
NZ_CP022578_13 13.6|4030672|28|NZ_CP022578|CRT 4030672-4030699 28 NC_034248 Rhizobium phage RHEph10, complete genome 882-909 5 0.821
NZ_CP022578_14 14.1|4159156|27|NZ_CP022578|CRT 4159156-4159182 27 MN583270 Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence 202881-202907 5 0.815
NZ_CP022578_14 14.1|4159156|27|NZ_CP022578|CRT 4159156-4159182 27 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 356185-356211 5 0.815
NZ_CP022578_14 14.1|4159156|27|NZ_CP022578|CRT 4159156-4159182 27 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 328577-328603 5 0.815
NZ_CP022578_14 14.6|4159450|27|NZ_CP022578|CRT 4159450-4159476 27 NZ_CP030128 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence 347008-347034 5 0.815
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP041156 Leisingera aquaemixtae strain R2C4 plasmid unnamed1, complete sequence 134619-134642 5 0.792
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP016620 Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence 403908-403931 5 0.792
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP016617 Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence 29587-29610 5 0.792
NZ_CP022578_14 14.7|4159498|24|NZ_CP022578|CRT 4159498-4159521 24 NZ_CP016619 Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence 268829-268852 5 0.792
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 2099-2125 5 0.815
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 2099-2125 5 0.815
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MK359320 Mycobacterium phage Cookies, complete genome 58413-58439 5 0.815
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 KX611831 Mycobacterium phage Pharsalus, complete genome 58834-58860 5 0.815
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 NC_041844 Mycobacterium phage Optimus, complete genome 77610-77636 5 0.815
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MK967379 Mycobacterium phage HokkenD, complete genome 80092-80118 5 0.815
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MH230878 Mycobacterium phage Oogway, complete genome 40771-40797 5 0.815
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MN585999 Mycobacterium phage Briton15, complete genome 41723-41749 5 0.815
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MG962370 Mycobacterium phage Kykar, complete genome 40271-40297 5 0.815
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MH576975 Mycobacterium phage Target, complete genome 39125-39151 5 0.815
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MK359331 Mycobacterium phage Rajelicia, complete genome 41672-41698 5 0.815
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MH744414 Mycobacterium phage Arcanine, complete genome 41138-41164 5 0.815
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 KF493880 Mycobacterium phage HanShotFirst, complete genome 41672-41698 5 0.815
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 JF937103 Mycobacterium virus Museum, complete genome 41210-41236 5 0.815
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MH576971 Mycobacterium phage Arlo, complete genome 39521-39547 5 0.815
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MH697575 Mycobacterium phage Adahisdi, complete genome 41184-41210 5 0.815
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 KJ409696 Mycobacterium phage Lamina13, complete genome 41059-41085 5 0.815
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 NC_028784 Mycobacterium phage Tasp14, complete genome 41683-41709 5 0.815
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 KT259047 Mycobacterium phage Rufus, complete genome 40308-40334 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 207153-207179 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 994943-994969 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP024424 Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence 212744-212770 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP020440 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence 94785-94811 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 585833-585859 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 317095-317121 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 635-661 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 247982-248008 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP044082 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence 227894-227920 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 119527-119553 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 181599-181625 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 506639-506665 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP042276 Agrobacterium tumefaciens strain 186 plasmid pAt, complete sequence 278724-278750 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_LR134461 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence 90925-90951 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_007491 Rhodococcus erythropolis PR4 plasmid pREL1, complete sequence 169292-169318 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 131132-131158 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 99679-99705 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 100069-100095 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP011297 Rhodococcus erythropolis strain BG43 plasmid pRLLBG43, complete sequence 184399-184425 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1021631-1021657 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP017304 Rhodococcus sp. YL-1 plasmid pYLL2 sequence 153165-153191 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_005073 Rhodococcus erythropolis linear plasmid pBD2, complete sequence 91758-91784 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP016820 Rhodococcus sp. p52 plasmid pDF02, complete sequence 159620-159646 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP042915 Rhodococcus qingshengii strain RL1 plasmid unnamed2 439701-439727 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP042915 Rhodococcus qingshengii strain RL1 plasmid unnamed2 93748-93774 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP042915 Rhodococcus qingshengii strain RL1 plasmid unnamed2 252263-252289 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 38778-38804 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP015203 Rhodococcus sp. 008 plasmid pR8L1, complete sequence 126191-126217 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 286156-286182 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 CP000385 Mycobacterium sp. MCS Plasmid1, complete sequence 68541-68567 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP044283 Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence 99012-99038 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP044283 Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence 396755-396781 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 975997-976023 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 39259-39285 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP046100 Rhodococcus sp. AQ5-07 plasmid unnamed1, complete sequence 42420-42446 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 951354-951380 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 975997-976023 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 129884-129910 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 333630-333656 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP017300 Rhodococcus sp. YL-1 plasmid pYLC1, complete sequence 273293-273319 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP017303 Rhodococcus sp. YL-1 plasmid pYLL1 sequence 224386-224412 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP021373 Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence 7080-7106 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 546501-546527 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP050125 Rhodococcus erythropolis strain KB1 plasmid plas1, complete sequence 123696-123722 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_008704 Mycobacterium sp. KMS plasmid pMKMS02, complete sequence 94600-94626 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 57775-57801 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 175596-175622 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP045549 Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence 29547-29573 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP034156 Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence 105961-105987 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP034156 Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence 426971-426997 5 0.815
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP032357 Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence 152523-152549 5 0.815
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 MN234199 Mycobacterium phage Ekdilam, complete genome 53598-53624 6 0.778
NZ_CP022578_3 3.6|1499893|27|NZ_CP022578|CRT 1499893-1499919 27 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 211346-211372 6 0.778
NZ_CP022578_3 3.7|1499938|30|NZ_CP022578|CRT 1499938-1499967 30 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 262130-262159 6 0.8
NZ_CP022578_3 3.7|1499938|30|NZ_CP022578|CRT 1499938-1499967 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1624787-1624816 6 0.8
NZ_CP022578_3 3.7|1499938|30|NZ_CP022578|CRT 1499938-1499967 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1624922-1624951 6 0.8
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 GQ141189 Bifidobacterium phage Bbif-1, complete sequence 38062-38092 6 0.806
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 88882-88911 6 0.8
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 4449-4478 6 0.8
NZ_CP022578_11 11.1|4009127|29|NZ_CP022578|CRT 4009127-4009155 29 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 529162-529190 6 0.793
NZ_CP022578_11 11.1|4009127|29|NZ_CP022578|CRT 4009127-4009155 29 MK305891 Streptomyces phage Gibson, complete genome 21789-21817 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 487068-487096 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 621642-621670 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP014799 Salipiger profundus strain JLT2016 plasmid pTPRO3, complete sequence 3172-3200 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 9795-9823 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 KC736071 Mycobacterium phage WIVsmall, complete genome 29696-29724 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350105-350133 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_012852 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence 338806-338834 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP048283 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence 53689-53717 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 174759-174787 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_031109 Gordonia phage Jumbo, complete genome 54641-54669 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK814754 Mycobacterium phage Sumter, complete genome 28142-28170 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK814754 Mycobacterium phage Sumter, complete genome 28640-28668 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MN369739 Mycobacterium phage Kenuha5, complete genome 22589-22617 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK494110 Mycobacterium phage SwagPigglett, complete genome 24954-24982 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH479919 Mycobacterium phage Moose, complete genome 28919-28947 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 KY012363 Mycobacterium phage Empress, complete genome 26300-26328 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK967397 Mycobacterium phage Mahavrat, complete genome 24815-24843 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH669010 Mycobacterium phage PHappiness, complete genome 24929-24957 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH669003 Mycobacterium phage Girr, complete genome 24926-24954 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MG925342 Mycobacterium phage Forsytheast, complete genome 28919-28947 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK359354 Mycobacterium phage PinkPlastic, complete genome 28500-28528 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH632118 Mycobacterium phage Zeeculate, complete genome 29465-29493 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MG872836 Mycobacterium phage Fajezeel, complete genome 29005-29033 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MN585999 Mycobacterium phage Briton15, complete genome 28984-29012 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MG872841 Mycobacterium phage Priscilla, complete genome 25144-25172 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH155865 Mycobacterium phage BobaPhett, complete genome 25107-25135 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MN585985 Mycobacterium phage Watermelon, complete genome 29572-29600 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 KY348865 Mycobacterium phage Bubbles123, complete genome 25541-25569 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MN428047 Mycobacterium phage Doomphist, complete genome 24963-24991 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH651169 Mycobacterium phage Burwell21, complete genome 25141-25169 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MG925344 Mycobacterium phage Ichabod, complete genome 28890-28918 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK359315 Mycobacterium phage MisterCuddles, complete genome 24926-24954 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH697581 Mycobacterium phage Crispicous1, complete genome 28240-28268 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK359299 Mycobacterium phage Petp2012, complete genome 29653-29681 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH371120 Mycobacterium phage OlympiaSaint, complete genome 25330-25358 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MF190168 Mycobacterium phage Spoonbill, complete genome 25141-25169 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MG925340 Mycobacterium phage Corvo, complete genome 29641-29669 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MT771340 Mycobacterium phage Jorgensen, complete genome 28477-28505 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MN735433 Mycobacterium phage Scottish, complete genome 26252-26280 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MG920060 Mycobacterium phage Bob3, complete genome 28226-28254 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH338239 Mycobacterium phage Mryolo, complete genome 28445-28473 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH651183 Mycobacterium phage Nivrat, complete genome 25115-25143 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_021297 Mycobacterium phage PattyP, complete genome 28982-29010 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 KY224001 Mycobacterium phage Blue, complete genome 29185-29213 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MF919508 Mycobacterium phage ILeeKay, complete genome 28856-28884 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 AY500152 Mycobacteriophage U2, complete genome 28818-28846 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MG770213 Mycobacterium phage OldBen, complete genome 24921-24949 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK967387 Mycobacterium phage Big3, complete genome 29344-29372 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH651188 Mycobacterium phage Ruby, complete genome 24926-24954 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_041989 Mycobacterium phage Shauna1, complete genome 22606-22634 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 JN020140 Mycobacterium virus MrGordo, complete genome 28429-28457 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH834617 Mycobacterium phage Lizziana, complete genome 25116-25144 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 EU744251 Mycobacterium phage Jasper, complete genome 28533-28561 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK524499 Mycobacterium phage Tripl3t, complete genome 29563-29591 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK820638 Mycobacterium phage HermioneGrange, complete genome 28614-28642 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_041988 Mycobacterium phage ShiLan, complete genome 25142-25170 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 KX522649 Mycobacterium phage Bircsak, complete genome 29189-29217 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK524517 Mycobacterium phage James, complete genome 25107-25135 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK305886 Mycobacterium phage Poenanya, complete genome 24963-24991 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 JN859129 Mycobacterium virus DotProduct, complete genome 24830-24858 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MG962372 Mycobacterium phage McGuire, complete genome 28727-28755 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK305893 Mycobacterium phage Beatrix, complete genome 30124-30152 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK016494 Mycobacterium phage Filuzino, complete genome 24946-24974 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 KM066034 Mycobacterium phage Inventum, complete genome 25082-25110 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MN586011 Mycobacterium phage LilMoolah, complete genome 25241-25269 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 KT438500 Mycobacterium phage Pari, complete genome 28446-28474 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH338238 Mycobacterium phage Michley, complete genome 28566-28594 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH399784 Mycobacterium phage NormanBulbieJr, complete genome 25130-25158 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MT310893 Mycobacterium phage DRBy19, complete genome 24977-25005 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH399771 Mycobacterium phage ByChance, complete genome 25118-25146 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 KX522943 Mycobacterium phage Gompeii16, complete genome 29190-29218 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 KY702574 Mycobacterium phage Kingsley, complete genome 22409-22437 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH450133 Mycobacterium phage SwissCheese, complete genome 29419-29447 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_009877 Mycobacterium phage U2, complete genome 28818-28846 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 KJ025956 Mycobacterium phage Saal, complete genome 24931-24959 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MN813700 Mycobacterium phage Atkinbua, complete genome 29150-29178 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_024136 Mycobacterium phage Seabiscuit, complete genome 28727-28755 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MN369751 Mycobacterium phage TDanisky, complete genome 24977-25005 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MT639644 Mycobacterium phage MaryBeth, complete genome 28847-28875 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MT639654 Mycobacterium phage Jerm2, complete genome 28880-28908 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH590602 Mycobacterium phage Gorge, complete genome 25111-25139 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 JF937108 Mycobacterium phage Switzer, complete genome 28833-28861 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 JN660814 Mycobacterium phage Dreamboat, complete genome 28647-28675 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_011054 Mycobacterium phage Boomer, complete genome 24638-24666 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH669011 Mycobacterium phage PherrisBueller, complete genome 28556-28584 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_023687 Mycobacterium phage Bruns, complete genome 28664-28692 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK310141 Mycobacterium phage Fenn, complete genome 30323-30351 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 JF937103 Mycobacterium virus Museum, complete genome 28773-28801 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH669005 Mycobacterium phage JoeyJr, complete genome 25119-25147 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_028654 Mycobacterium phage Sparkdehlily, complete genome 24977-25005 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK524523 Mycobacterium phage Naira, complete genome 30370-30398 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH450113 Mycobacterium phage BigMau, complete genome 28880-28908 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MN444869 Mycobacterium phage DreamCatcher, complete genome 30058-30086 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_023695 Mycobacterium phage Violet, complete genome 29236-29264 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MG812495 Mycobacterium phage Pippin, complete genome 29064-29092 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_023726 Mycobacterium phage Euphoria, complete genome 28737-28765 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MG812489 Mycobacterium phage Greg, complete genome 29005-29033 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MT310897 Mycobacterium phage Manatee, complete genome 28435-28463 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH155871 Mycobacterium phage Mattes, complete genome 25107-25135 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MN204502 Mycobacterium phage KingMidas, complete genome 26251-26279 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_022068 Mycobacteriophage Daenerys, complete genome 24951-24979 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK310142 Mycobacterium phage MetalQZJ, complete genome 28847-28875 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 KT895281 Mycobacterium phage Cabrinians, complete genome 25135-25163 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_031041 Mycobacterium phage Papez, complete genome 30400-30428 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH513971 Mycobacterium phage Hope4ever, complete genome 29092-29120 6 0.793
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH450130 Mycobacterium phage Rohr, complete genome 28919-28947 6 0.793
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032344 Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence 135403-135428 6 0.769
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 94486-94511 6 0.769
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 377811-377836 6 0.769
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 633712-633737 6 0.769
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP033323 Azospirillum brasilense strain Cd plasmid p5, complete sequence 9254-9279 6 0.769
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP033317 Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence 58977-59002 6 0.769
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP012919 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence 48043-48068 6 0.769
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 117792-117817 6 0.769
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 114132-114157 6 0.769
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 303401-303426 6 0.769
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP045303 Azotobacter salinestris strain KACC 13899 plasmid unnamed1, complete sequence 270828-270853 6 0.769
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 820542-820567 6 0.769
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 40667-40692 6 0.769
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP021127 Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence 423227-423252 6 0.769
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 440801-440826 6 0.769
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP014598 Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence 73325-73350 6 0.769
NZ_CP022578_11 11.12|4010003|29|NZ_CP022578|CRT 4010003-4010031 29 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1269400-1269428 6 0.793
NZ_CP022578_11 11.12|4010003|29|NZ_CP022578|CRT 4010003-4010031 29 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 2357907-2357935 6 0.793
NZ_CP022578_11 11.12|4010003|29|NZ_CP022578|CRT 4010003-4010031 29 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 448301-448329 6 0.793
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 AP017627 Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome 126742-126773 6 0.812
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1287244-1287275 6 0.812
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 35379-35410 6 0.812
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 1145460-1145491 6 0.812
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP018466 Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.3, complete sequence 26645-26676 6 0.812
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_LR723674 Rhizobium flavum strain YW14 plasmid 5 102513-102544 6 0.812
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP020976 Xanthomonas phaseoli pv. phaseoli strain CFBP6982 plasmid pA 31697-31728 6 0.812
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP020965 Xanthomonas phaseoli pv. phaseoli strain CFBP412 plasmid pA, complete sequence 14916-14947 6 0.812
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP018727 Xanthomonas vesicatoria ATCC 35937 strain LMG911 plasmid pLMG911.2, complete sequence 16476-16507 6 0.812
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NC_012853 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132503, complete sequence 213684-213715 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 24060-24091 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 27512-27543 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 164930-164961 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 326642-326673 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1773789-1773820 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 298129-298160 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 318546-318577 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 333102-333133 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 301273-301304 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 362911-362942 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210636-2210667 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 454698-454729 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 114578-114609 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 303386-303417 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 913358-913389 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 11036-11067 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 302533-302564 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 683734-683765 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 687348-687379 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 311647-311678 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 299307-299338 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 298391-298422 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 315320-315351 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 295588-295619 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 299550-299581 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 302550-302581 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 315320-315351 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 317013-317044 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 301318-301349 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 362983-363014 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 317013-317044 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 301318-301349 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 317013-317044 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 317013-317044 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 301318-301349 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 301318-301349 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 301318-301349 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1795331-1795362 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 311630-311661 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 311600-311631 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 306151-306182 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 304280-304311 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 299829-299860 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 317013-317044 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 315314-315345 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 301318-301349 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1777383-1777414 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1777383-1777414 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 82570-82601 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 68738-68769 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 364384-364415 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1639384-1639415 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 619974-620005 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 2029088-2029119 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1292463-1292494 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 89190-89221 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 192209-192240 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 780405-780436 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 315319-315350 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 294173-294204 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 315320-315351 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 294176-294207 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 315320-315351 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 315320-315351 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 294176-294207 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 315320-315351 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 294176-294207 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 294176-294207 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 294176-294207 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 315320-315351 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 315320-315351 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 315320-315351 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_031109 Gordonia phage Jumbo, complete genome 20059-20090 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 929944-929975 6 0.812
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 209775-209806 6 0.812
NZ_CP022578_13 13.6|4030672|28|NZ_CP022578|CRT 4030672-4030699 28 LN997844 Streptomyces reticuli genome assembly TUE45, plasmid : III 46922-46949 6 0.786
NZ_CP022578_13 13.6|4030672|28|NZ_CP022578|CRT 4030672-4030699 28 DQ115854 Cyanobacteria phage AS-1 contig_47 genomic sequence 815-842 6 0.786
NZ_CP022578_13 13.6|4030672|28|NZ_CP022578|CRT 4030672-4030699 28 NC_009717 Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence 86709-86736 6 0.786
NZ_CP022578_13 13.6|4030672|28|NZ_CP022578|CRT 4030672-4030699 28 NZ_CP031752 Rhodobacter sphaeroides strain EBL0706 plasmid p.A, complete sequence 175180-175207 6 0.786
NZ_CP022578_14 14.1|4159156|27|NZ_CP022578|CRT 4159156-4159182 27 NC_048759 Serratia phage MTx, partial genome 50157-50183 6 0.778
NZ_CP022578_14 14.6|4159450|27|NZ_CP022578|CRT 4159450-4159476 27 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 319826-319852 6 0.778
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MG872843 Mycobacterium phage Sotrice96, complete genome 58962-58988 6 0.778
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MT723943 Mycobacterium phage Cactus, complete genome 58219-58245 6 0.778
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MT114165 Mycobacterium phage BadStone, complete genome 58858-58884 6 0.778
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 KF493883 Mycobacterium phage Mosby, complete genome 58434-58460 6 0.778
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MF919529 Mycobacterium phage Sassay, complete genome 57396-57422 6 0.778
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MK359343 Mycobacterium phage Pollywog, complete genome 43646-43672 6 0.778
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 KU865303 Mycobacterium phage TeardropMSU, complete genome 58043-58069 6 0.778
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 KR080204 Mycobacterium phage Mindy, complete genome 58182-58208 6 0.778
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 NC_029079 Mycobacterium phage Dusk, complete genome 58518-58544 6 0.778
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 NC_022065 Mycobacterium phage Contagion, complete genome 58434-58460 6 0.778
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 KX817173 Mycobacterium phage Tuco, complete genome 60123-60149 6 0.778
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MT684595 Mycobacterium phage Mova, complete genome 43328-43354 6 0.778
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 KF188414 Mycobacterium phage ABCat, complete genome 59289-59315 6 0.778
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MF919540 Mycobacterium phage Willez, complete genome 57396-57422 6 0.778
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MN234212 Mycobacterium phage Paphu, complete genome 40417-40443 6 0.778
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MK061415 Mycobacterium phage Rhynn, complete genome 39582-39608 6 0.778
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MK524531 Mycobacterium phage Rutherferd, complete genome 41404-41430 6 0.778
NZ_CP022578_14 14.11|4159720|27|NZ_CP022578|CRT 4159720-4159746 27 MN617845 Mycobacterium phage BaconJack, complete genome 42888-42914 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 330036-330062 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_002699 Frankia sp. CpI1 plasmid pFQ12, complete plasmid sequence 8359-8385 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 501002-501028 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP015585 Roseomonas gilardii strain U14-5 plasmid 1, complete sequence 229195-229221 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 113102-113128 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 506092-506118 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 122717-122743 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 103719-103745 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 109506-109532 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 103719-103745 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 398793-398819 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 203705-203731 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 641102-641128 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 581085-581111 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 2350438-2350464 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP013069 Pannonibacter phragmitetus strain 31801 plasmid p.p-1, complete sequence 118179-118205 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_016115 Streptomyces pratensis ATCC 33331 plasmid pSFLA02, complete sequence 106743-106769 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1759817-1759843 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 557163-557189 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP015040 Rhodovulum sp. P5 plasmid pRGUI01, complete sequence 15924-15950 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 271657-271683 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP042268 Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence 2903-2929 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 455498-455524 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_022995 Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence 330124-330150 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP009975 Pseudomonas putida S12 plasmid pTTS12, complete sequence 323550-323576 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 731394-731420 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 213993-214019 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 385369-385395 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1509591-1509617 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 107589-107615 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP016080 Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence 121758-121784 6 0.778
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_022739 Pseudomonas sp. VLB120 plasmid pSTY, complete sequence 113279-113305 6 0.778
NZ_CP022578_14 14.18|4160212|36|NZ_CP022578|CRT 4160212-4160247 36 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2067764-2067799 6 0.833
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 MK977708 Mycobacterium phage Fulbright, complete genome 10281-10311 7 0.774
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 MG099948 Mycobacterium phage Philonius, complete genome 10281-10311 7 0.774
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 MH926055 Mycobacterium phage Chewbacca, complete genome 10281-10311 7 0.774
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 MT723932 Mycobacterium phage Schnauzer, complete genome 10281-10311 7 0.774
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 KU935726 Mycobacterium phage Xerxes, complete genome 10281-10311 7 0.774
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 KU935730 Mycobacterium phage Pipsqueaks, complete genome 10281-10311 7 0.774
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 MH316570 Mycobacterium phage Silvafighter, complete genome 10281-10311 7 0.774
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 MK524518 Mycobacterium phage Smurph, complete genome 10281-10311 7 0.774
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 MK524515 Mycobacterium phage Parmesanjohn, complete genome 10281-10311 7 0.774
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 MH697585 Mycobacterium phage Gex, complete genome 10280-10310 7 0.774
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 KM588359 Mycobacterium phage Carcharodon, complete genome 10281-10311 7 0.774
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 MH697576 Mycobacterium phage Aggie, complete genome 10282-10312 7 0.774
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 MH697593 Mycobacterium phage Tapioca, complete genome 10281-10311 7 0.774
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 MG099936 Mycobacterium phage Andies, complete genome 10281-10311 7 0.774
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 NC_031243 Mycobacterium phage Xeno, complete genome 10281-10311 7 0.774
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 JN256079 Mycobacterium phage Charlie, complete genome 10281-10311 7 0.774
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 MF417927 Uncultured Caudovirales phage clone 9F_2, partial genome 6978-7007 7 0.767
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 732060-732089 7 0.767
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 87847-87876 7 0.767
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 JX469830 Uncultured bacterium plasmid pG527, complete sequence 62414-62443 7 0.767
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 JX469833 Uncultured bacterium plasmid pWEC911, complete sequence 55706-55735 7 0.767
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 NC_008357 Pseudomonas aeruginosa plasmid pBS228, complete sequence 88668-88697 7 0.767
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 CP002151 Uncultured bacterium plasmid PB5, complete sequence 46922-46951 7 0.767
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 CP002152 Uncultured bacterium plasmid PB11, complete sequence 49405-49434 7 0.767
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 CP002153 Uncultured bacterium plasmid PSP21, complete sequence 51092-51121 7 0.767
NZ_CP022578_9 9.4|3214531|36|NZ_CP022578|CRT 3214531-3214566 36 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 201261-201296 7 0.806
NZ_CP022578_9 9.11|3215011|27|NZ_CP022578|CRT 3215011-3215037 27 NZ_AP018520 Sphingobium sp. YG1 plasmid pYGP1, complete sequence 54324-54350 7 0.741
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MN585973 Mycobacterium phage StAnnes, complete genome 24891-24919 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MG944221 Mycobacterium phage Scowl, complete genome 29090-29118 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 KT309034 Mycobacterium phage Dante, complete genome 24864-24892 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_048850 Mycobacterium phage Cornie, complete genome 23306-23334 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_021538 Mycobacterium phage Job42, complete genome 26532-26560 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_026584 Mycobacterium phage Minerva, complete genome 38743-38771 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 KJ409696 Mycobacterium phage Lamina13, complete genome 28205-28233 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_028784 Mycobacterium phage Tasp14, complete genome 28829-28857 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350114-350142 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350666-350694 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2211451-2211479 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 455349-455377 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_014819 Asticcacaulis excentricus CB 48 plasmid pASTEX02, complete sequence 68663-68691 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_LR134463 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence 144921-144949 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_LT703506 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2 304359-304387 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP025615 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed3, complete sequence 36213-36241 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 445678-445706 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 455533-455561 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 2019770-2019798 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 119320-119348 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP040096 Pantoea sp. SO10 plasmid unnamed1, complete sequence 107446-107474 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 333785-333813 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_011887 Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence 348321-348349 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MT522000 Mycobacterium phage Soul22, complete genome 22193-22221 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MF919502 Mycobacterium phage Demsculpinboyz, complete genome 22191-22219 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 AY129336 Mycobacteriophage Che9d, complete genome 22206-22234 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK359343 Mycobacterium phage Pollywog, complete genome 23656-23684 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_042030 Mycobacterium phage Yoshi, complete sequence 22194-22222 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_048729 Mycobacterium phage Renaud18, complete genome 22866-22894 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MT889380 Mycobacterium phage Coco12, complete genome 22837-22865 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_026585 Mycobacteriophage Estave1, complete genome 22559-22587 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MG925354 Mycobacterium phage Ogopogo, complete genome 22786-22814 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_023698 Mycobacterium phage Avani, complete genome 22198-22226 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MT114167 Mycobacterium phage Phanphagia, complete genome 22492-22520 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH077585 Mycobacterium phage TChen, complete genome 22971-22999 7 0.759
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NC_048788 Mycobacterium phage ThetaBob, complete genome 22784-22812 7 0.759
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP032344 Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence 134977-135002 7 0.731
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 580333-580358 7 0.731
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP033323 Azospirillum brasilense strain Cd plasmid p5, complete sequence 9680-9705 7 0.731
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP033317 Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence 58551-58576 7 0.731
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP012919 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence 48469-48494 7 0.731
NZ_CP022578_11 11.10|4009853|26|NZ_CP022578|CRT 4009853-4009878 26 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 582845-582870 7 0.731
NZ_CP022578_11 11.12|4010003|29|NZ_CP022578|CRT 4010003-4010031 29 NZ_CP047220 Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed3, complete sequence 33127-33155 7 0.759
NZ_CP022578_11 11.12|4010003|29|NZ_CP022578|CRT 4010003-4010031 29 MK510999 Pseudomonas phage BR58, partial genome 18164-18192 7 0.759
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 104974-105005 7 0.781
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 230840-230871 7 0.781
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP054025 Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence 19813-19844 7 0.781
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP051543 Paracoccus sanguinis strain OM2164 plasmid pPspOM122, complete sequence 106285-106316 7 0.781
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP054034 Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence 268526-268557 7 0.781
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 465925-465956 7 0.781
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 456256-456287 7 0.781
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 466109-466140 7 0.781
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 344363-344394 7 0.781
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 20371-20402 7 0.781
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 128423-128454 7 0.781
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_LR723674 Rhizobium flavum strain YW14 plasmid 5 101685-101716 7 0.781
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_LR723674 Rhizobium flavum strain YW14 plasmid 5 101829-101860 7 0.781
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_LR723674 Rhizobium flavum strain YW14 plasmid 5 102057-102088 7 0.781
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_LR723674 Rhizobium flavum strain YW14 plasmid 5 102099-102130 7 0.781
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_LR723674 Rhizobium flavum strain YW14 plasmid 5 102285-102316 7 0.781
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_LR723674 Rhizobium flavum strain YW14 plasmid 5 102327-102358 7 0.781
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_LR723674 Rhizobium flavum strain YW14 plasmid 5 102471-102502 7 0.781
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 416440-416471 7 0.781
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 210543-210574 7 0.781
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1974012-1974043 7 0.781
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NC_012853 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132503, complete sequence 213747-213778 7 0.781
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 374789-374820 7 0.781
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 723914-723945 7 0.781
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP019063 Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence 394924-394955 7 0.781
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 134704-134735 7 0.781
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 105338-105369 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 916895-916926 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 333906-333937 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1727798-1727829 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1754493-1754524 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 917354-917385 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1783272-1783303 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1814773-1814804 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350104-350135 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2211449-2211480 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1959037-1959068 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 698830-698861 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1714018-1714049 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 329136-329167 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 579487-579518 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1792768-1792799 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1500392-1500423 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1735050-1735081 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1729871-1729902 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1798700-1798731 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 446057-446088 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1672859-1672890 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1729331-1729362 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1804248-1804279 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1798667-1798698 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1708136-1708167 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1783689-1783720 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 440080-440111 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1814775-1814806 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1708448-1708479 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1783689-1783720 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1708136-1708167 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1707339-1707370 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1783689-1783720 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1783689-1783720 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1783689-1783720 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 248523-248554 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1708334-1708365 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1688979-1689010 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1750023-1750054 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1782005-1782036 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1781004-1781035 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1708447-1708478 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1798491-1798522 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1783694-1783725 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 216325-216356 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 216325-216356 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 573838-573869 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_009339 Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence 80793-80824 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 315284-315315 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 83152-83183 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 67805-67836 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 71042-71073 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 258325-258356 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 250537-250568 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 301071-301102 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 202914-202945 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 509871-509902 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_011879 Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence 75980-76011 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_008703 Mycobacterium sp. KMS plasmid pMKMS01, complete sequence 170110-170141 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261733-261764 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 308611-308642 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MT889380 Mycobacterium phage Coco12, complete genome 22835-22866 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MT114167 Mycobacterium phage Phanphagia, complete genome 22490-22521 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1797462-1797493 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 50134-50165 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 765883-765914 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1797460-1797491 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP014276 Martelella sp. AD-3 plasmid unnamed1, complete sequence 26313-26344 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 245788-245819 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP047145 Streptomyces sp. HF10 plasmid plas1, complete sequence 52536-52567 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1462200-1462231 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 300484-300515 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 280825-280856 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 670169-670200 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 98683-98714 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MK494095 Mycobacterium phage Daegal, complete genome 5958-5989 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MK494105 Mycobacterium phage Pinnie, complete genome 23390-23421 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MK494105 Mycobacterium phage Pinnie, complete genome 23159-23190 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_028791 Mycobacterium phage MOOREtheMARYer, complete genome 23011-23042 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP023779 Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence 6341-6372 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 318451-318482 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 396853-396884 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 391036-391067 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 153727-153758 7 0.781
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 573119-573150 7 0.781
NZ_CP022578_12 12.6|4029297|32|NZ_CP022578|CRT 4029297-4029328 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2781975-2782006 7 0.781
NZ_CP022578_13 13.6|4030672|28|NZ_CP022578|CRT 4030672-4030699 28 NC_022050 Paracoccus aminophilus JCM 7686 plasmid pAMI8, complete sequence 39653-39680 7 0.75
NZ_CP022578_14 14.4|4159339|33|NZ_CP022578|CRT 4159339-4159371 33 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 612195-612227 7 0.788
NZ_CP022578_14 14.9|4159615|27|NZ_CP022578|CRT 4159615-4159641 27 AP021851 Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome 369282-369308 7 0.741
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 663780-663806 7 0.741
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 286244-286270 7 0.741
NZ_CP022578_14 14.13|4159831|27|NZ_CP022578|CRT 4159831-4159857 27 NZ_CP006368 Aureimonas sp. AU20 plasmid pAU20a, complete sequence 29168-29194 7 0.741
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1465470-1465499 8 0.733
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 251025-251054 8 0.733
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 NZ_CP048283 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence 258423-258452 8 0.733
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 NZ_CP021796 Sinorhizobium meliloti strain USDA1157 plasmid accessoryA, complete sequence 88284-88313 8 0.733
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 52655-52684 8 0.733
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 NZ_CP025016 Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence 190437-190466 8 0.733
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 273171-273200 8 0.733
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 52528-52557 8 0.733
NZ_CP022578_8 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder 3186729-3186758 30 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 163428-163457 8 0.733
NZ_CP022578_9 9.4|3214531|36|NZ_CP022578|CRT 3214531-3214566 36 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 519535-519570 8 0.778
NZ_CP022578_11 11.1|4009127|29|NZ_CP022578|CRT 4009127-4009155 29 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 938431-938459 8 0.724
NZ_CP022578_11 11.1|4009127|29|NZ_CP022578|CRT 4009127-4009155 29 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1510083-1510111 8 0.724
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 NZ_CP048923 Lactobacillus plantarum strain X7022 plasmid unnamed2, complete sequence 17406-17434 8 0.724
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MK937593 Mycobacterium phage Flypotenuse, complete genome 26855-26883 8 0.724
NZ_CP022578_11 11.6|4009544|29|NZ_CP022578|CRT 4009544-4009572 29 MH536820 Mycobacterium phage Glexan, complete genome 26855-26883 8 0.724
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 223846-223877 8 0.75
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 87943-87974 8 0.75
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 223111-223142 8 0.75
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 73264-73295 8 0.75
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 624011-624042 8 0.75
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP046571 Xanthomonas albilineans strain Xa-FJ1 plasmid pXaFJ1, complete sequence 7592-7623 8 0.75
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 424526-424557 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 69206-69237 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 416248-416279 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 416296-416327 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 416344-416375 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 416128-416159 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 416224-416255 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 416368-416399 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 222441-222472 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 393193-393224 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 416863-416894 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 393262-393293 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 399992-400023 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 398832-398863 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 398832-398863 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 398824-398855 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 416863-416894 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 399992-400023 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 399470-399501 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 JN699011 Mycobacterium phage Stinger, complete genome 23830-23861 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_KM406416 Bifidobacterium breve strain JCM 7017 plasmid megaplasmid pMP7017, complete sequence 12241-12272 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NC_019018 Mycobacterium marinum DL240490 plasmid pMUM003, complete sequence 58948-58979 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NC_011355 Mycobacterium liflandii 128FXT plasmid pMUM002, complete sequence 5698-5729 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 599851-599882 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP016617 Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence 173242-173273 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_AP017625 Mycobacterium ulcerans subsp. shinshuense strain ATCC 33728 plasmid pShTP, complete sequence 5705-5736 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP027853 Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence 194754-194785 8 0.75
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1389287-1389318 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 280285-280316 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 876589-876620 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350665-350696 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3466591-3466622 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210945-2210976 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2211119-2211150 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3467425-3467456 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350506-350537 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 752721-752752 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2211059-2211090 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3467362-3467393 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 684907-684938 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1552681-1552712 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 83251-83282 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 83422-83453 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_LR134461 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence 116486-116517 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1172375-1172406 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 306654-306685 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 302070-302101 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MF141540 Mycobacterium phage Avocado, complete genome 24054-24085 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 KR080198 Mycobacterium phage Cambiare, complete genome 24519-24550 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 258384-258415 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 806900-806931 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 94315-94346 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 473669-473700 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP026974 Achromobacter insolitus strain FDAARGOS_88 plasmid unnamed1, complete sequence 151628-151659 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_020275 Mycobacterium intracellulare subsp. yongonense 05-1390 plasmid pMyong1, complete sequence 117761-117792 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 713857-713888 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP047145 Streptomyces sp. HF10 plasmid plas1, complete sequence 41273-41304 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1755080-1755111 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 162817-162848 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 529169-529200 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1657444-1657475 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 408199-408230 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MK814754 Mycobacterium phage Sumter, complete genome 28140-28171 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MK814754 Mycobacterium phage Sumter, complete genome 28638-28669 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MN369739 Mycobacterium phage Kenuha5, complete genome 22587-22618 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MK967397 Mycobacterium phage Mahavrat, complete genome 24813-24844 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MH001451 Mycobacterium phage Nairb, complete genome 21241-21272 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MK524490 Mycobacterium phage Donny, complete genome 33810-33841 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MT522000 Mycobacterium phage Soul22, complete genome 22191-22222 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 KY348865 Mycobacterium phage Bubbles123, complete genome 25539-25570 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MN428047 Mycobacterium phage Doomphist, complete genome 24961-24992 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MF919502 Mycobacterium phage Demsculpinboyz, complete genome 22189-22220 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 AY129336 Mycobacteriophage Che9d, complete genome 22204-22235 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MT771340 Mycobacterium phage Jorgensen, complete genome 28475-28506 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MK359343 Mycobacterium phage Pollywog, complete genome 23654-23685 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MF155936 Mycobacterium phage ZenTime222, complete genome 21241-21272 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_042030 Mycobacterium phage Yoshi, complete sequence 22192-22223 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MH338241 Mycobacterium phage Tarynearal, complete genome 23683-23714 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_048729 Mycobacterium phage Renaud18, complete genome 22864-22895 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_026585 Mycobacteriophage Estave1, complete genome 22557-22588 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MK305886 Mycobacterium phage Poenanya, complete genome 24961-24992 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 JN859129 Mycobacterium virus DotProduct, complete genome 24828-24859 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MK494089 Mycobacterium phage Ibrahim, complete genome 21241-21272 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MG925354 Mycobacterium phage Ogopogo, complete genome 22784-22815 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_023698 Mycobacterium phage Avani, complete genome 22196-22227 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 JN699007 Mycobacterium phage Acadian, complete genome 33805-33836 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_024135 Mycobacterium phage Bernal13, complete genome 21241-21272 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_011054 Mycobacterium phage Boomer, complete genome 24636-24667 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MT889381 Mycobacterium phage Suigeneris, complete genome 33810-33841 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 KM591905 Mycobacterium phage RonRayGun, complete genome 21241-21272 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MH077585 Mycobacterium phage TChen, complete genome 22969-23000 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MN735432 Mycobacteriophage Whitty, complete genome 21241-21272 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_048788 Mycobacterium phage ThetaBob, complete genome 22782-22813 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP018471 Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence 13085-13116 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_008712 Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence 40934-40965 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 480125-480156 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 83601-83632 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_LR134446 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence 52094-52125 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_LR134454 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence 288114-288145 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 572169-572200 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP044283 Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence 335584-335615 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_008539 Arthrobacter sp. FB24 plasmid 3, complete sequence 16079-16110 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1246417-1246448 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 449577-449608 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP046330 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed1, complete sequence 94222-94253 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_019789 Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence 455292-455323 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 313198-313229 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022566 Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence 218474-218505 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190142-190173 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 112997-113028 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_008766 Acidovorax sp. JS42 plasmid pAOVO02, complete sequence 13754-13785 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 645804-645835 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP023550 Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence 151176-151207 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 219895-219926 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_006525 Cupriavidus metallidurans CH34 plasmid pMOL28, complete sequence 12466-12497 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 677364-677395 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MN096355 Mycobacterium phage Purky, complete genome 13504-13535 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MH669003 Mycobacterium phage Girr, complete genome 14385-14416 8 0.75
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MK016504 Mycobacterium phage Whouxphf, complete genome 14517-14548 8 0.75
NZ_CP022578_12 12.5|4029243|32|NZ_CP022578|CRT 4029243-4029274 32 NZ_CP021406 Celeribacter manganoxidans strain DY25 plasmid pDY25-B, complete sequence 151899-151930 8 0.75
NZ_CP022578_12 12.5|4029243|32|NZ_CP022578|CRT 4029243-4029274 32 NZ_LR134456 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence 300695-300726 8 0.75
NZ_CP022578_12 12.5|4029243|32|NZ_CP022578|CRT 4029243-4029274 32 NZ_CP010872 Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6003, complete sequence 102705-102736 8 0.75
NZ_CP022578_12 12.5|4029243|32|NZ_CP022578|CRT 4029243-4029274 32 NZ_CP040823 Paraoceanicella profunda strain D4M1 plasmid pD4M1E, complete sequence 5062-5093 8 0.75
NZ_CP022578_12 12.5|4029243|32|NZ_CP022578|CRT 4029243-4029274 32 NZ_CP040823 Paraoceanicella profunda strain D4M1 plasmid pD4M1E, complete sequence 111204-111235 8 0.75
NZ_CP022578_12 12.6|4029297|32|NZ_CP022578|CRT 4029297-4029328 32 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 279027-279058 8 0.75
NZ_CP022578_13 13.6|4030672|28|NZ_CP022578|CRT 4030672-4030699 28 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 783761-783788 8 0.714
NZ_CP022578_14 14.4|4159339|33|NZ_CP022578|CRT 4159339-4159371 33 MN234213 Gordonia phage Schiebs, complete genome 11497-11529 8 0.758
NZ_CP022578_14 14.4|4159339|33|NZ_CP022578|CRT 4159339-4159371 33 NC_012520 Rhodococcus opacus B4 plasmid pROB01, complete sequence 447918-447950 8 0.758
NZ_CP022578_14 14.5|4159393|36|NZ_CP022578|CRT 4159393-4159428 36 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 296417-296452 8 0.778
NZ_CP022578_14 14.5|4159393|36|NZ_CP022578|CRT 4159393-4159428 36 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 346479-346514 8 0.778
NZ_CP022578_14 14.18|4160212|36|NZ_CP022578|CRT 4160212-4160247 36 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 233810-233845 8 0.778
NZ_CP022578_14 14.18|4160212|36|NZ_CP022578|CRT 4160212-4160247 36 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 263517-263552 8 0.778
NZ_CP022578_14 14.18|4160212|36|NZ_CP022578|CRT 4160212-4160247 36 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 811469-811504 8 0.778
NZ_CP022578_3 3.7|1499938|30|NZ_CP022578|CRT 1499938-1499967 30 NZ_CP022197 Celeribacter ethanolicus strain TSPH2 plasmid unnamed, complete sequence 25141-25170 9 0.7
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 NZ_CP014964 Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence 13698-13728 9 0.71
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 NC_015974 Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence 20960-20990 9 0.71
NZ_CP022578_5 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder 2856753-2856783 31 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 15390-15420 9 0.71
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NC_010509 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD02, complete sequence 4245-4276 9 0.719
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 426519-426550 9 0.719
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 160488-160519 9 0.719
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 414196-414227 9 0.719
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 204646-204677 9 0.719
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 209773-209804 9 0.719
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NC_023286 Streptomyces sp. F12 plasmid pFRL6, complete sequence 139549-139580 9 0.719
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NC_012852 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence 143-174 9 0.719
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP017300 Rhodococcus sp. YL-1 plasmid pYLC1, complete sequence 340876-340907 9 0.719
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP020371 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence 177208-177239 9 0.719
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 1525216-1525247 9 0.719
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 443295-443326 9 0.719
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 MH632120 Mycobacterium phage Thonko, complete genome 12336-12367 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 416392-416423 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 416080-416111 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 416176-416207 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 416200-416231 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 416320-416351 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 416416-416447 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 1010316-1010347 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 985673-985704 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 880738-880769 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 1010316-1010347 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 880737-880768 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP032678 Pseudomonas sp. Leaf58 plasmid pBASL58, complete sequence 723992-724023 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 1019170-1019201 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_LR723676 Rhizobium sp. TCK plasmid 2 121353-121384 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 379096-379127 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 293535-293566 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 293535-293566 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 97913-97944 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 238635-238666 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP053022 Sphingobium yanoikuyae strain YC-XJ2 plasmid p-A-Sy, complete sequence 72142-72173 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 2084374-2084405 9 0.719
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 CP003952 Rhodococcus opacus PD630 plasmid 3, complete sequence 60533-60564 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350095-350126 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3465304-3465335 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4086145-4086176 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4571813-4571844 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4863684-4863715 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1271064-1271095 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3466267-3466298 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3467023-3467054 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 687357-687388 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 69755-69786 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 13863-13894 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 306606-306637 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MT889380 Mycobacterium phage Coco12, complete genome 14812-14843 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MT114167 Mycobacterium phage Phanphagia, complete genome 14467-14498 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 364375-364406 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 531166-531197 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 342003-342034 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 13742-13773 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 14621-14652 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 14824-14855 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 274043-274074 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 13743-13774 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 13743-13774 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 479451-479482 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 13742-13773 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 13738-13769 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 18613-18644 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 18613-18644 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 13750-13781 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 18613-18644 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 13861-13892 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 18613-18644 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 13743-13774 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 557389-557420 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 14599-14630 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1333618-1333649 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 13750-13781 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 534054-534085 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 14599-14630 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 14599-14630 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 18613-18644 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP021126 Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence 14821-14852 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 14599-14630 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 14599-14630 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 14826-14857 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 262378-262409 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 13741-13772 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1022655-1022686 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 918752-918783 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MN428047 Mycobacterium phage Doomphist, complete genome 14549-14580 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MK305886 Mycobacterium phage Poenanya, complete genome 14549-14580 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 JN859129 Mycobacterium virus DotProduct, complete genome 14425-14456 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 659488-659519 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 600186-600217 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_015184 Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence 72745-72776 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 126716-126747 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 152440-152471 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 152668-152699 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_AP022334 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence 27567-27598 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_001759 Streptomyces phaeochromogenes plasmid pJV1, complete sequence 409-440 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 125962-125993 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 686343-686374 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MH051248 Mycobacterium phage BigPhil, complete genome 14271-14302 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MF668281 Mycobacterium phage RitaG, complete genome 14558-14589 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MN369749 Mycobacterium phage MinionDave, complete genome 15113-15144 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MT684597 Mycobacterium phage Mandlovu, complete genome 14527-14558 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 KY012363 Mycobacterium phage Empress, complete genome 15766-15797 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MN585973 Mycobacterium phage StAnnes, complete genome 14462-14493 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MH077578 Mycobacterium phage DillTech15, complete genome 14464-14495 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MH020235 Mycobacterium phage Batiatus, complete genome 14465-14496 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 KY471267 Mycobacterium phage SassyB, complete genome 14466-14497 9 0.719
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MG872841 Mycobacterium phage Priscilla, complete genome 14423-14454 9 0.719
NZ_CP022578_12 12.5|4029243|32|NZ_CP022578|CRT 4029243-4029274 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 917199-917230 9 0.719
NZ_CP022578_12 12.5|4029243|32|NZ_CP022578|CRT 4029243-4029274 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 895925-895956 9 0.719
NZ_CP022578_12 12.5|4029243|32|NZ_CP022578|CRT 4029243-4029274 32 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 232436-232467 9 0.719
NZ_CP022578_12 12.5|4029243|32|NZ_CP022578|CRT 4029243-4029274 32 NZ_CP015221 Rhodococcus sp. PBTS 2 plasmid unnamed1, complete sequence 130163-130194 9 0.719
NZ_CP022578_12 12.6|4029297|32|NZ_CP022578|CRT 4029297-4029328 32 NZ_CP013071 Sphingobium indicum B90A plasmid pSRL1, complete sequence 86867-86898 9 0.719
NZ_CP022578_12 12.6|4029297|32|NZ_CP022578|CRT 4029297-4029328 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1334636-1334667 9 0.719
NZ_CP022578_12 12.6|4029297|32|NZ_CP022578|CRT 4029297-4029328 32 NZ_CP021819 Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence 44253-44284 9 0.719
NZ_CP022578_14 14.4|4159339|33|NZ_CP022578|CRT 4159339-4159371 33 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 444168-444200 9 0.727
NZ_CP022578_14 14.18|4160212|36|NZ_CP022578|CRT 4160212-4160247 36 NC_031262 Mycobacterium phage Brocalys, complete genome 19446-19481 9 0.75
NZ_CP022578_14 14.18|4160212|36|NZ_CP022578|CRT 4160212-4160247 36 NC_004683 Mycobacterium phage Che9c, complete genome 20558-20593 9 0.75
NZ_CP022578_14 14.18|4160212|36|NZ_CP022578|CRT 4160212-4160247 36 AY129333 Mycobacterium virus Che9c, complete genome 20558-20593 9 0.75
NZ_CP022578_14 14.18|4160212|36|NZ_CP022578|CRT 4160212-4160247 36 MN234184 Mycobacterium phage IdentityCrisis, complete genome 18582-18617 9 0.75
NZ_CP022578_14 14.18|4160212|36|NZ_CP022578|CRT 4160212-4160247 36 KM083128 Mycobacterium phage Sparky, complete genome 21436-21471 9 0.75
NZ_CP022578_14 14.18|4160212|36|NZ_CP022578|CRT 4160212-4160247 36 MT889380 Mycobacterium phage Coco12, complete genome 22836-22871 9 0.75
NZ_CP022578_14 14.18|4160212|36|NZ_CP022578|CRT 4160212-4160247 36 MT114167 Mycobacterium phage Phanphagia, complete genome 22491-22526 9 0.75
NZ_CP022578_1 1.7|431664|35|NZ_CP022578|CRT,PILER-CR,CRISPRCasFinder 431664-431698 35 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 414652-414686 10 0.714
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_KU140623 Sinorhizobium sp. M14 plasmid pSinB, complete sequence 65269-65300 10 0.688
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 152547-152578 10 0.688
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP048631 Ancylobacter pratisalsi strain DSM 102029 plasmid pLGM, complete sequence 130266-130297 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 416152-416183 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 416272-416303 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 865209-865240 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 824526-824557 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 224222-224253 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 244313-244344 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 226869-226900 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 224416-224447 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 224786-224817 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 224786-224817 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 224781-224812 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 244313-244344 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 224416-224447 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 230392-230423 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 219568-219599 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 238684-238715 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 238684-238715 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 222088-222119 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 243141-243172 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013523 Rhizobium phaseoli strain R744 plasmid pRphaR744a, complete sequence 68631-68662 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 260131-260162 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 249908-249939 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 1008420-1008451 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 227840-227871 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 902801-902832 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 1008420-1008451 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 KU935731 Mycobacterium phage Phrann, complete genome 21013-21044 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 MK224497 Mycobacterium phage Henu3, complete genome 33343-33374 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 MT498061 Mycobacterium phage Jung, complete genome 21826-21857 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 MH230879 Mycobacterium phage Xavia, complete genome 22489-22520 10 0.688
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 MN585977 Mycobacterium phage Atcoo, complete genome 22360-22391 10 0.688
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 685570-685601 10 0.688
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 684352-684383 10 0.688
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP034352 Streptomyces sp. W1SF4 plasmid p2, complete sequence 107037-107068 10 0.688
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 377424-377455 10 0.688
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 507464-507495 10 0.688
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP009112 Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence 768792-768823 10 0.688
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 MG812488 Mycobacterium phage Frankie, complete genome 14521-14552 10 0.688
NZ_CP022578_14 14.5|4159393|36|NZ_CP022578|CRT 4159393-4159428 36 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2211249-2211284 10 0.722
NZ_CP022578_14 14.5|4159393|36|NZ_CP022578|CRT 4159393-4159428 36 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350879-350914 10 0.722
NZ_CP022578_11 11.13|4010075|32|NZ_CP022578|CRT 4010075-4010106 32 NZ_CP015743 Shinella sp. HZN7 plasmid pShin-07, complete sequence 96148-96179 11 0.656
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 247382-247413 11 0.656
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 302631-302662 11 0.656
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 109051-109082 11 0.656
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1435597-1435628 11 0.656
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 682268-682299 11 0.656
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1797409-1797440 11 0.656
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1694606-1694637 11 0.656
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1797508-1797539 11 0.656
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1695253-1695284 11 0.656
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1797504-1797535 11 0.656
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1797493-1797524 11 0.656
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1694629-1694660 11 0.656
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1797493-1797524 11 0.656
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1694629-1694660 11 0.656
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1694629-1694660 11 0.656
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1694629-1694660 11 0.656
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1797504-1797535 11 0.656
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1797515-1797546 11 0.656
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1797316-1797347 11 0.656
NZ_CP022578_12 12.2|4029063|32|NZ_CP022578|CRT 4029063-4029094 32 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 71709-71740 12 0.625
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1603109-1603140 13 0.594
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1403949-1403980 13 0.594
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1603236-1603267 13 0.594
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1355265-1355296 13 0.594
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 700709-700740 13 0.594
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1602738-1602769 13 0.594
NZ_CP022578_12 12.4|4029189|32|NZ_CP022578|CRT 4029189-4029220 32 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 155711-155742 13 0.594

1. spacer 3.9|1500028|21|NZ_CP022578|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 1, identity: 0.952

aatggcgggctcctgttcggc	CRISPR spacer
aatggcgggctcctgctcggc	Protospacer
***************.*****

2. spacer 7.3|3186282|21|NZ_CP022578|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 1, identity: 0.952

ggcaccgccgggcgcaccgac	CRISPR spacer
ggcaccaccgggcgcaccgac	Protospacer
******.**************

3. spacer 7.3|3186282|21|NZ_CP022578|CRISPRCasFinder matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 1, identity: 0.952

ggcaccgccgggcgcaccgac	CRISPR spacer
ggcaccaccgggcgcaccgac	Protospacer
******.**************

4. spacer 4.1|2711030|25|NZ_CP022578|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 2, identity: 0.92

ggccccgccgccacccgccgagctg	CRISPR spacer
ggccccgccgccgcccgccgtgctg	Protospacer
************.******* ****

5. spacer 4.1|2711030|25|NZ_CP022578|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.92

ggccccgccgccacccgccgagctg	CRISPR spacer
ggccccgccgccgcccgccgtgctg	Protospacer
************.******* ****

6. spacer 4.1|2711030|25|NZ_CP022578|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.92

ggccccgccgccacccgccgagctg	CRISPR spacer
ggccccgccgccgcccgccgtgctg	Protospacer
************.******* ****

7. spacer 4.1|2711030|25|NZ_CP022578|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.92

ggccccgccgccacccgccgagctg	CRISPR spacer
ggccccgccgccgcccgccgtgctg	Protospacer
************.******* ****

8. spacer 4.1|2711030|25|NZ_CP022578|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 2, identity: 0.92

ggccccgccgccacccgccgagctg	CRISPR spacer
ggccccgccgcccgccgccgagctg	Protospacer
************  ***********

9. spacer 4.1|2711030|25|NZ_CP022578|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 2, identity: 0.92

ggccccgccgccacccgccgagctg	CRISPR spacer
ggccccgccgccgcccgccgtgctg	Protospacer
************.******* ****

10. spacer 8.1|3186684|21|NZ_CP022578|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.905

gttgccgaagaacccggcgtt	CRISPR spacer
gttgccgaagaacccggcgac	Protospacer
******************* .

11. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP032327 (Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence) position: , mismatch: 2, identity: 0.917

caacgccgtgctgatcggcaacgg	CRISPR spacer
caacgacgttctgatcggcaacgg	Protospacer
***** *** **************

12. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP007798 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p5, complete sequence) position: , mismatch: 2, identity: 0.917

caacgccgtgctgatcggcaacgg	CRISPR spacer
caacgacgttctgatcggcaacgg	Protospacer
***** *** **************

13. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP005087 (Sphingobium sp. TKS plasmid pTK3, complete sequence) position: , mismatch: 2, identity: 0.917

caacgccgtgctgatcggcaacgg	CRISPR spacer
cgacgccgtgctgatcggcagcgg	Protospacer
*.******************.***

14. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.917

caacgccgtgctgatcggcaacgg	CRISPR spacer
ccacgccgtgctgaccggcaacgg	Protospacer
* ************.*********

15. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 2, identity: 0.917

caacgccgtgctgatcggcaacgg	CRISPR spacer
ccacgccgtgctgaccggcaacgg	Protospacer
* ************.*********

16. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 2, identity: 0.917

caacgccgtgctgatcggcaacgg	CRISPR spacer
ccacgccgtgctgaccggcaacgg	Protospacer
* ************.*********

17. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 2, identity: 0.917

caacgccgtgctgatcggcaacgg	CRISPR spacer
caacgccgggctgatcggaaacgg	Protospacer
******** ********* *****

18. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917

caacgccgtgctgatcggcaacgg	CRISPR spacer
caacggcgtgctgctcggcaacgg	Protospacer
***** ******* **********

19. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917

caacgccgtgctgatcggcaacgg	CRISPR spacer
caacgccgtgctgctcggcatcgg	Protospacer
************* ****** ***

20. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.917

caacgccgtgctgatcggcaacgg	CRISPR spacer
ccacgccgtgctgaccggcaacgg	Protospacer
* ************.*********

21. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 2, identity: 0.917

caacgccgtgctgatcggcaacgg	CRISPR spacer
caacgacgagctgatcggcaacgg	Protospacer
***** ** ***************

22. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to CU468217 (Azospirillum brasilense bacteriophage Cd, complete genome) position: , mismatch: 2, identity: 0.917

caacgccgtgctgatcggcaacgg	CRISPR spacer
ccacgccgtgctgaccggcaacgg	Protospacer
* ************.*********

23. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NC_010355 (Azospirillum phage Cd, complete genome) position: , mismatch: 2, identity: 0.917

caacgccgtgctgatcggcaacgg	CRISPR spacer
ccacgccgtgctgaccggcaacgg	Protospacer
* ************.*********

24. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_CP010862 (Marinovum algicola DG 898 plasmid pMaD7) position: , mismatch: 2, identity: 0.923

gcgccggagccgttggtgccgccggt	CRISPR spacer
gtgccggagcctttggtgccgccggt	Protospacer
*.********* **************

25. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_CP010862 (Marinovum algicola DG 898 plasmid pMaD7) position: , mismatch: 2, identity: 0.923

gcgccggagccgttggtgccgccggt	CRISPR spacer
gtgccggagcctttggtgccgccggt	Protospacer
*.********* **************

26. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gtcgccaccggcgccggtgccgc	Protospacer
**.*******************.

27. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

28. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP031258 (Klebsiella quasipneumoniae strain L22 plasmid pL22-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

29. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP011600 (Phytobacter ursingii strain CAV1151 plasmid pCAV1151-215, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

30. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP011601 (Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

31. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

32. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

33. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

34. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP052159 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

35. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP042506 (Leclercia adecarboxylata strain E1 plasmid pE1_001, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

36. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP042507 (Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

37. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

38. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MT077884 (Escherichia coli plasmid p33, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

39. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MT077886 (Escherichia coli plasmid p39, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

40. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP026170 (Leclercia sp. LSNIH1 plasmid pLEC-000f, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

41. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

42. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP052144 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

43. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

44. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MN423361 (Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

45. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP054602 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gctgacaccggcgccggtgccgt	Protospacer
*.** ******************

46. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MK347226 (Klebsiella pneumoniae strain K185 plasmid pK185_rmpA2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

47. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

48. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

49. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MK347229 (Klebsiella pneumoniae strain K199 plasmid pK199_rmpA2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

50. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

51. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

52. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MK347232 (Klebsiella pneumoniae strain K211 plasmid pK211_rmpA2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

53. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MK347233 (Klebsiella pneumoniae strain K214 plasmid pK214_rmpA2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

54. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MK347234 (Klebsiella pneumoniae strain K230 plasmid pK230_rmpA2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

55. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MK347235 (Klebsiella pneumoniae strain K232 plasmid pK232_rmpA2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

56. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MK347236 (Klebsiella pneumoniae strain K234 plasmid pK234_rmpA2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

57. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MK347237 (Klebsiella pneumoniae strain K235 plasmid pK235_rmpA2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

58. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

59. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

60. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP052357 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

61. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

62. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MN310380 (Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

63. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP008825 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKPC-272, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

64. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP041374 (Klebsiella pneumoniae strain KP58 plasmid pKP58-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

65. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP052232 (Klebsiella pneumoniae strain E17KP0033 plasmid pE17KP0033-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

66. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP040546 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-VIR, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

67. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP044215 (Klebsiella aerogenes strain KA_P10_L5_03.19 plasmid pIMPIncH12_334kb, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

68. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP030355 (Novosphingobium sp. P6W plasmid pP6W2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gatgccaccggcggcggtgccgt	Protospacer
* *********** *********

69. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP036191 (Klebsiella pneumoniae strain BA34918 plasmid pvirulence_VBA34918, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

70. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP052563 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

71. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP042494 (Leclercia adecarboxylata strain E61 plasmid pE61_001, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

72. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP042495 (Leclercia adecarboxylata strain E61 plasmid pE61_002, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

73. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP040696 (Citrobacter freundii strain R47 plasmid pR47-309, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

74. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_AP019666 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63631, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

75. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP042552 (Enterobacter hormaechei strain C45 plasmid pC45_001, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

76. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP016526 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

77. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP035906 (Klebsiella pneumoniae strain BA4656 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

78. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

79. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP034416 (Klebsiella pneumoniae strain C789 plasmid pVir-CR-hvKP-C789, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

80. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

81. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP030270 (Klebsiella pneumoniae subsp. pneumoniae strain SC-7 plasmid pSC7-vir, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

82. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

83. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

84. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

85. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP026166 (Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

86. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP052304 (Klebsiella pneumoniae strain E16KP0172 plasmid pE16KP0172-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

87. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

88. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP052204 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

89. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP023135 (Klebsiella pneumoniae subsp. pneumoniae strain KpvK54 plasmid pKpvK54, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

90. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

91. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NC_012556 (Enterobacter cloacae plasmid pEC-IMPQ, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

92. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NC_012555 (Enterobacter cloacae plasmid pEC-IMP, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

93. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP042579 (Enterobacter kobei strain C16 plasmid pC16_001, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

94. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

95. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP052178 (Klebsiella pneumoniae strain F16KP0045 plasmid pF16KP0045-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

96. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP054751 (Klebsiella pneumoniae strain KP20194c3 plasmid pKP20194c3-p1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

97. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP054781 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

98. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

99. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP032842 (Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

100. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP018338 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

101. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

102. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

103. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP054763 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

104. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

105. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

106. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP042525 (Citrobacter freundii strain E11 plasmid pE11_001, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

107. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP054745 (Klebsiella pneumoniae strain KP20194c4 plasmid pKP20194c4-p1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

108. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP054727 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

109. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP054739 (Klebsiella pneumoniae strain KP20194c5 plasmid pKP20194c5-p1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

110. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP054775 (Klebsiella pneumoniae strain KP20194a2 plasmid pKP20194a2-p1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

111. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP054733 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

112. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP054721 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

113. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP054757 (Klebsiella pneumoniae strain KP20194c plasmid pKP20194c-p1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

114. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP054769 (Klebsiella pneumoniae strain KP20194b plasmid pKP20194b-p1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

115. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP022533 (Enterobacter hormaechei strain MS7884A plasmid pMS7884A, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

116. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP041024 (Klebsiella pneumoniae strain KP1692 plasmid pKP1692, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

117. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP052317 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

118. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP054064 (Klebsiella pneumoniae strain WSHvKP plasmid pSWHvKp, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

119. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP029717 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0154 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

120. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP042489 (Enterobacter hormaechei strain C15 plasmid pC15_001, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

121. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP052495 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

122. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

123. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

124. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP033103 (Enterobacter hormaechei strain L51 plasmid pEHZJ1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

125. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

126. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_MF398271 (Klebsiella pneumoniae subsp. pneumoniae strain 70-2 plasmid pKP70-2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

127. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_MF344580 (Enterobacter cloacae strain 30860 plasmid p30860-HI2, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

128. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_MH399264 (Enterobacter cloacae strain RJ702 plasmid pIMP26, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

129. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_KY863418 (Enterobacter asburiae strain AMA 497 plasmid pOXA436, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

130. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_KY978628 (Cronobacter sakazakii strain 505108 plasmid p505108-MDR, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

131. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_MF788071 (Raoultella ornithinolytica strain 23141 plasmid p23141-3, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

132. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP040534 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-VIR, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

133. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MH727545 (Mycobacterium phage DismalStressor, complete genome) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
ggtgccatcggcgccggtgccgt	Protospacer
* *****.***************

134. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MN871473 (UNVERIFIED: Pseudomonas virus Pa-Z, complete genome) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccaccggcggcggcgccgt	Protospacer
************* ***.*****

135. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to KJ510412 (Mycobacterium phage ZoeJ, complete genome) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
ggtgccatcggcgccggtgccgt	Protospacer
* *****.***************

136. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NC_026598 (Mycobacterium phage Milly, complete genome) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
ggtgccatcggcgccggtgccgt	Protospacer
* *****.***************

137. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to AF068845 (Mycobacteriophage TM4, complete genome) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
ggtgccatcggcgccggtgccgt	Protospacer
* *****.***************

138. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MH834601 (Mycobacterium phage BoostSeason, complete genome) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
ggtgccatcggcgccggtgccgt	Protospacer
* *****.***************

139. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to KX688047 (Mycobacterium phage Marcoliusprime, complete genome) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
ggtgccatcggcgccggtgccgt	Protospacer
* *****.***************

140. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to KX171208 (Pseudomonas phage vB_Pae436M-8, complete genome) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccaccggcggcggcgccgt	Protospacer
************* ***.*****

141. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NC_028759 (Mycobacterium phage Mufasa, complete genome) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
ggtgccatcggcgccggtgccgt	Protospacer
* *****.***************

142. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MK318076 (Pseudomonas phage vB_PaeM_fHoPae01, complete genome) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccaccggcggcggcgccgt	Protospacer
************* ***.*****

143. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MF140408 (Mycobacterium phage DismalFunk, complete genome) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
ggtgccatcggcgccggtgccgt	Protospacer
* *****.***************

144. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NC_003387 (Mycobacterium phage TM4, complete genome) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
ggtgccatcggcgccggtgccgt	Protospacer
* *****.***************

145. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MT119369 (Pseudomonas phage sortsol, complete genome) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccaccggcggcggcgccgt	Protospacer
************* ***.*****

146. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_KX810825 (Salmonella enterica subsp. enterica serovar Typhimurium strain MU1 plasmid pIMP4-SEM1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

147. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP028197 (Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

148. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP052163 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

149. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

150. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

151. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

152. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP048293 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

153. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

154. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP020529 (Enterobacter cloacae strain 174 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

155. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

156. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

157. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP031567 (Enterobacter hormaechei strain 2013_1a plasmid pIncHI2-1301491, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

158. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP035380 (Leclercia adecarboxylata strain R25 plasmid pLA-109, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

159. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

160. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

161. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NC_008573 (Shewanella sp. ANA-3 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

162. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP022696 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

163. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP052873 (Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

164. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

165. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_AP018757 (Metakosakonia sp. MRY16-398 plasmid pMRY16-398_1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

166. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

167. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP026390 (Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

168. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP008899 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-8a4, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

169. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

170. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP031575 (Enterobacter hormaechei strain A1 plasmid pIncHI2-1502264, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

171. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

172. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP047678 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVF1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

173. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP047676 (Klebsiella pneumoniae subsp. pneumoniae strain KUH-KPNHVL1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

174. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP025983 (Enterobacteriaceae bacterium A-F18 plasmid pAF18_1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

175. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP013215 (Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

176. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

177. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

178. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

179. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

180. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP052259 (Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

181. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

182. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

183. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

184. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_MK715436 (Klebsiella pneumoniae subsp. pneumoniae strain SCNJ1 plasmid pVir-SCNJ1, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

185. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_MN058044 (Klebsiella pneumoniae strain KP1677 plasmid pKP1677, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

186. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

187. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP049047 (Enterobacter hormaechei strain Y233 plasmid pIHI2-233, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

188. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

189. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MT090958 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccagcggggccggtgccgt	Protospacer
******* *** ***********

190. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to MT118290 (Pseudomonas phage Epa10, complete genome) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgccaccggcggcggcgccgt	Protospacer
************* ***.*****

191. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to KC787101 (Mycobacterium phage 33D, partial genome) position: , mismatch: 2, identity: 0.913

gttgccaccggcgccggtgccgt	CRISPR spacer
ggtgccatcggcgccggtgccgt	Protospacer
* *****.***************

192. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 2, identity: 0.917

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagcccggccttc	Protospacer
******************** **.

193. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 2, identity: 0.917

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagcccggccttc	Protospacer
******************** **.

194. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 2, identity: 0.917

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagcccggccttc	Protospacer
******************** **.

195. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 2, identity: 0.917

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcaggccggccttt	Protospacer
************** ***** ***

196. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 2, identity: 0.917

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcaggccggccttt	Protospacer
************** ***** ***

197. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to MT723937 (Gordonia phage JKSyngboy, complete genome) position: , mismatch: 3, identity: 0.889

gtcggcggactcgcggccgacgccggt	CRISPR spacer
ttcggcggactcgcgtacgacgccggt	Protospacer
 **************  **********

198. spacer 3.8|1499986|24|NZ_CP022578|CRT matches to NZ_CP014599 (Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.875

accggcactaatgtcaccggcggt	CRISPR spacer
aacggcactaatgtcaccggcgtg	Protospacer
* ********************  

199. spacer 3.8|1499986|24|NZ_CP022578|CRT matches to NZ_CP028945 (Vibrio sp. dhg plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

accggcactaatgtcaccggcggt	CRISPR spacer
accggcactaatgtcaccgccaga	Protospacer
******************* *.* 

200. spacer 4.1|2711030|25|NZ_CP022578|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 3, identity: 0.88

ggccccgccgccacccgccgagctg	CRISPR spacer
agccccgccgccacccgccgaccgg	Protospacer
.******************** * *

201. spacer 4.1|2711030|25|NZ_CP022578|CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88

ggccccgccgccacccgccgagctg	CRISPR spacer
ggccccgccgccgcccgccgagggg	Protospacer
************.*********  *

202. spacer 4.1|2711030|25|NZ_CP022578|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.88

ggccccgccgccacccgccgagctg	CRISPR spacer
ggccccgccgccaccagccgcgccg	Protospacer
*************** **** **.*

203. spacer 9.12|3215059|24|NZ_CP022578|CRT matches to MN103533 (Mycobacterium phage Weirdo19, complete genome) position: , mismatch: 3, identity: 0.875

cagcggtgccaacgctctaggcgc	CRISPR spacer
ccacggtgccaacgctctaggccc	Protospacer
* .******************* *

204. spacer 9.13|3215104|24|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875

tgacggtggccacgccggggtgtt	CRISPR spacer
cgacggtgaccgcgccggggtgtt	Protospacer
.*******.**.************

205. spacer 9.13|3215104|24|NZ_CP022578|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 3, identity: 0.875

tgacggtggccacgccggggtgtt	CRISPR spacer
tgccggtggccacaccggggtgta	Protospacer
** **********.********* 

206. spacer 9.13|3215104|24|NZ_CP022578|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 3, identity: 0.875

tgacggtggccacgccggggtgtt	CRISPR spacer
tgccggtggccacaccggggtgta	Protospacer
** **********.********* 

207. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

caacgccgtgctgatcggcaacgg	CRISPR spacer
caacgcggtgctgatcgccaacgc	Protospacer
****** ********** ***** 

208. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 3, identity: 0.875

caacgccgtgctgatcggcaacgg	CRISPR spacer
caacgccgcgctgatcggcaccgc	Protospacer
********.*********** ** 

209. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NC_022061 (Mycobacterium phage KayaCho, complete genome) position: , mismatch: 3, identity: 0.875

caacgccgtgctgatcggcaacgg	CRISPR spacer
cgtcgcggtgctgatcggcaacgg	Protospacer
*. *** *****************

210. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP019938 (Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

caacgccgtgctgatcggcaacgg	CRISPR spacer
cacccccgtgctgatcggcaacgc	Protospacer
** * ****************** 

211. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

caacgccgtgctgatcggcaacgg	CRISPR spacer
caacgccgaggtgatcggcaacga	Protospacer
******** * ************.

212. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.875

caacgccgtgctgatcggcaacgg	CRISPR spacer
caacgcggtgctgatcgccaacgc	Protospacer
****** ********** ***** 

213. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 3, identity: 0.875

caacgccgtgctgatcggcaacgg	CRISPR spacer
caacgccgaggtgatcggcaacga	Protospacer
******** * ************.

214. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 3, identity: 0.875

caacgccgtgctgatcggcaacgg	CRISPR spacer
caacgccctgctgatcgccaacgt	Protospacer
******* ********* ***** 

215. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 3, identity: 0.875

caacgccgtgctgatcggcaacgg	CRISPR spacer
cggcgccgtgctgatcggcagcgg	Protospacer
*..*****************.***

216. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.875

caacgccgtgctgatcggcaacgg	CRISPR spacer
aaacgccgtgctgctcggcaaagg	Protospacer
 ************ ******* **

217. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to MK415401 (Phage apr34_1789, complete genome) position: , mismatch: 3, identity: 0.875

caacgccgtgctgatcggcaacgg	CRISPR spacer
aaacgccgtgctgctgggcaacgg	Protospacer
 ************ * ********

218. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to MK415401 (Phage apr34_1789, complete genome) position: , mismatch: 3, identity: 0.875

caacgccgtgctgatcggcaacgg	CRISPR spacer
aaacgccgtgctgctgggcaacgg	Protospacer
 ************ * ********

219. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to MK415401 (Phage apr34_1789, complete genome) position: , mismatch: 3, identity: 0.875

caacgccgtgctgatcggcaacgg	CRISPR spacer
aaacgccgtgctgctgggcaacgg	Protospacer
 ************ * ********

220. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 3, identity: 0.885

gcggagtcgtcgccggccccgccggt	CRISPR spacer
accgagtcgccgccggccccgccggt	Protospacer
.* ******.****************

221. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 3, identity: 0.87

gttgccaccggcgccggtgccgt	CRISPR spacer
atcgccaccggcgccggtgccgc	Protospacer
.*.*******************.

222. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to CP049262 (Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence) position: , mismatch: 3, identity: 0.87

gttgccaccggcgccggtgccgt	CRISPR spacer
cttgccaccggctccggtgccgg	Protospacer
 *********** ********* 

223. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.87

gttgccaccggcgccggtgccgt	CRISPR spacer
cgtgccgccggcgccggtgccgt	Protospacer
  ****.****************

224. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP016024 (Ralstonia insidiosa strain ATCC 49129 plasmid pRI-1, complete sequence) position: , mismatch: 3, identity: 0.87

gttgccaccggcgccggtgccgt	CRISPR spacer
attgccaccggtgccggtgccga	Protospacer
.**********.********** 

225. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 3, identity: 0.87

gttgccaccggcgccggtgccgt	CRISPR spacer
atcgccaccggcgccggtgccgc	Protospacer
.*.*******************.

226. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to AP014203 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C76-MedDCM-OCT-S35-C25, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

gttgccaccggcgccggtgccgt	CRISPR spacer
cttgccaccggcgacggtgccgc	Protospacer
 ************ ********.

227. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 3, identity: 0.87

gttgccaccggcgccggtgccgt	CRISPR spacer
gttgcaaccggcgccggtgccag	Protospacer
***** ***************. 

228. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to KJ680225 (Uncultured bacterium plasmid PLAsvaD clone PLAsvaD-1, complete sequence) position: , mismatch: 3, identity: 0.87

gttgccaccggcgccggtgccgt	CRISPR spacer
attgccaccggtgccggtgccga	Protospacer
.**********.********** 

229. spacer 12.7|4029351|23|NZ_CP022578|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.87

gttgccaccggcgccggtgccgt	CRISPR spacer
cgtgccgccggcgccggtgccgt	Protospacer
  ****.****************

230. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagcccggcgaac	Protospacer
*********************  .

231. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagcccggcgaag	Protospacer
*********************   

232. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagcccggcgaag	Protospacer
*********************   

233. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagcccggcgaag	Protospacer
*********************   

234. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
cctgcgccgatcagcccggcgtcc	Protospacer
** *******************..

235. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
gcggcgccgatcagcgcggcgttg	Protospacer
 ************** ******* 

236. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
gcggcgccgatcagcgcggcgttg	Protospacer
 ************** ******* 

237. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP026518 (Deinococcus sp. NW-56 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggccccgatcagcccggcgtag	Protospacer
***** ****************  

238. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP020897 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5a, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggcgccgatcagcccggccttc	Protospacer
.******************* **.

239. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013524 (Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggcgccgatcagcccggccttc	Protospacer
.******************* **.

240. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggcgccgatcagcccggctttc	Protospacer
.******************* **.

241. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013586 (Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggcgccgatcagcccggccttc	Protospacer
.******************* **.

242. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013559 (Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggcgccgatcagcccggccttc	Protospacer
.******************* **.

243. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013576 (Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggcgccgatcagcccggccttc	Protospacer
.******************* **.

244. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013548 (Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggcgccgatcagcccggccttc	Protospacer
.******************* **.

245. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013528 (Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggcgccgatcagcccggccttc	Protospacer
.******************* **.

246. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013533 (Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggcgccgatcagcccggccttc	Protospacer
.******************* **.

247. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013538 (Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggcgccgatcagcccggccttc	Protospacer
.******************* **.

248. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013543 (Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggcgccgatcagcccggccttc	Protospacer
.******************* **.

249. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggcgccgatcagcccggctttc	Protospacer
.******************* **.

250. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP021368 (Acidovorax carolinensis strain P4 plasmid pACP4.2, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatctgcccggcgtcc	Protospacer
************ *********..

251. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013581 (Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggcgccgatcagcccggccttc	Protospacer
.******************* **.

252. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013570 (Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggcgccgatcagcccggccttc	Protospacer
.******************* **.

253. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP021364 (Acidovorax carolinensis strain P3 plasmid pACP3.2, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatctgcccggcgtcc	Protospacer
************ *********..

254. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcaggccggccttc	Protospacer
************** ***** **.

255. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

256. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

257. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

258. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcaccgatcagcccggcgagt	Protospacer
*****.***************  *

259. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagcccgccgatg	Protospacer
****************** ** * 

260. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagcccgccgatg	Protospacer
****************** ** * 

261. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

262. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcaggccggccttc	Protospacer
************** ***** **.

263. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

264. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

265. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgaccagcccggcgatg	Protospacer
**********.********** * 

266. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

267. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ctggcgcggatcagcccggcgttg	Protospacer
*.***** *************** 

268. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcaggccggccttc	Protospacer
************** ***** **.

269. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

270. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

271. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

272. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

273. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to CU468217 (Azospirillum brasilense bacteriophage Cd, complete genome) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggtgccgatcagcccggcgatt	Protospacer
.***.**************** **

274. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NC_010355 (Azospirillum phage Cd, complete genome) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggtgccgatcagcccggcgatt	Protospacer
.***.**************** **

275. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggcgcctatcaggccggcgttt	Protospacer
.******* ***** *********

276. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

277. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

278. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggcgcctatcaggccggcgttt	Protospacer
.******* ***** *********

279. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NC_007764 (Rhizobium etli CFN 42 plasmid p42c, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggagccgatcagcccggccttc	Protospacer
**** *************** **.

280. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

281. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP021026 (Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggagccgatcagcccggccttc	Protospacer
**** *************** **.

282. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP020908 (Rhizobium etli strain NXC12 plasmid pRetNXC12b, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggagccgatcagcccggccttc	Protospacer
**** *************** **.

283. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

284. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

285. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

286. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013597 (Rhizobium sp. N741 plasmid pRspN741b, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggagccgatcagcccggccttc	Protospacer
**** *************** **.

287. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

288. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

289. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NC_021907 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1b, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggagccgatcagcccggccttc	Protospacer
**** *************** **.

290. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013501 (Rhizobium esperanzae strain N561 plasmid pRspN561a, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggagccgatcagcccggccttc	Protospacer
**** *************** **.

291. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013507 (Rhizobium sp. N1341 plasmid pRspN1341b, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggagccgatcagcccggccttc	Protospacer
**** *************** **.

292. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013518 (Rhizobium sp. N113 plasmid pRspN113a, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggagccgatcagcccggccttc	Protospacer
**** *************** **.

293. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

294. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013491 (Rhizobium sp. N6212 plasmid pRspN6212a, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggagccgatcagcccggccttc	Protospacer
**** *************** **.

295. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013513 (Rhizobium sp. N1314 plasmid pRspN1314b, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggagccgatcagcccggccttc	Protospacer
**** *************** **.

296. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013496 (Rhizobium sp. N621 plasmid pRspN621a, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggagccgatcagcccggccttc	Protospacer
**** *************** **.

297. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013591 (Rhizobium sp. N871 plasmid pRspN871a, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggagccgatcagcccggccttc	Protospacer
**** *************** **.

298. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

299. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggtgccgatcagcccggcgatt	Protospacer
.***.**************** **

300. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

301. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

302. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

303. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

304. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

305. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

306. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

307. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggtgccgatcagcccggcgatt	Protospacer
.***.**************** **

308. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggtgccgatcagcccggcgatt	Protospacer
.***.**************** **

309. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggtgccgatcagcccggcgatt	Protospacer
.***.**************** **

310. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggtgccgatcagcccggcgatt	Protospacer
.***.**************** **

311. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013603 (Rhizobium sp. N731 plasmid pRspN731b, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggagccgatcagcccggccttc	Protospacer
**** *************** **.

312. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgatg	Protospacer
******** ************ * 

313. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcaggccggccttc	Protospacer
************** ***** **.

314. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_LN831788 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE1, complete sequence) position: , mismatch: 3, identity: 0.889

ccggcgccgccatcgccgaccaggtac-	CRISPR spacer
cccgcgccgccatggccgacca-gtacg	Protospacer
** ********** ******** **** 

315. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 4, identity: 0.852

gtcggcggactcgcggccgacgccggt	CRISPR spacer
ctcggcggcctcgtggccgacgccggc	Protospacer
 ******* ****.************.

316. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 4, identity: 0.852

gtcggcggactcgcggccgacgccggt	CRISPR spacer
ctcggcggcctcgtggccgacgccggc	Protospacer
 ******* ****.************.

317. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 4, identity: 0.852

gtcggcggactcgcggccgacgccggt	CRISPR spacer
gccggcggtctcggggccgacgccggg	Protospacer
*.****** **** ************ 

318. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 4, identity: 0.852

gtcggcggactcgcggccgacgccggt	CRISPR spacer
gccggcggtctcggggccgacgccggg	Protospacer
*.****** **** ************ 

319. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to NZ_CP050100 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b3, complete sequence) position: , mismatch: 4, identity: 0.852

gtcggcggactcgcggccgacgccggt	CRISPR spacer
ttcggcggcgtcgcggccgacgccgat	Protospacer
 *******  ***************.*

320. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to NZ_CP009439 (Streptomyces glaucescens strain GLA.O plasmid pSglau1, complete sequence) position: , mismatch: 4, identity: 0.852

gtcggcggactcgcggccgacgccggt	CRISPR spacer
ctcggcgggctcgcggccggcgccgat	Protospacer
 *******.**********.*****.*

321. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 4, identity: 0.852

gtcggcggactcgcggccgacgccggt	CRISPR spacer
ttcggcggcgtcgcggccgacgccgat	Protospacer
 *******  ***************.*

322. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 4, identity: 0.852

gtcggcggactcgcggccgacgccggt	CRISPR spacer
ggcggcggactccccgccgacgccgct	Protospacer
* ********** * ********** *

323. spacer 4.1|2711030|25|NZ_CP022578|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.84

ggccccgccgccacccgccgagctg	CRISPR spacer
acgcccgccgccacccgccgagcgg	Protospacer
.  ******************** *

324. spacer 4.1|2711030|25|NZ_CP022578|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 4, identity: 0.84

ggccccgccgccacccgccgagctg	CRISPR spacer
ctccccgccgccaccggccgcgctg	Protospacer
  ************* **** ****

325. spacer 4.1|2711030|25|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84

ggccccgccgccacccgccgagctg	CRISPR spacer
accaccgccgccccccgccgagctg	Protospacer
. * ******** ************

326. spacer 4.1|2711030|25|NZ_CP022578|CRT matches to MH338239 (Mycobacterium phage Mryolo, complete genome) position: , mismatch: 4, identity: 0.84

ggccccgccgccacccgccgagctg	CRISPR spacer
atccccgccgccatccgccgcgctg	Protospacer
. ***********.****** ****

327. spacer 4.1|2711030|25|NZ_CP022578|CRT matches to MK305893 (Mycobacterium phage Beatrix, complete genome) position: , mismatch: 4, identity: 0.84

ggccccgccgccacccgccgagctg	CRISPR spacer
atccccgccgccatccgccgcgctg	Protospacer
. ***********.****** ****

328. spacer 4.1|2711030|25|NZ_CP022578|CRT matches to MN617845 (Mycobacterium phage BaconJack, complete genome) position: , mismatch: 4, identity: 0.84

ggccccgccgccacccgccgagctg	CRISPR spacer
tcccccgccgccatccgccgcgctg	Protospacer
  ***********.****** ****

329. spacer 4.1|2711030|25|NZ_CP022578|CRT matches to MK359312 (Mycobacterium phage Fushigi, complete genome) position: , mismatch: 4, identity: 0.84

ggccccgccgccacccgccgagctg	CRISPR spacer
atccccgccgccatccgccgcgctg	Protospacer
. ***********.****** ****

330. spacer 9.11|3215011|27|NZ_CP022578|CRT matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 4, identity: 0.852

gaacggcggcttgctcttcggctccgc	CRISPR spacer
gctcggcggcgtgatcttcggctccgc	Protospacer
*  ******* ** *************

331. spacer 9.13|3215104|24|NZ_CP022578|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 4, identity: 0.833

tgacggtggccacgccggggtgtt	CRISPR spacer
ccgcggcggccacgccggggtgtt	Protospacer
. .***.*****************

332. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP033583 (Streptomyces sp. ADI95-16 plasmid pADI95-16b, complete sequence) position: , mismatch: 4, identity: 0.833

caacgccgtgctgatcggcaacgg	CRISPR spacer
ggacgccgtgctgatcggcaccgc	Protospacer
 .****************** ** 

333. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 4, identity: 0.833

caacgccgtgctgatcggcaacgg	CRISPR spacer
tggcgccgtgctgttcggcaacgg	Protospacer
...********** **********

334. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 4, identity: 0.833

caacgccgtgctgatcggcaacgg	CRISPR spacer
tggcgccgtgctgttcggcaacgg	Protospacer
...********** **********

335. spacer 9.15|3215198|24|NZ_CP022578|CRT matches to NZ_CP041162 (Leisingera aquaemixtae strain R2C4 plasmid unnamed6) position: , mismatch: 4, identity: 0.833

caacgccgtgctgatcggcaacgg	CRISPR spacer
gcccgccgtgctgttcggcaacgg	Protospacer
   ********** **********

336. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_DQ996271 (Burkholderia glumae BGR1 plasmid pBGF3, complete sequence) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
gcgccggcgctgttggtgccgccgaa	Protospacer
******* **.*************. 

337. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
cggccggtgcccttggtgccgccggt	Protospacer
  ***** *** **************

338. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
ttggcggagccggtggtgccgccggt	Protospacer
 .* ******** *************

339. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
ccgccggagcctttggtgtcgccggc	Protospacer
 ********** ******.******.

340. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
gcgccggagccgttggtgccatcgcg	Protospacer
********************..**  

341. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
gcgccggagccgttggtgccatcgcg	Protospacer
********************..**  

342. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
ttggcggagccggtggtgccgccggt	Protospacer
 .* ******** *************

343. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
atgccggtgccgctggtgccgccggt	Protospacer
..***** ****.*************

344. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
cggccggtgcccttggtgccgccggt	Protospacer
  ***** *** **************

345. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to KT281796 (Mycobacterium phage Zakhe101, complete genome) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
aagccggagccgctggtcccgccggt	Protospacer
. **********.**** ********

346. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to AY129335 (Mycobacterium virus Corndog, complete genome) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
aagccggagccgctggtcccgccggt	Protospacer
. **********.**** ********

347. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to MK493325 (Synechococcus phage S-RIM8 isolate RW_62_0316, complete genome) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
gcgctggagccgtttgtgccgccgcc	Protospacer
****.********* ********* .

348. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to MK493322 (Synechococcus phage S-RIM8 isolate RW_01_0115_WH8101, complete genome) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
gcgctggagccgtttgtgccgccgcc	Protospacer
****.********* ********* .

349. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to KX349288 (Synechococcus phage S-RIM8 isolate RW_08_0711, complete genome) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
gcgctggagccgtttgtgccgccgcc	Protospacer
****.********* ********* .

350. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to MN428058 (Mycobacterium phage Krili, complete genome) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
aagccggagccgctggtcccgccggt	Protospacer
. **********.**** ********

351. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to KX349286 (Synechococcus phage S-RIM8 isolate RW_03_0807_WH8101, complete genome) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
gcgctggagccgtttgtgccgccgcc	Protospacer
****.********* ********* .

352. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NC_004685 (Mycobacterium phage Corndog, complete genome) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
aagccggagccgctggtcccgccggt	Protospacer
. **********.**** ********

353. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to JN698993 (Mycobacterium phage Firecracker, complete genome) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
aagccggagccgctggtcccgccggt	Protospacer
. **********.**** ********

354. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to MK493324 (Synechococcus phage S-RIM8 isolate RW_22_0214, complete genome) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
gcgctggagccgtttgtgccgccgcc	Protospacer
****.********* ********* .

355. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to KX349290 (Synechococcus phage S-RIM8 isolate RW_25_1112, complete genome) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
gcgctggagccgtttgtgccgccgcc	Protospacer
****.********* ********* .

356. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to KX349287 (Synechococcus phage S-RIM8 isolate RW_06_0613, complete genome) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
gcgctggagccgtttgtgccgccgcc	Protospacer
****.********* ********* .

357. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to MN585964 (Mycobacterium phage Blessica, complete genome) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
aagccggagccgctggtcccgccggt	Protospacer
. **********.**** ********

358. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NC_022057 (Mycobacterium phage Catdawg, complete genome) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
aagccggagccgctggtcccgccggt	Protospacer
. **********.**** ********

359. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to MT818425 (Mycobacterium phage NiebruSaylor, complete genome) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
aagccggagccgctggtcccgccggt	Protospacer
. **********.**** ********

360. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NC_022325 (Mycobacterium phage Dylan, complete genome) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
aagccggagccgctggtcccgccggt	Protospacer
. **********.**** ********

361. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to MN428052 (Mycobacterium phage Smooch, complete genome) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
aagccggagccgctggtcccgccggt	Protospacer
. **********.**** ********

362. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
tcgccggagccggtggtgctgccgct	Protospacer
 *********** ******.**** *

363. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
tcgccggagccggtggtgctgccgct	Protospacer
 *********** ******.**** *

364. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_AP022578 (Mycolicibacterium aubagnense strain JCM 15296 plasmid pJCM15296, complete sequence) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
gcgcccgagccgttggcgccgccagc	Protospacer
***** **********.******.*.

365. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 4, identity: 0.846

gcgccggagccgttggtgccgccggt	CRISPR spacer
gagccggagccgctggtgccgcccga	Protospacer
* **********.********** * 

366. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 4, identity: 0.846

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccggt	Protospacer
.  * *********************

367. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 4, identity: 0.846

gcggagtcgtcgccggccccgccggt	CRISPR spacer
aaggtgtcgtcgccggcaccgccggt	Protospacer
. ** ************ ********

368. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 4, identity: 0.846

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccggt	Protospacer
.  * *********************

369. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 4, identity: 0.846

gcggagtcgtcgccggccccgccggt	CRISPR spacer
aaggtgtcgttgccggccccgccggt	Protospacer
. ** *****.***************

370. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 4, identity: 0.846

gcggagtcgtcgccggccccgccggt	CRISPR spacer
aaggtgtcgtcgccggccccgccgga	Protospacer
. ** ******************** 

371. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 4, identity: 0.846

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccggt	Protospacer
.  * *********************

372. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 4, identity: 0.846

gcggagtcgtcgccggccccgccggt	CRISPR spacer
aaggtgtcgtcgccggcaccgccggt	Protospacer
. ** ************ ********

373. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 4, identity: 0.846

gcggagtcgtcgccggccccgccggt	CRISPR spacer
aaggtgtcgtcgccggcaccgccggt	Protospacer
. ** ************ ********

374. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccggt	Protospacer
.  * *********************

375. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 4, identity: 0.846

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccggt	Protospacer
.  * *********************

376. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 4, identity: 0.846

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccggt	Protospacer
.  * *********************

377. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 4, identity: 0.846

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccggt	Protospacer
.  * *********************

378. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP015441 (Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846

gcggagtcgtcgccggccccgccggt	CRISPR spacer
gcggagacggcgccggccccgccgca	Protospacer
****** ** **************  

379. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_LR134447 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence) position: , mismatch: 4, identity: 0.846

gcggagtcgtcgccggccccgccggt	CRISPR spacer
gcggagtcctcgccggcgccgccgcc	Protospacer
******** ******** ****** .

380. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 4, identity: 0.846

gcggagtcgtcgccggccccgccggt	CRISPR spacer
tcggcgtcgtcgccggcctcgccgat	Protospacer
 *** *************.*****.*

381. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 4, identity: 0.846

gcggagtcgtcgccggccccgccggt	CRISPR spacer
gcgaagtcgtcgccggccccgatggc	Protospacer
***.***************** .**.

382. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 4, identity: 0.875

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
atcaccgccggtgccgtcgtcgccgccggcct	Protospacer
.** ************.**************.

383. spacer 13.6|4030672|28|NZ_CP022578|CRT matches to NC_008712 (Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence) position: , mismatch: 4, identity: 0.857

ggcacggtgatggtggtgccctgtgcgc-	CRISPR spacer
ggcacggtgatcgtggagccctg-gctcg	Protospacer
*********** **** ****** ** * 

384. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP035418 (Leisingera sp. NJS204 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
gcggcgccgatcagcccggcggca	Protospacer
 ******************** . 

385. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP038237 (Leisingera sp. NJS201 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
gcggcgccgatcagcccggcggca	Protospacer
 ******************** . 

386. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
gcggcgccgatcagcgcggcgtcg	Protospacer
 ************** ******. 

387. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
gaggcgccgatctgcccggcgttg	Protospacer
  ********** ********** 

388. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
gcggcgccgatcagcgcggcgtcg	Protospacer
 ************** ******. 

389. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
gcggcgccgataagcccggcgtca	Protospacer
 ********** **********. 

390. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to LR134132 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgacg	Protospacer
******** ************ . 

391. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
gcggcgccgatcagcgcggcgtcg	Protospacer
 ************** ******. 

392. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
gcggcgccgatcagcgcggcgtcg	Protospacer
 ************** ******. 

393. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgaccagcccggcgaag	Protospacer
**********.**********   

394. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
gcggcgccgatcagcgcggcgtcg	Protospacer
 ************** ******. 

395. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgaacagcccggcgagg	Protospacer
********** **********   

396. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagcacggcgggc	Protospacer
*************** *****  .

397. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgaag	Protospacer
******** ************   

398. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcaggccggcgagg	Protospacer
************** ******   

399. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
gaggcgccgatctgcccggcgttg	Protospacer
  ********** ********** 

400. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagcccgacgagg	Protospacer
******************.**   

401. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagccaggcgaga	Protospacer
**************** ****   

402. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP041043 (Paracoccus sp. AK26 plasmid pAK3, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgacgatcagcccggcgacc	Protospacer
****** ************** ..

403. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
gaggcgccgatctgcccggcgttg	Protospacer
  ********** ********** 

404. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP024583 (Roseomonas sp. FDAARGOS_362 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagcccgccgaag	Protospacer
****************** **   

405. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagccaggcgagg	Protospacer
**************** ****   

406. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagccaggcgaga	Protospacer
**************** ****   

407. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
gaggcgccgatctgcccggcgttg	Protospacer
  ********** ********** 

408. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
tcggcgccgatcagcccgtcgtca	Protospacer
.***************** ***. 

409. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagccaggcgagg	Protospacer
**************** ****   

410. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagccaggcgagg	Protospacer
**************** ****   

411. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagccaggcgagg	Protospacer
**************** ****   

412. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgcccatcagcccggcgaag	Protospacer
******** ************   

413. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagccaggcgagg	Protospacer
**************** ****   

414. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagccaggcgagg	Protospacer
**************** ****   

415. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagcacggcgggc	Protospacer
*************** *****  .

416. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to MK494131 (Mycobacterium phage GodPhather, complete genome) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagcgcggcgcca	Protospacer
*************** *****.. 

417. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to MH001450 (Mycobacterium phage Jeon, complete genome) position: , mismatch: 4, identity: 0.833

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagcgcggcgcca	Protospacer
*************** *****.. 

418. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 4, identity: 0.852

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccgccgccgccatcgccgcccaggtcg	Protospacer
*** ************** ******  

419. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
tcggcgccgccatcgccgacgaggaag	Protospacer
.******************* *** * 

420. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 4, identity: 0.852

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccctcgccgacgaggtgg	Protospacer
*********** ******** ****. 

421. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to MN586047 (Gordonia phage EMoore, complete genome) position: , mismatch: 4, identity: 0.852

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgtcatcgccgagcaggtcg	Protospacer
*********.********* *****  

422. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 4, identity: 0.852

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccaccatcgccgacctggcgc	Protospacer
********.************ **..*

423. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 4, identity: 0.852

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
gcggcgtcgccatcggcgaccaggtgc	Protospacer
 *****.******** *********.*

424. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccgacgccgccatagccgaccaggccc	Protospacer
***.********* **********. *

425. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.852

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccgacgccgccatagccgaccaggccc	Protospacer
***.********* **********. *

426. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 4, identity: 0.852

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgtccccatcgccgaccaggaag	Protospacer
******.* *************** * 

427. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to MN657133 (Cryobacterium sp. strain ANT_H10B plasmid pA10BH1, complete sequence) position: , mismatch: 5, identity: 0.815

gtcggcggactcgcggccgacgccggt	CRISPR spacer
gcgtgcggtctcgcggccgacgccggc	Protospacer
*.  **** *****************.

428. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 5, identity: 0.815

gtcggcggactcgcggccgacgccggt	CRISPR spacer
ggcggcggactcgcggccgtcgccatc	Protospacer
* ***************** ****. .

429. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

gtcggcggactcgcggccgacgccggt	CRISPR spacer
tgcggcggactggcggtcgacgccggc	Protospacer
  ********* ****.*********.

430. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to MK937603 (Gordonia phage Bakery, complete genome) position: , mismatch: 5, identity: 0.815

gtcggcggactcgcggccgacgccggt	CRISPR spacer
gacggcggactcgcggtcgccgccgcg	Protospacer
* **************.** *****  

431. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to KM389402 (UNVERIFIED: Pseudomonas phage F_HA1961sp/Pa1641 clone contig00002 genomic sequence) position: , mismatch: 5, identity: 0.815

gtcggcggactcgcggccgacgccggt	CRISPR spacer
ctggccgtactcgcggccgacgccggc	Protospacer
 * * ** ******************.

432. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to NC_003278 (Pseudomonas phage phiCTX, complete genome) position: , mismatch: 5, identity: 0.815

gtcggcggactcgcggccgacgccggt	CRISPR spacer
ctggccgtactcgcggccgacgccggc	Protospacer
 * * ** ******************.

433. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to Y13918 (Pseudomonas aeruginosa phage phi CTX DNA, complete genome) position: , mismatch: 5, identity: 0.815

gtcggcggactcgcggccgacgccggt	CRISPR spacer
ctggccgtactcgcggccgacgccggc	Protospacer
 * * ** ******************.

434. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to AB008550 (Pseudomonas phage phiCTX DNA, complete genome) position: , mismatch: 5, identity: 0.815

gtcggcggactcgcggccgacgccggt	CRISPR spacer
ctggccgtactcgcggccgacgccggc	Protospacer
 * * ** ******************.

435. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to MK034952 (Pseudomonas phage Dobby, complete genome) position: , mismatch: 5, identity: 0.815

gtcggcggactcgcggccgacgccggt	CRISPR spacer
ctggccgtactcgcggccgacgccggc	Protospacer
 * * ** ******************.

436. spacer 3.7|1499938|30|NZ_CP022578|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.833

gacggcgggttgttcttcggcgtgggcggt	CRISPR spacer
gccggcgggttgttctgcggcgttggcgca	Protospacer
* ************** ****** ****  

437. spacer 3.7|1499938|30|NZ_CP022578|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

gacggcgggttgttcttcggcgtgggcggt	CRISPR spacer
gccggcgggttgttctgcggcgttggcgca	Protospacer
* ************** ****** ****  

438. spacer 9.11|3215011|27|NZ_CP022578|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 5, identity: 0.815

gaacggcggcttgctcttcggctccgc	CRISPR spacer
catcggcggctttctcttcggcttcgt	Protospacer
 * ********* **********.**.

439. spacer 9.14|3215149|28|NZ_CP022578|CRT matches to NZ_CP011276 (Planctomyces sp. SH-PL62 plasmid pPL62-3, complete sequence) position: , mismatch: 5, identity: 0.821

ttgccggcgggtttggcgccggtaccgg	CRISPR spacer
gcgccggcgggttcggcgccggtaacgc	Protospacer
 .***********.********** ** 

440. spacer 9.14|3215149|28|NZ_CP022578|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.821

ttgccggcgggtttggcgccggtaccgg	CRISPR spacer
ttgccggcgggtttggggccgggcgggg	Protospacer
**************** *****    **

441. spacer 9.14|3215149|28|NZ_CP022578|CRT matches to CP048434 (Collinsella aerofaciens ATCC 25986 strain JCM 10188 plasmid putative_pCaero1, complete sequence) position: , mismatch: 5, identity: 0.821

ttgccggcgggtttggcgccggtaccgg	CRISPR spacer
tgtgcggcggatttcgcgccggtaccgg	Protospacer
*   ******.*** *************

442. spacer 9.14|3215149|28|NZ_CP022578|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.821

ttgccggcgggtttggcgccggtaccgg	CRISPR spacer
ttgccggcgggtttggggccgggcgggg	Protospacer
**************** *****    **

443. spacer 9.14|3215149|28|NZ_CP022578|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

ttgccggcgggtttggcgccggtaccgg	CRISPR spacer
ttgccggccgggttggcgccggtgacgt	Protospacer
******** ** ***********. ** 

444. spacer 9.14|3215149|28|NZ_CP022578|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.821

ttgccggcgggtttggcgccggtaccgg	CRISPR spacer
ttgccggccgggttggcgccggtgacgt	Protospacer
******** ** ***********. ** 

445. spacer 9.14|3215149|28|NZ_CP022578|CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ttgccggcgggtttggcgccggtaccgg	CRISPR spacer
ttgccggccgggttggcgccggtgacgt	Protospacer
******** ** ***********. ** 

446. spacer 9.14|3215149|28|NZ_CP022578|CRT matches to JN698994 (Mycobacterium phage DS6A, complete genome) position: , mismatch: 5, identity: 0.821

ttgccggcgggtttggcgccggtaccgg	CRISPR spacer
ctgccggcgggttaggcgccggcgcagg	Protospacer
.************ ********..* **

447. spacer 11.1|4009127|29|NZ_CP022578|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.828

ccggtggctgcccctccgtcggcgccatc	CRISPR spacer
ccggtgggtgctcctccgtcggcgcacac	Protospacer
******* ***.*************   *

448. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 5, identity: 0.828

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
gtgccgccgatgttgccgttgctgccggt	Protospacer
********* **.***********  * *

449. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828

----gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
atcggtg----cggtgctgccgttgctgaagct	Protospacer
    ***    ** *******************

450. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.828

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
gtgccgccgttgccgccgttgccgccgtt	Protospacer
*************.********.*  *.*

451. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_CP022195 (Yangia pacifica strain YSBP01 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.828

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
gcggcgccgttgctggcgatgctgaagcc	Protospacer
*.* *********** ** *********.

452. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.828

gtgc-cgccgttgctgccgttgctgaagct	CRISPR spacer
-tacgcgcggttgctgccgtcgctgaagtt	Protospacer
 *.* *** ***********.*******.*

453. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 5, identity: 0.828

gtgc-cgccgttgctgccgttgctgaagct	CRISPR spacer
-tacgcgcggttgctgccgtcgctgaagtt	Protospacer
 *.* *** ***********.*******.*

454. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.808

gcgccggagccgttggtgccgccggt	CRISPR spacer
atgccggagccgttgatgccgccgcc	Protospacer
..*************.******** .

455. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.808

gcgccggagccgttggtgccgccggt	CRISPR spacer
atgccggagccgttgatgccgccgcc	Protospacer
..*************.******** .

456. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 5, identity: 0.808

gcgccggagccgttggtgccgccggt	CRISPR spacer
ccgccggagccgttgttgccgcgtat	Protospacer
 ************** ******  .*

457. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 5, identity: 0.808

gcgccggagccgttggtgccgccggt	CRISPR spacer
ccgccggagccgttgttgccgcgtat	Protospacer
 ************** ******  .*

458. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 5, identity: 0.808

gcgccggagccgttggtgccgccggt	CRISPR spacer
gcgccgcagccggtggtgccgcctcc	Protospacer
****** ***** **********  .

459. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 5, identity: 0.808

gcgccggagccgttggtgccgccggt	CRISPR spacer
gcgccgcagccggtggtgccgcctcc	Protospacer
****** ***** **********  .

460. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

gcgccggagccgttggtgccgccggt	CRISPR spacer
ccgccggagccgttcttgccgccgcc	Protospacer
 *************  ******** .

461. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to MT855965 (Microcystis phage vB_MaeS-yong1, complete genome) position: , mismatch: 5, identity: 0.808

gcgccggagccgttggtgccgccggt	CRISPR spacer
ccgcccgagccgttgctgccgccgcg	Protospacer
 **** ********* ********  

462. spacer 11.7|4009616|26|NZ_CP022578|CRT matches to MN585977 (Mycobacterium phage Atcoo, complete genome) position: , mismatch: 5, identity: 0.808

gcgccggagccgttggtgccgccggt	CRISPR spacer
ccgccggtgccgctggtgccgccgcg	Protospacer
 ****** ****.***********  

463. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agacggtcgtcgccggccccgccggt	Protospacer
. . .*********************

464. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccgga	Protospacer
.  * ******************** 

465. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccgtt	Protospacer
.  * ******************* *

466. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggcaccgccggt	Protospacer
.  * ************ ********

467. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
aagatgtcgttgccggccccgccggt	Protospacer
. *. *****.***************

468. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccgga	Protospacer
.  * ******************** 

469. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
aagacgtcgttgccggccccgccggt	Protospacer
. *. *****.***************

470. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccgtt	Protospacer
.  * ******************* *

471. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
aggctgtcgtcgccggccccgccggc	Protospacer
. *  ********************.

472. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
tagctgtcgtcgccggccccgccgat	Protospacer
  *  *******************.*

473. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agacggtcgtcgccggccccgccggt	Protospacer
. . .*********************

474. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agacggtcgtcgccggccccgccggt	Protospacer
. . .*********************

475. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccgga	Protospacer
.  * ******************** 

476. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggcaccgccggt	Protospacer
.  * ************ ********

477. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccgtt	Protospacer
.  * ******************* *

478. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
aagatgtcgttgccggccccgccggt	Protospacer
. *. *****.***************

479. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggcaccgccggt	Protospacer
.  * ************ ********

480. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccgtt	Protospacer
.  * ******************* *

481. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccgga	Protospacer
.  * ******************** 

482. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcaccggccccgccggt	Protospacer
.  * ******.**************

483. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccgtt	Protospacer
.  * ******************* *

484. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
tcggagtcgtcaccggcgccgccgcg	Protospacer
 **********.***** ******  

485. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
ccggagtcgtcgccgccctcgccgcg	Protospacer
 ************** **.*****  

486. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
gcactctcgtcgccggccccgccggg	Protospacer
**.   ******************* 

487. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
tcggagtcgtcaccggcgccgccgcg	Protospacer
 **********.***** ******  

488. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
tcggagtcgtcaccggcgccgccgcg	Protospacer
 **********.***** ******  

489. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
tcggagtcgtcaccggcgccgccgcg	Protospacer
 **********.***** ******  

490. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agggagtcgtcgccgtcctcgccgga	Protospacer
. ************* **.****** 

491. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
atcgtgtcgtcgccgcccccgccggt	Protospacer
.. * ********** **********

492. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP041042 (Paracoccus sp. AK26 plasmid pAK4, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agggtgtcgtcgcctgccccgccgga	Protospacer
. ** ********* ********** 

493. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NC_019959 (Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
caggtgtcgccgccggccccgccggg	Protospacer
  ** ****.*************** 

494. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_MN366361 (Bacterium plasmid pALTS33, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
acggagccgtcgccggcctcgccgcc	Protospacer
.*****.***********.***** .

495. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.808

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgttgccggccccgccggt	Protospacer
.  * *****.***************

496. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 5, identity: 0.844

ttgccggggtcgccggcgccggtgcctgcgtt-	CRISPR spacer
cggccggggtcgccgtcgccggtgctt-cgttc	Protospacer
. ************* *********.* **** 

497. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

ttgccggggtcgccggcgccggt--gcctgcgtt	CRISPR spacer
ttgccggggtcgccggctgcggtgggcttgcg--	Protospacer
*****************  ****  **.****  

498. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 5, identity: 0.844

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gcctccgccggtgccgccgtcgccgccgcagc	Protospacer
*.*.************************   *

499. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 5, identity: 0.844

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gtccccgcccgtgccgccgccgccgccgatcg	Protospacer
********* *********.********..* 

500. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 5, identity: 0.844

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gccgccgccggtgccgccgtggccgccggtgc	Protospacer
*.* **************** ********. *

501. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gtatccgccggtcccgccggcgccgccggcac	Protospacer
** .******** ****** ********** *

502. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.844

gtccccgccggtgccgccgtcgccg--ccggccc	CRISPR spacer
gtcccggccggtgccgccgtccccgtttcggc--	Protospacer
***** *************** ***  .****  

503. spacer 13.6|4030672|28|NZ_CP022578|CRT matches to NC_034248 (Rhizobium phage RHEph10, complete genome) position: , mismatch: 5, identity: 0.821

ggcacggtgatggtggtgccctgtgcgc	CRISPR spacer
ggaacggtaatggtggtgccctggacga	Protospacer
** *****.************** .** 

504. spacer 14.1|4159156|27|NZ_CP022578|CRT matches to MN583270 (Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence) position: , mismatch: 5, identity: 0.815

cttagcaagccgccattcccgccgttg	CRISPR spacer
ccatgcaggccgccattcccgccggtg	Protospacer
*.  ***.**************** **

505. spacer 14.1|4159156|27|NZ_CP022578|CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 5, identity: 0.815

cttagcaagccgccattcccgccgttg	CRISPR spacer
ccatgcaggccgccattcccgccggtg	Protospacer
*.  ***.**************** **

506. spacer 14.1|4159156|27|NZ_CP022578|CRT matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 5, identity: 0.815

cttagcaagccgccattcccgccgttg	CRISPR spacer
ccatgcaggccgccattcccgccggtg	Protospacer
*.  ***.**************** **

507. spacer 14.6|4159450|27|NZ_CP022578|CRT matches to NZ_CP030128 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

acgccaccggtttggtttccgccggcg	CRISPR spacer
catccaccgatttggcttccgccggcg	Protospacer
   ******.*****.***********

508. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP041156 (Leisingera aquaemixtae strain R2C4 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.792

ccggcgccgatcagcccggcgttt	CRISPR spacer
gcggcgccgatcagcccggctgcg	Protospacer
 *******************  . 

509. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP016620 (Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.792

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagcccggatggc	Protospacer
*******************    .

510. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.792

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagcccggatggc	Protospacer
*******************    .

511. spacer 14.7|4159498|24|NZ_CP022578|CRT matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.792

ccggcgccgatcagcccggcgttt	CRISPR spacer
ccggcgccgatcagcccggatggc	Protospacer
*******************    .

512. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgccgccgtacagccacccggcctgt	Protospacer
****.****** ************  .

513. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgccgccgtacagccacccggcctgt	Protospacer
****.****** ************  .

514. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MK359320 (Mycobacterium phage Cookies, complete genome) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatcgag	Protospacer
****************** **..**  

515. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to KX611831 (Mycobacterium phage Pharsalus, complete genome) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatcgag	Protospacer
****************** **..**  

516. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to NC_041844 (Mycobacterium phage Optimus, complete genome) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatcgag	Protospacer
****************** **..**  

517. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatcgag	Protospacer
****************** **..**  

518. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MH230878 (Mycobacterium phage Oogway, complete genome) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatcgag	Protospacer
****************** **..**  

519. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MN585999 (Mycobacterium phage Briton15, complete genome) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatcgag	Protospacer
****************** **..**  

520. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MG962370 (Mycobacterium phage Kykar, complete genome) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatcgag	Protospacer
****************** **..**  

521. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MH576975 (Mycobacterium phage Target, complete genome) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatcgag	Protospacer
****************** **..**  

522. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MK359331 (Mycobacterium phage Rajelicia, complete genome) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatcgag	Protospacer
****************** **..**  

523. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MH744414 (Mycobacterium phage Arcanine, complete genome) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatcgag	Protospacer
****************** **..**  

524. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to KF493880 (Mycobacterium phage HanShotFirst, complete genome) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatcgag	Protospacer
****************** **..**  

525. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to JF937103 (Mycobacterium virus Museum, complete genome) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatcgag	Protospacer
****************** **..**  

526. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MH576971 (Mycobacterium phage Arlo, complete genome) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatcgag	Protospacer
****************** **..**  

527. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MH697575 (Mycobacterium phage Adahisdi, complete genome) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatcgag	Protospacer
****************** **..**  

528. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to KJ409696 (Mycobacterium phage Lamina13, complete genome) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatcgag	Protospacer
****************** **..**  

529. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to NC_028784 (Mycobacterium phage Tasp14, complete genome) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatcgag	Protospacer
****************** **..**  

530. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to KT259047 (Mycobacterium phage Rufus, complete genome) position: , mismatch: 5, identity: 0.815

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatcgag	Protospacer
****************** **..**  

531. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccgccgccgccatcgccgaccagaccg	Protospacer
*** *******************..  

532. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccgtcgccgccaccgccgaccaggccg	Protospacer
*** ********.***********.  

533. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
cccgcgccgccatcgccgcccaggccg	Protospacer
** *************** *****.  

534. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
cccgcgccgccatcgccgcccaggccg	Protospacer
** *************** *****.  

535. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgttatcgccgaccaggccg	Protospacer
*********..*************.  

536. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
tcggcgccgccattgccgtccaggtcg	Protospacer
.************.**** ******  

537. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccgtcgccgaccaccagc	Protospacer
***********.**********   .*

538. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccgtcgccgaccaccagc	Protospacer
***********.**********   .*

539. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
cccgcgccgccatcgccgcccaggccg	Protospacer
** *************** *****.  

540. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
cccgcgccgccatcgccgcccaggccg	Protospacer
** *************** *****.  

541. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccaccgccgatcaggcga	Protospacer
************.******.****.. 

542. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
cgggcgccgccatcgccgtccagctcg	Protospacer
* **************** **** *  

543. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP042276 (Agrobacterium tumefaciens strain 186 plasmid pAt, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
cgatcgccgccatcgtcgaccagggac	Protospacer
* . ***********.******** **

544. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
tcggcgccgccctcgccgacaaggatc	Protospacer
.********** ******** ***  *

545. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_007491 (Rhodococcus erythropolis PR4 plasmid pREL1, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgtcgacaagatca	Protospacer
***************.**** **.*  

546. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
tcctcgccgccatcgccgagcagctac	Protospacer
.*  *************** *** ***

547. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
tcggtgccggcatcgccgaccagggtc	Protospacer
.***.**** **************  *

548. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
tcggtgccggcatcgccgaccagggtc	Protospacer
.***.**** **************  *

549. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP011297 (Rhodococcus erythropolis strain BG43 plasmid pRLLBG43, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgtcgacaagatca	Protospacer
***************.**** **.*  

550. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgacc-aggtac	CRISPR spacer
ccggcgccgccatcgacgaccttagca-	Protospacer
*************** *****  .*.* 

551. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP017304 (Rhodococcus sp. YL-1 plasmid pYLL2 sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgtcgacaagatca	Protospacer
***************.**** **.*  

552. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_005073 (Rhodococcus erythropolis linear plasmid pBD2, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgtcgacaagatca	Protospacer
***************.**** **.*  

553. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP016820 (Rhodococcus sp. p52 plasmid pDF02, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgacgacatcgccgaccagatca	Protospacer
****** ** *************.*  

554. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP042915 (Rhodococcus qingshengii strain RL1 plasmid unnamed2) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgtcgacaagatca	Protospacer
***************.**** **.*  

555. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP042915 (Rhodococcus qingshengii strain RL1 plasmid unnamed2) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgtcgacaagatca	Protospacer
***************.**** **.*  

556. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP042915 (Rhodococcus qingshengii strain RL1 plasmid unnamed2) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgtcgacaagatca	Protospacer
***************.**** **.*  

557. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
tcctcgccgccatcgccgagcagctac	Protospacer
.*  *************** *** ***

558. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgtcgacaagatca	Protospacer
***************.**** **.*  

559. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccggcattgccgaccagcagc	Protospacer
********* ***.*********  .*

560. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to CP000385 (Mycobacterium sp. MCS Plasmid1, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccattggcgaccagcccc	Protospacer
*************.* ******* . *

561. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgtcgacaagatca	Protospacer
***************.**** **.*  

562. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgtcgacaagatca	Protospacer
***************.**** **.*  

563. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
tcggcgccgccgccgccgaccaggccc	Protospacer
.**********..***********. *

564. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac---	CRISPR spacer
acggcgccgccatcgccgac---gtcctca	Protospacer
 *******************   ** *   

565. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP046100 (Rhodococcus sp. AQ5-07 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgtcgacaagatca	Protospacer
***************.**** **.*  

566. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
tcggcgccgccgccgccgaccaggccc	Protospacer
.**********..***********. *

567. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
tcggcgccgccgccgccgaccaggccc	Protospacer
.**********..***********. *

568. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgtcgacaagatca	Protospacer
***************.**** **.*  

569. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgtcgacaagatca	Protospacer
***************.**** **.*  

570. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP017300 (Rhodococcus sp. YL-1 plasmid pYLC1, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgtcgacaagatca	Protospacer
***************.**** **.*  

571. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP017303 (Rhodococcus sp. YL-1 plasmid pYLL1 sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgtcgacaagatca	Protospacer
***************.**** **.*  

572. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccggcgccgaccagcagc	Protospacer
***********. **********  .*

573. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
cccgcgccgccatcgccgacgagctga	Protospacer
** ***************** ** *. 

574. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP050125 (Rhodococcus erythropolis strain KB1 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgtcgacaagatca	Protospacer
***************.**** **.*  

575. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_008704 (Mycobacterium sp. KMS plasmid pMKMS02, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccattggcgaccagcccc	Protospacer
*************.* ******* . *

576. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
tcctcgccgccatcgccgagcagctac	Protospacer
.*  *************** *** ***

577. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
tcggcgccgccagcgcctaccaggccc	Protospacer
.*********** **** ******. *

578. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP045549 (Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
agggcgccgccctcgccgaccacgtgc	Protospacer
  ********* ********** **.*

579. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgtcgacaagatca	Protospacer
***************.**** **.*  

580. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgtcgacaagatca	Protospacer
***************.**** **.*  

581. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 5, identity: 0.815

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
acgtcgccgccatcgccgcccaggcgc	Protospacer
 ** ************** *****..*

582. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 6, identity: 0.778

gtcggcggactcgcggccgacgccggt	CRISPR spacer
ctcggcggcctggcggccgacgccccg	Protospacer
 ******* ** ************   

583. spacer 3.6|1499893|27|NZ_CP022578|CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 6, identity: 0.778

gtcggcggactcgcggccgacgccggt	CRISPR spacer
cgcggcgaactcgcggccggcgccgtc	Protospacer
  *****.***********.***** .

584. spacer 3.7|1499938|30|NZ_CP022578|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 6, identity: 0.8

gacggcgggttgttcttcggcgtgggcggt	CRISPR spacer
gtgagcgggttgttcctcggcgtggggggc	Protospacer
*  .***********.********** **.

585. spacer 3.7|1499938|30|NZ_CP022578|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gacggcgggttgttcttcggcgtgggcggt	CRISPR spacer
gccggcgggttgttctgcggcgttggtgca	Protospacer
* ************** ****** **.*  

586. spacer 3.7|1499938|30|NZ_CP022578|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

gacggcgggttgttcttcggcgtgggcggt	CRISPR spacer
gccggcgggttgttctgcggcgttggtgca	Protospacer
* ************** ****** **.*  

587. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806

gggtcca----acggttcggcttgccgttcgcgct	CRISPR spacer
----ccagcgcatggttcggctggccgttcgcgct	Protospacer
    ***    *.********* ************

588. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
gaaaatgccgtcgatgccggcaacgccgag	Protospacer
**.* .*****.************.**** 

589. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
gaaaatgccgtcgatgccggcaacgccgag	Protospacer
**.* .*****.************.**** 

590. spacer 11.1|4009127|29|NZ_CP022578|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 6, identity: 0.793

ccggtggctgcccctccgtcggcgccatc	CRISPR spacer
ccggtggtcgcccctccgtcggcgacgat	Protospacer
*******..*************** *. .

591. spacer 11.1|4009127|29|NZ_CP022578|CRT matches to MK305891 (Streptomyces phage Gibson, complete genome) position: , mismatch: 6, identity: 0.793

ccggtggctgcccctccgtcggcgccatc	CRISPR spacer
gcggcggctgccactccgtcggcgtagtc	Protospacer
 ***.******* ***********. .**

592. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
tcgccgccgttgatgccgttgttgaagac	Protospacer
 .********** ********.***** .

593. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct---	CRISPR spacer
gtgccgccgatgctgccgt---tggcgctcag	Protospacer
********* *********   **. ***   

594. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_CP014799 (Salipiger profundus strain JLT2016 plasmid pTPRO3, complete sequence) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
tcgccgccgttgcggccgttgctgaggaa	Protospacer
 .*********** ***********.*  

595. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
gacccgctgttgctgccgttgctgaaagc	Protospacer
*  ****.******************. .

596. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ttgccgccgttgccgccgttgctggactc	Protospacer
 ************.**********.* ..

597. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ttgccgccgttgccgccgttgccgccgtt	Protospacer
 ************.********.*  *.*

598. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
gatccgctgctgctgccgttgctgaaggc	Protospacer
*  ****.*.***************** .

599. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
gatccgctgctgctgccgttgctgaaggc	Protospacer
*  ****.*.***************** .

600. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgtttctgccgtcgctgatccg	Protospacer
 ********** *******.*****  * 

601. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_031109 (Gordonia phage Jumbo, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
gtgccgccggtgctgccggtgctgcgggc	Protospacer
********* ******** ***** .* .

602. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccggt	Protospacer
 ************.********.*  * *

603. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccggt	Protospacer
 ************.********.*  * *

604. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccggt	Protospacer
 ************.********.*  * *

605. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK494110 (Mycobacterium phage SwagPigglett, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

606. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH479919 (Mycobacterium phage Moose, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

607. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to KY012363 (Mycobacterium phage Empress, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

608. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccggt	Protospacer
 ************.********.*  * *

609. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH669010 (Mycobacterium phage PHappiness, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

610. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH669003 (Mycobacterium phage Girr, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

611. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MG925342 (Mycobacterium phage Forsytheast, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

612. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK359354 (Mycobacterium phage PinkPlastic, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

613. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH632118 (Mycobacterium phage Zeeculate, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

614. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MG872836 (Mycobacterium phage Fajezeel, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

615. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MN585999 (Mycobacterium phage Briton15, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

616. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MG872841 (Mycobacterium phage Priscilla, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

617. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH155865 (Mycobacterium phage BobaPhett, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

618. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MN585985 (Mycobacterium phage Watermelon, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

619. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccggt	Protospacer
 ************.********.*  * *

620. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccggt	Protospacer
 ************.********.*  * *

621. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH651169 (Mycobacterium phage Burwell21, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

622. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MG925344 (Mycobacterium phage Ichabod, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

623. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK359315 (Mycobacterium phage MisterCuddles, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

624. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH697581 (Mycobacterium phage Crispicous1, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

625. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK359299 (Mycobacterium phage Petp2012, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

626. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH371120 (Mycobacterium phage OlympiaSaint, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

627. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MF190168 (Mycobacterium phage Spoonbill, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

628. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MG925340 (Mycobacterium phage Corvo, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

629. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccggt	Protospacer
 ************.********.*  * *

630. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MN735433 (Mycobacterium phage Scottish, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

631. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MG920060 (Mycobacterium phage Bob3, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

632. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH338239 (Mycobacterium phage Mryolo, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

633. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH651183 (Mycobacterium phage Nivrat, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

634. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_021297 (Mycobacterium phage PattyP, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

635. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to KY224001 (Mycobacterium phage Blue, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

636. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MF919508 (Mycobacterium phage ILeeKay, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

637. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to AY500152 (Mycobacteriophage U2, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

638. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MG770213 (Mycobacterium phage OldBen, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

639. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK967387 (Mycobacterium phage Big3, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

640. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH651188 (Mycobacterium phage Ruby, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

641. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_041989 (Mycobacterium phage Shauna1, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

642. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to JN020140 (Mycobacterium virus MrGordo, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

643. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH834617 (Mycobacterium phage Lizziana, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

644. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to EU744251 (Mycobacterium phage Jasper, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

645. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK524499 (Mycobacterium phage Tripl3t, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

646. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK820638 (Mycobacterium phage HermioneGrange, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

647. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_041988 (Mycobacterium phage ShiLan, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

648. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to KX522649 (Mycobacterium phage Bircsak, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

649. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK524517 (Mycobacterium phage James, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

650. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccggt	Protospacer
 ************.********.*  * *

651. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccggt	Protospacer
 ************.********.*  * *

652. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MG962372 (Mycobacterium phage McGuire, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

653. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK305893 (Mycobacterium phage Beatrix, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

654. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK016494 (Mycobacterium phage Filuzino, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

655. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to KM066034 (Mycobacterium phage Inventum, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

656. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MN586011 (Mycobacterium phage LilMoolah, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

657. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to KT438500 (Mycobacterium phage Pari, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

658. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH338238 (Mycobacterium phage Michley, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

659. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH399784 (Mycobacterium phage NormanBulbieJr, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

660. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MT310893 (Mycobacterium phage DRBy19, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

661. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH399771 (Mycobacterium phage ByChance, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

662. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to KX522943 (Mycobacterium phage Gompeii16, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

663. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to KY702574 (Mycobacterium phage Kingsley, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

664. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH450133 (Mycobacterium phage SwissCheese, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

665. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_009877 (Mycobacterium phage U2, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

666. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to KJ025956 (Mycobacterium phage Saal, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

667. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MN813700 (Mycobacterium phage Atkinbua, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

668. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_024136 (Mycobacterium phage Seabiscuit, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

669. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MN369751 (Mycobacterium phage TDanisky, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

670. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MT639644 (Mycobacterium phage MaryBeth, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

671. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MT639654 (Mycobacterium phage Jerm2, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

672. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH590602 (Mycobacterium phage Gorge, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

673. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to JF937108 (Mycobacterium phage Switzer, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

674. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to JN660814 (Mycobacterium phage Dreamboat, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

675. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccggt	Protospacer
 ************.********.*  * *

676. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH669011 (Mycobacterium phage PherrisBueller, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

677. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_023687 (Mycobacterium phage Bruns, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

678. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK310141 (Mycobacterium phage Fenn, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

679. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to JF937103 (Mycobacterium virus Museum, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

680. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH669005 (Mycobacterium phage JoeyJr, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

681. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_028654 (Mycobacterium phage Sparkdehlily, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

682. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK524523 (Mycobacterium phage Naira, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

683. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH450113 (Mycobacterium phage BigMau, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

684. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MN444869 (Mycobacterium phage DreamCatcher, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

685. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_023695 (Mycobacterium phage Violet, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

686. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MG812495 (Mycobacterium phage Pippin, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

687. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_023726 (Mycobacterium phage Euphoria, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

688. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MG812489 (Mycobacterium phage Greg, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

689. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MT310897 (Mycobacterium phage Manatee, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

690. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH155871 (Mycobacterium phage Mattes, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

691. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MN204502 (Mycobacterium phage KingMidas, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

692. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_022068 (Mycobacteriophage Daenerys, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

693. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK310142 (Mycobacterium phage MetalQZJ, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

694. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to KT895281 (Mycobacterium phage Cabrinians, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

695. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_031041 (Mycobacterium phage Papez, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

696. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH513971 (Mycobacterium phage Hope4ever, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgccgctgaagct	Protospacer
 ** . ************..*********

697. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH450130 (Mycobacterium phage Rohr, complete genome) position: , mismatch: 6, identity: 0.793

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctggttccgttgctgccgctgctgatgct	Protospacer
 ** . ************.****** ***

698. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.769

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccgta	Protospacer
.  * *******************  

699. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 6, identity: 0.769

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccgtc	Protospacer
.  * ******************* .

700. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 6, identity: 0.769

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccgtc	Protospacer
.  * ******************* .

701. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.769

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccgtc	Protospacer
.  * ******************* .

702. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.769

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccgta	Protospacer
.  * *******************  

703. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.769

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccgta	Protospacer
.  * *******************  

704. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 6, identity: 0.769

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccgta	Protospacer
.  * *******************  

705. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.769

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agacgatcgtcgccggccccgccggt	Protospacer
. . ..********************

706. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.769

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcgtgtcgtcgccggccccgccgtc	Protospacer
.  * ******************* .

707. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 6, identity: 0.769

gcggagtcgtcgccggccccgccggt	CRISPR spacer
aggatgtcgtcgccggccccgccgaa	Protospacer
. *. *******************. 

708. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP045303 (Azotobacter salinestris strain KACC 13899 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.769

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agatagtcgtcgccagccccgccggc	Protospacer
. . **********.**********.

709. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 6, identity: 0.769

gcggagtcgtcgccggccccgccggt	CRISPR spacer
cgatcgtcgtcgccggccgcgccggt	Protospacer
  .  ************* *******

710. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 6, identity: 0.769

gcggagtcgtcgccggccccgccggt	CRISPR spacer
tgatcgtcggcgccggccccgccggt	Protospacer
  .  **** ****************

711. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 6, identity: 0.769

gcggagtcgtcgccggccccgccggt	CRISPR spacer
tggcgatcgtcgccggccccgccggc	Protospacer
  * ..*******************.

712. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 6, identity: 0.769

gcggagtcgtcgccggccccgccggt	CRISPR spacer
tggcgatcgtcgccggccccgccggc	Protospacer
  * ..*******************.

713. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.769

gcggagtcgtcgccggccccgccggt	CRISPR spacer
atggagtcgtcgcccgccccgccatc	Protospacer
..************ ********. .

714. spacer 11.12|4010003|29|NZ_CP022578|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 6, identity: 0.793

ttgaagttggccccgccgctaccgccggc	CRISPR spacer
agccagttgggcccgccgataccgccggc	Protospacer
    ****** ******* **********

715. spacer 11.12|4010003|29|NZ_CP022578|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.793

ttgaagttggccccgccgctaccgccggc	CRISPR spacer
agccagttgggcccgccgataccgccggc	Protospacer
    ****** ******* **********

716. spacer 11.12|4010003|29|NZ_CP022578|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 6, identity: 0.793

ttgaagttggccccgccgctaccgccggc	CRISPR spacer
ctgttgtcggccccgccgctgccgccggg	Protospacer
.**  **.************.******* 

717. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 6, identity: 0.812

ttgccgg--ggtcgccggcgccggtgcctgcgtt	CRISPR spacer
--gccggctggtcgccgccgccggcgcctgcgcc	Protospacer
  *****  ******** ******.*******..

718. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 6, identity: 0.812

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gatgccgcccgcattgccgttgccggcgacag	Protospacer
. ******* *******************   

719. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 6, identity: 0.812

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
atggccgccggcattgccgttgccgtcgtcaa	Protospacer
** ********************** **    

720. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 6, identity: 0.812

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
attgccgccgccattgccgttgccgccgccat	Protospacer
********** ************** **   .

721. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP018466 (Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.3, complete sequence) position: , mismatch: 6, identity: 0.812

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttgccatcggcattgccgttgccggcggctc	Protospacer
.*****..********************. .*

722. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_LR723674 (Rhizobium flavum strain YW14 plasmid 5) position: , mismatch: 6, identity: 0.812

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
attgccgccggcattgccgtttccgttggcac	Protospacer
********************* *** .*.  *

723. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP020976 (Xanthomonas phaseoli pv. phaseoli strain CFBP6982 plasmid pA) position: , mismatch: 6, identity: 0.812

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttgccatcggcattgccgttgccggcggctc	Protospacer
.*****..********************. .*

724. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP020965 (Xanthomonas phaseoli pv. phaseoli strain CFBP412 plasmid pA, complete sequence) position: , mismatch: 6, identity: 0.812

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttgccatcggcattgccgttgccggcggctc	Protospacer
.*****..********************. .*

725. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP018727 (Xanthomonas vesicatoria ATCC 35937 strain LMG911 plasmid pLMG911.2, complete sequence) position: , mismatch: 6, identity: 0.812

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttgccatcggcattgccgttgccggcggctc	Protospacer
.*****..********************. .*

726. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NC_012853 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132503, complete sequence) position: , mismatch: 6, identity: 0.812

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
attgccgccggaattgctgttgccgttgcccc	Protospacer
*********** *****.******* .*  **

727. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc---	CRISPR spacer
ctccccaccggtgccgccct---cgccggcccaga	Protospacer
 *****.*********** *   *********   

728. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc---	CRISPR spacer
ctccccaccggtgccgccct---cgccggcccaga	Protospacer
 *****.*********** *   *********   

729. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc---	CRISPR spacer
ctccccaccggtgccgccct---cgccggcccaga	Protospacer
 *****.*********** *   *********   

730. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

731. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

732. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

733. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

734. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

735. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

736. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

737. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggtcccgcccgtgccgccggcgccgccggtgc	Protospacer
* .****** ********* *********. *

738. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

739. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

740. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

741. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

742. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

743. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

744. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggtcccgccggtgccgccgccgccgccgactg	Protospacer
* .****************.********.*. 

745. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggcaccgccggtgccgccggtgccgccgccgc	Protospacer
* * *************** .******* * *

746. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

747. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

748. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

749. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

750. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

751. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

752. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

753. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

754. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

755. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

756. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

757. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

758. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

759. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

760. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

761. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

762. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

763. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

764. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

765. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

766. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

767. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

768. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

769. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

770. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

771. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

772. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

773. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

774. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

775. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggtaccgcccgtgccaccgtcgccgccggcac	Protospacer
* . ***** *****.************** *

776. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tcccgggccggtgccgcccgcgccgccggccc	Protospacer
 .**  ************  ************

777. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

778. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

779. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

780. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

781. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

782. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

783. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

784. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

785. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

786. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

787. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

788. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

789. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

790. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

791. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

792. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

793. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

794. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

795. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

796. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

797. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

798. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
ttcgccgccggtgccgccctcgccgc--gctcgg	Protospacer
 ** ************** *******  **.*  

799. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_031109 (Gordonia phage Jumbo, complete genome) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggcgctgccggtgccgccgccgccgccggtct	Protospacer
* * *.*************.*********.*.

800. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gtggccgccggtgcggtcgtcgccgccgccgc	Protospacer
**  ********** *.*********** * *

801. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 6, identity: 0.812

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gccgccgccggagccgccgccgccgccgccgc	Protospacer
*.* ******* *******.******** * *

802. spacer 13.6|4030672|28|NZ_CP022578|CRT matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 6, identity: 0.786

ggcacggtgatggtggtgccctgtgcgc	CRISPR spacer
tcgacggtgatggtcgttccctgtgcgt	Protospacer
   *********** ** *********.

803. spacer 13.6|4030672|28|NZ_CP022578|CRT matches to DQ115854 (Cyanobacteria phage AS-1 contig_47 genomic sequence) position: , mismatch: 6, identity: 0.786

ggcacggtgatggtggtgccctgtgcgc	CRISPR spacer
gcctcggtgatggtggtgcccggtggca	Protospacer
* * ***************** ***   

804. spacer 13.6|4030672|28|NZ_CP022578|CRT matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 6, identity: 0.786

ggcacggtgatggtggtgccctgtgcgc	CRISPR spacer
ggcaacgtgatggtggtgccctggggct	Protospacer
****  ***************** *  .

805. spacer 13.6|4030672|28|NZ_CP022578|CRT matches to NZ_CP031752 (Rhodobacter sphaeroides strain EBL0706 plasmid p.A, complete sequence) position: , mismatch: 6, identity: 0.786

ggcacggtgatggtggtgccctgtgcgc	CRISPR spacer
tgcacggtgaaggtggtgcccttcgggt	Protospacer
 ********* *********** .* *.

806. spacer 14.1|4159156|27|NZ_CP022578|CRT matches to NC_048759 (Serratia phage MTx, partial genome) position: , mismatch: 6, identity: 0.778

cttagcaagccgccattcccgccgttg	CRISPR spacer
gacagcaagccgccattctcggcgttt	Protospacer
  .***************.** **** 

807. spacer 14.6|4159450|27|NZ_CP022578|CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.778

acgccaccggtttggtttccgccggcg	CRISPR spacer
ccgccagcggttcggtttccgccgcga	Protospacer
 ***** *****.***********  .

808. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MG872843 (Mycobacterium phage Sotrice96, complete genome) position: , mismatch: 6, identity: 0.778

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatggag	Protospacer
****************** **.. *  

809. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MT723943 (Mycobacterium phage Cactus, complete genome) position: , mismatch: 6, identity: 0.778

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatggag	Protospacer
****************** **.. *  

810. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MT114165 (Mycobacterium phage BadStone, complete genome) position: , mismatch: 6, identity: 0.778

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatggag	Protospacer
****************** **.. *  

811. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to KF493883 (Mycobacterium phage Mosby, complete genome) position: , mismatch: 6, identity: 0.778

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatggag	Protospacer
****************** **.. *  

812. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MF919529 (Mycobacterium phage Sassay, complete genome) position: , mismatch: 6, identity: 0.778

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatggag	Protospacer
****************** **.. *  

813. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 6, identity: 0.778

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatggag	Protospacer
****************** **.. *  

814. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to KU865303 (Mycobacterium phage TeardropMSU, complete genome) position: , mismatch: 6, identity: 0.778

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatggag	Protospacer
****************** **.. *  

815. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to KR080204 (Mycobacterium phage Mindy, complete genome) position: , mismatch: 6, identity: 0.778

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatggag	Protospacer
****************** **.. *  

816. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to NC_029079 (Mycobacterium phage Dusk, complete genome) position: , mismatch: 6, identity: 0.778

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatggag	Protospacer
****************** **.. *  

817. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to NC_022065 (Mycobacterium phage Contagion, complete genome) position: , mismatch: 6, identity: 0.778

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatggag	Protospacer
****************** **.. *  

818. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to KX817173 (Mycobacterium phage Tuco, complete genome) position: , mismatch: 6, identity: 0.778

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatggag	Protospacer
****************** **.. *  

819. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MT684595 (Mycobacterium phage Mova, complete genome) position: , mismatch: 6, identity: 0.778

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatggag	Protospacer
****************** **.. *  

820. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to KF188414 (Mycobacterium phage ABCat, complete genome) position: , mismatch: 6, identity: 0.778

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatggag	Protospacer
****************** **.. *  

821. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MF919540 (Mycobacterium phage Willez, complete genome) position: , mismatch: 6, identity: 0.778

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatggag	Protospacer
****************** **.. *  

822. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MN234212 (Mycobacterium phage Paphu, complete genome) position: , mismatch: 6, identity: 0.778

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatggag	Protospacer
****************** **.. *  

823. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MK061415 (Mycobacterium phage Rhynn, complete genome) position: , mismatch: 6, identity: 0.778

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatggag	Protospacer
****************** **.. *  

824. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MK524531 (Mycobacterium phage Rutherferd, complete genome) position: , mismatch: 6, identity: 0.778

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatggag	Protospacer
****************** **.. *  

825. spacer 14.11|4159720|27|NZ_CP022578|CRT matches to MN617845 (Mycobacterium phage BaconJack, complete genome) position: , mismatch: 6, identity: 0.778

ccgctgccgtagagccacccggccgcc	CRISPR spacer
ccgctgccgtagagccacgcgatggag	Protospacer
****************** **.. *  

826. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
gcggcgccgacatcgccgaccagacgg	Protospacer
 ******** *************... 

827. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_002699 (Frankia sp. CpI1 plasmid pFQ12, complete plasmid sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgccgactggaacg	Protospacer
********************..*.   

828. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
gcggcgccgacatcgccgaccagccgg	Protospacer
 ******** ************* .. 

829. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP015585 (Roseomonas gilardii strain U14-5 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
agcacgccgccctcgccgaccaggtag	Protospacer
   .******* ************** 

830. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
gcggcgccgacatcgccgaccagacgg	Protospacer
 ******** *************... 

831. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
gcgtcgccgccatcgccgaccagacca	Protospacer
 ** *******************..  

832. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
gcggcgccgacatcgccgaccagccgg	Protospacer
 ******** ************* .. 

833. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
gcggcgccgacatcgccgaccagacgg	Protospacer
 ******** *************... 

834. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
gcggcgccgacatcgccgaccagacga	Protospacer
 ******** *************... 

835. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
gcggcgccgacatcgccgaccagacgg	Protospacer
 ******** *************... 

836. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
gcgtcgccgccatcgccgaccagacca	Protospacer
 ** *******************..  

837. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
gcgtcgccgccatcgccgaccagacca	Protospacer
 ** *******************..  

838. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccgtcgccggcatcgccgaccagcccg	Protospacer
*** ***** ************* .  

839. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
gcggcgccgtcaccgccgaccaggcca	Protospacer
 ********.**.***********.  

840. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgccggccccattt	Protospacer
******************.**  .* .

841. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP013069 (Pannonibacter phragmitetus strain 31801 plasmid p.p-1, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
tcggcgccgccatcggcggccaggccg	Protospacer
.************** **.*****.  

842. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_016115 (Streptomyces pratensis ATCC 33331 plasmid pSFLA02, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
acggcatcgccatcgccgaccagggcg	Protospacer
 ****..*****************   

843. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
tcggcgccgccatcgccggcctggagg	Protospacer
.*****************.** ** . 

844. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
aggccgccgccatcggcgaccaggtga	Protospacer
  * *********** *********. 

845. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP015040 (Rhodovulum sp. P5 plasmid pRGUI01, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
gcatcgccgccatcgccgaccgggtcg	Protospacer
 *. *****************.***  

846. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
tcggcgccgccatcgccggcctggacg	Protospacer
.*****************.** **   

847. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP042268 (Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
gcatcgccgccatcgccgacgaggtct	Protospacer
 *. **************** **** .

848. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
atttcgccgccatcgccgatcaggcac	Protospacer
 .  ***************.****.**

849. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
cccgcgccgccatcgcctaccagcagg	Protospacer
** ************** *****  . 

850. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
atggcgccgccatcgtcaaccaggtgg	Protospacer
 .*************.*.*******. 

851. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccacagccgaccagcagg	Protospacer
************. *********  . 

852. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
tcggcgccgccatcgccggcgaggagg	Protospacer
.*****************.* *** . 

853. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
tcggcgccgccatcgccgagcatgagg	Protospacer
.****************** ** * . 

854. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgccatcgccgcccttgcct	Protospacer
****************** **  *. .

855. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
gcggcgccgccttcgccgacgaggaca	Protospacer
 ********** ******** ***   

856. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccggcgccgctctcgccgaccagcgcg	Protospacer
**********. ***********    

857. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_022739 (Pseudomonas sp. VLB120 plasmid pSTY, complete sequence) position: , mismatch: 6, identity: 0.778

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
atggcgccgccatcgtcaaccaggtgg	Protospacer
 .*************.*.*******. 

858. spacer 14.18|4160212|36|NZ_CP022578|CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 6, identity: 0.833

tacagc-cacccgccgttgccgccgaggccgccggcg	CRISPR spacer
-acaccgcacccgccgttgccgccgctgccgccctcg	Protospacer
 *** * ******************  ******  **

859. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
ccggtcaacggttcgggatgccgttcgcgcg	Protospacer
  * .***********  ************ 

860. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
ccggtcaacggttcgggatgccgttcgcgcg	Protospacer
  * .***********  ************ 

861. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
ccggtcaacggttcgggatgccgttcgcgcg	Protospacer
  * .***********  ************ 

862. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
ccggtcaacggttcgggatgccgttcgcgcg	Protospacer
  * .***********  ************ 

863. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
ccggtcaacggttcgggatgccgttcgcgcg	Protospacer
  * .***********  ************ 

864. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
ccggtcaacggttcgggatgccgttcgcgcg	Protospacer
  * .***********  ************ 

865. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
ccggtcaacggttcgggatgccgttcgcgcg	Protospacer
  * .***********  ************ 

866. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
ccggtcaacggttcgggatgccgttcgcgcg	Protospacer
  * .***********  ************ 

867. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
ccggtcaacggttcgggatgccgttcgcgcg	Protospacer
  * .***********  ************ 

868. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
ccggtcaacggttcgggatgccgttcgcgcg	Protospacer
  * .***********  ************ 

869. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
ccggtcaacggttcgggatgccgttcgcgcg	Protospacer
  * .***********  ************ 

870. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
ccggtcaacggttcgggatgccgttcgcgcg	Protospacer
  * .***********  ************ 

871. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
ccggtcaacggttcgggatgccgttcgcgcg	Protospacer
  * .***********  ************ 

872. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
ccggtcaacggttcgggatgccgttcgcgcg	Protospacer
  * .***********  ************ 

873. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
ccggtcaacggttcgggatgccgttcgcgcg	Protospacer
  * .***********  ************ 

874. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
ccggtcaacggttcgggatgccgttcgcgcg	Protospacer
  * .***********  ************ 

875. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to MF417927 (Uncultured Caudovirales phage clone 9F_2, partial genome) position: , mismatch: 7, identity: 0.767

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
aaaggcgccttcgatgccggcaacaccgac	Protospacer
.*.. **** *.*****************.

876. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
gccattgccgtcgatgccggcaataccgag	Protospacer
*  *..*****.***********.***** 

877. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 7, identity: 0.767

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
gaagatgccgtcgatgccggcaacgccgag	Protospacer
**.. .*****.************.**** 

878. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to JX469830 (Uncultured bacterium plasmid pG527, complete sequence) position: , mismatch: 7, identity: 0.767

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
gatcgcgccgatgatgccggccacaccggc	Protospacer
**   ***** ********** ******..

879. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to JX469833 (Uncultured bacterium plasmid pWEC911, complete sequence) position: , mismatch: 7, identity: 0.767

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
gatcgcgccgatgatgccggccacaccggc	Protospacer
**   ***** ********** ******..

880. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to NC_008357 (Pseudomonas aeruginosa plasmid pBS228, complete sequence) position: , mismatch: 7, identity: 0.767

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
gatcgcgccgatgatgccggccacaccggc	Protospacer
**   ***** ********** ******..

881. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to CP002151 (Uncultured bacterium plasmid PB5, complete sequence) position: , mismatch: 7, identity: 0.767

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
gatcgcgccgatgatgccggccacaccggc	Protospacer
**   ***** ********** ******..

882. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to CP002152 (Uncultured bacterium plasmid PB11, complete sequence) position: , mismatch: 7, identity: 0.767

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
gatcgcgccgatgatgccggccacaccggc	Protospacer
**   ***** ********** ******..

883. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to CP002153 (Uncultured bacterium plasmid PSP21, complete sequence) position: , mismatch: 7, identity: 0.767

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
gatcgcgccgatgatgccggccacaccggc	Protospacer
**   ***** ********** ******..

884. spacer 9.4|3214531|36|NZ_CP022578|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 7, identity: 0.806

ccacggcgccgctggcggtgtcccggccggcgtcgg	CRISPR spacer
tcctggccccgctggcggtgacccggccggcgatgg	Protospacer
.* .*** ************ *********** .**

885. spacer 9.11|3215011|27|NZ_CP022578|CRT matches to NZ_AP018520 (Sphingobium sp. YG1 plasmid pYGP1, complete sequence) position: , mismatch: 7, identity: 0.741

gaacggcggcttgctcttcggctccgc	CRISPR spacer
tctcggcggcttgctcttcggcctgga	Protospacer
   *******************.. * 

886. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MN585973 (Mycobacterium phage StAnnes, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ttgccgccgttgccgccgttgctggcctc	Protospacer
 ************.**********.  ..

887. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MG944221 (Mycobacterium phage Scowl, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ttgccgccgttgccgccgttgctggcctc	Protospacer
 ************.**********.  ..

888. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to KT309034 (Mycobacterium phage Dante, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ttgccgccgttgccgccgttgctggcctc	Protospacer
 ************.**********.  ..

889. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_048850 (Mycobacterium phage Cornie, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ttgccgccgttgccgccgttgctggcctc	Protospacer
 ************.**********.  ..

890. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_021538 (Mycobacterium phage Job42, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ttgccgccgttgccgccgttgctggcctc	Protospacer
 ************.**********.  ..

891. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_026584 (Mycobacterium phage Minerva, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ttgccgccgttgccgccgttgctggcctc	Protospacer
 ************.**********.  ..

892. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to KJ409696 (Mycobacterium phage Lamina13, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgctggcctc	Protospacer
 ************.**********.  ..

893. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_028784 (Mycobacterium phage Tasp14, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgctggcctc	Protospacer
 ************.**********.  ..

894. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct-----	CRISPR spacer
ttgccgccgttgccgccgttgc-----ctcccgc	Protospacer
 ************.********     **     

895. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ttgccgccgttgccgccgttgccgccggg	Protospacer
 ************.********.*  *  

896. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ttgccgccgttgccgccgttgccgcccgt	Protospacer
 ************.********.*    *

897. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
gacccgctgttgctgccgctgctgaaagc	Protospacer
*  ****.**********.*******. .

898. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_014819 (Asticcacaulis excentricus CB 48 plasmid pASTEX02, complete sequence) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
gggccgccgtcgctgcccttgctgacaac	Protospacer
* ********.****** ******* . .

899. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_LR134463 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
aagtgtccgttgctgccgcggctgaagct	Protospacer
. *.  ************. *********

900. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_LT703506 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
tggttgccgatgccgccgttgctgaagcg	Protospacer
  *..**** ***.************** 

901. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_CP025615 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
gtgccgccgttgctgccaatgctcagcgc	Protospacer
*****************. **** *.  .

902. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
gacccgctgttgctgccgctgctgaaagc	Protospacer
*  ****.**********.*******. .

903. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
gacccgctgttgctgccgctgctgaaagc	Protospacer
*  ****.**********.*******. .

904. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ttgctgccgttgctgccgttgccgtattc	Protospacer
 ***.*****************.* * ..

905. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
gacccgctgttgctgccgctgctgaaagc	Protospacer
*  ****.**********.*******. .

906. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_CP040096 (Pantoea sp. SO10 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
atgccgccgttgctgacgttggtgtcgta	Protospacer
.************** ***** **  *. 

907. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
gacccgctgttgctgccgctgctgaaagc	Protospacer
*  ****.**********.*******. .

908. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_011887 (Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
gacccgctgatgctgccgttgctgaaagc	Protospacer
*  ****.* ****************. .

909. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccgga	Protospacer
 ************.********.*  *  

910. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccgga	Protospacer
 ************.********.*  *  

911. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccgga	Protospacer
 ************.********.*  *  

912. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccgga	Protospacer
 ************.********.*  *  

913. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccgga	Protospacer
 ************.********.*  *  

914. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccgga	Protospacer
 ************.********.*  *  

915. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccggc	Protospacer
 ************.********.*  * .

916. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccgga	Protospacer
 ************.********.*  *  

917. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccgga	Protospacer
 ************.********.*  *  

918. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccgga	Protospacer
 ************.********.*  *  

919. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccggc	Protospacer
 ************.********.*  * .

920. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccgga	Protospacer
 ************.********.*  *  

921. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 7, identity: 0.759

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccgccgga	Protospacer
 ************.********.*  *  

922. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.731

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcacgtcgtcgccggccccgccgtc	Protospacer
.  . ******************* .

923. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.731

gcggagtcgtcgccggccccgccggt	CRISPR spacer
atccggtcgtcgccggccccgccgcg	Protospacer
..  .*******************  

924. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.731

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcacgtcgtcgccggccccgccgtc	Protospacer
.  . ******************* .

925. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.731

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcacgtcgtcgccggccccgccgtc	Protospacer
.  . ******************* .

926. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 7, identity: 0.731

gcggagtcgtcgccggccccgccggt	CRISPR spacer
agcacgtcgtcgccggccccgccgtc	Protospacer
.  . ******************* .

927. spacer 11.10|4009853|26|NZ_CP022578|CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.731

gcggagtcgtcgccggccccgccggt	CRISPR spacer
aacagatcgtcgccggccccgccgga	Protospacer
.  ...******************* 

928. spacer 11.12|4010003|29|NZ_CP022578|CRT matches to NZ_CP047220 (Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.759

ttgaagttggccccgccgctaccgccggc	CRISPR spacer
cccatttttgccacgccgctaccgccggc	Protospacer
.. *  ** *** ****************

929. spacer 11.12|4010003|29|NZ_CP022578|CRT matches to MK510999 (Pseudomonas phage BR58, partial genome) position: , mismatch: 7, identity: 0.759

ttgaagttggccccgccgctaccgccggc	CRISPR spacer
ccggccttggaaccgccgctaccgccggc	Protospacer
..*.  ****  *****************

930. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 7, identity: 0.781

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
cggccggggtcgccgtcgccggtgcatccctc	Protospacer
. ************* ********* * * *.

931. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
cagccggggtcgtcggcgccggtgcggccgct	Protospacer
. **********.************   **.*

932. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP054025 (Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence) position: , mismatch: 7, identity: 0.781

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
cggccggggtcgccgtcgccggtgcatccctc	Protospacer
. ************* ********* * * *.

933. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP051543 (Paracoccus sanguinis strain OM2164 plasmid pPspOM122, complete sequence) position: , mismatch: 7, identity: 0.781

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
cggccggggtcgccggctcgggtgcctcccct	Protospacer
. *************** * ******* * .*

934. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP054034 (Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence) position: , mismatch: 7, identity: 0.781

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
cggccggggtcgccgtcgccggtgcatccctc	Protospacer
. ************* ********* * * *.

935. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 7, identity: 0.781

ttgccggggtcgccggcgccggtgcctgcgtt-	CRISPR spacer
cggccggggttgccgtcgccggtgctt-cgctg	Protospacer
. ********.**** *********.* **.* 

936. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 7, identity: 0.781

ttgccggggtcgccggcgccggtgcctgcgtt-	CRISPR spacer
cggccggggttgccgtcgccggtgctt-cgctg	Protospacer
. ********.**** *********.* **.* 

937. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 7, identity: 0.781

ttgccggggtcgccggcgccggtgcctgcgtt-	CRISPR spacer
cggccggggttgccgtcgccggtgctt-cgctg	Protospacer
. ********.**** *********.* **.* 

938. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 7, identity: 0.781

ttgccggggtcgccggcgccggtgcctgcgtt-	CRISPR spacer
cggccggggttgccgtcgccggtgctt-cgctg	Protospacer
. ********.**** *********.* **.* 

939. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 7, identity: 0.781

ttgccggggtcgccggcgccggtgcctgcgtt-	CRISPR spacer
cggccggggttgccgtcgccggtgctt-cgctg	Protospacer
. ********.**** *********.* **.* 

940. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 7, identity: 0.781

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
attgccgccggcattgccgtcgccgcgtggct	Protospacer
********************.****   ..*.

941. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_LR723674 (Rhizobium flavum strain YW14 plasmid 5) position: , mismatch: 7, identity: 0.781

attgccgccggcattgccgttgccggcgaacc---	CRISPR spacer
attgccgctggcattgccgttaccgtt---cccag	Protospacer
********.************.*** .   **   

942. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_LR723674 (Rhizobium flavum strain YW14 plasmid 5) position: , mismatch: 7, identity: 0.781

attgccgccggcattgccgttgccggcgaacc---	CRISPR spacer
attgccgctggcattgccgttaccgtt---cccag	Protospacer
********.************.*** .   **   

943. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_LR723674 (Rhizobium flavum strain YW14 plasmid 5) position: , mismatch: 7, identity: 0.781

attgccgccggcattgccgttgccg---gcgaacc	CRISPR spacer
attgccgctggcattgccgttaccgtttccgg---	Protospacer
********.************.***    **.   

944. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_LR723674 (Rhizobium flavum strain YW14 plasmid 5) position: , mismatch: 7, identity: 0.781

attgccgccggcattgccgttgccggcgaacc---	CRISPR spacer
attgccgctggcattgccgttaccgtt---cccag	Protospacer
********.************.*** .   **   

945. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_LR723674 (Rhizobium flavum strain YW14 plasmid 5) position: , mismatch: 7, identity: 0.781

attgccgccggcattgccgttgccg---gcgaacc	CRISPR spacer
attgccgctggcattgccgttaccgtttccgg---	Protospacer
********.************.***    **.   

946. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_LR723674 (Rhizobium flavum strain YW14 plasmid 5) position: , mismatch: 7, identity: 0.781

attgccgccggcattgccgttgccggcgaacc---	CRISPR spacer
attgccgctggcattgccgttaccgtt---cccag	Protospacer
********.************.*** .   **   

947. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_LR723674 (Rhizobium flavum strain YW14 plasmid 5) position: , mismatch: 7, identity: 0.781

attgccgccggcattgccgttgccggcgaacc---	CRISPR spacer
attgccgctggcattgccgtttccgtt---cccag	Protospacer
********.************ *** .   **   

948. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
attcccgccggcattgccgttgccgttcccgc	Protospacer
*** ********************* .    *

949. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.781

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gatgccgaccgcattgccgttgccggcgacag	Protospacer
. ***** * *******************   

950. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.781

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gatgccgaccgcattgccgttgccggcgacag	Protospacer
. ***** * *******************   

951. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NC_012853 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132503, complete sequence) position: , mismatch: 7, identity: 0.781

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
attgccgccggaattgccgttgcccccgctat	Protospacer
*********** ************  **   .

952. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 7, identity: 0.781

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
attgccgccggcatcgccgtggccgcctggct	Protospacer
**************.***** **** * ..*.

953. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.781

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gtcgacgccggcatagccgttgcgggcgatct	Protospacer
.*.* ********* ******** ***** *.

954. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP019063 (Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
attgccggcggcattgcctttgccaacccgcc	Protospacer
******* ********** *****..*  .**

955. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gtcgacgccggcatagccgttgcgggcgatct	Protospacer
.*.* ********* ******** ***** *.

956. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 7, identity: 0.781

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gtcgacgccggcatagccgttgcgggcgatct	Protospacer
.*.* ********* ******** ***** *.

957. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

958. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

959. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

960. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

961. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

962. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

963. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

964. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gttgccgccgttgccgccgttgccgccgttgc	Protospacer
**. ****** *********.******* . *

965. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gttgccgccgttgccgccgttgccgcccgttc	Protospacer
**. ****** *********.****** *..*

966. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

967. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

968. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

969. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

970. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

971. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

972. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

973. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

974. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

975. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

976. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
agcaccgccggtgccgccatcaccgccgccgc	Protospacer
. * **************.**.****** * *

977. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

978. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

979. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

980. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

981. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

982. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

983. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gtacctgccggtgccgccgtcgccgcccagga	Protospacer
** **.********************* .   

984. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

985. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

986. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

987. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

988. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

989. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

990. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

991. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

992. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

993. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

994. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

995. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

996. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

997. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

998. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

999. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

1000. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

1001. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

1002. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccggcca	Protospacer
    ***** *********.*********** 

1003. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gaggtcgtcggtgccgccgtcgccgccggtca	Protospacer
*   .**.*********************.* 

1004. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_009339 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tcctgggccggtgccgcccgcgccgccggccc	Protospacer
 .*.  ************  ************

1005. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gtcctcgccggtgcggccgtcgccgcgcgtgg	Protospacer
****.********* ***********  *.  

1006. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggtgccaccggtaccgccgtcgccgccgggtc	Protospacer
* . **.*****.**************** .*

1007. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gaccccgccggtgccgccgccaccgccgattg	Protospacer
* *****************.*.******... 

1008. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gttgccgccgttgccgccatcgccgccgtcgt	Protospacer
**. ****** *******.********* * .

1009. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggcacggccgggaccgccgtcgccgccggcag	Protospacer
* * * ***** .*****************  

1010. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tccggcgccggtgtcgtcgtcgccgccggcct	Protospacer
 .*  ********.**.**************.

1011. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tccggcgccggtgccgccgtcgcagccggtct	Protospacer
 .*  ****************** *****.*.

1012. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tccggcgccggtgtcgccgtcgcagccggcct	Protospacer
 .*  ********.********* *******.

1013. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gaggtcgccggtgccgccgccgcggccggccg	Protospacer
*   .**************.*** ******* 

1014. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gagttcgacggtgccgccgacgccgccggcct	Protospacer
*  ..** *********** ***********.

1015. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tcctgggccggtgccgcccgcgccgccggccc	Protospacer
 .*.  ************  ************

1016. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gatcccgccggtgccgccggccccgccaccgc	Protospacer
* .**************** * *****. * *

1017. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ccctgcgccggtgccgcagtcgccgcccgccg	Protospacer
 .*. ************ ********* *** 

1018. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggcat	Protospacer
*.. ****** *********.********* .

1019. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggcat	Protospacer
*.. ****** *********.********* .

1020. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
acccaggccgctgccgccgtcgccaccggcct	Protospacer
..**  **** *************.******.

1021. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggatcggccggggccgccgtcgccgcccgcct	Protospacer
*  .* ***** *************** ***.

1022. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cccgccgccgctgccgccgtagccgccgccac	Protospacer
 .* ****** ********* ******* * *

1023. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
acccaggccgctgccgccgtcgccaccggcct	Protospacer
..**  **** *************.******.

1024. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggcgccgccgctgccgccgccgccgccgatcg	Protospacer
* * ****** ********.********..* 

1025. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gaccccgcccgtgccaccgtcgccgcccgggt	Protospacer
* ******* *****.*********** *  .

1026. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP047145 (Streptomyces sp. HF10 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
agcggcgccggtgccgacgacgccgccggcgc	Protospacer
. *  *********** ** ********** *

1027. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggccccgcaggtgccgccgtcgccgaccctgc	Protospacer
* ****** **************** *  . *

1028. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
acccaggccgctgccgccgtcgccaccggcct	Protospacer
..**  **** *************.******.

1029. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
acccaggccgctgccgccgtcgccaccggcct	Protospacer
..**  **** *************.******.

1030. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggccccgcaggtgccgccgtcgccgaccctgc	Protospacer
* ****** **************** *  . *

1031. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tccgccgccggcgccgccggcgccgccggatc	Protospacer
 .* *******.******* ********* .*

1032. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggtgccgccggtgccgccggtgccgccggtgc	Protospacer
* . *************** .********. *

1033. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MK494105 (Mycobacterium phage Pinnie, complete genome) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gccctcgccggtgccgccggcgccgcccggtg	Protospacer
*.**.************** ******* * . 

1034. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MK494105 (Mycobacterium phage Pinnie, complete genome) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cacgccgccgttgccgccggcgccgccgccac	Protospacer
  * ****** ******** ******** * *

1035. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_028791 (Mycobacterium phage MOOREtheMARYer, complete genome) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gccctcgccggtgccgccggcgccgcctggtg	Protospacer
*.**.************** ******* * . 

1036. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP023779 (Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgcc--gccggccc	CRISPR spacer
gtccccggcggtcccgccgtcgcccgggtggt--	Protospacer
******* **** ***********  * .**.  

1037. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cttgccgccggcgccgccctcgccgccgaacc	Protospacer
 *. *******.****** *********. **

1038. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggcggcgccgatgccgccggcgccgccggtca	Protospacer
* *  *****.******** *********.* 

1039. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ctcggcgcgggggccgccgtcgccgccgtcgc	Protospacer
 **  *** ** **************** * *

1040. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gttgccgccgttgccgccatcgccgccgtcgt	Protospacer
**. ****** *******.********* * .

1041. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.781

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gccgttgccggtgccgccgtcggctccggcgc	Protospacer
*.* ..**************** * ***** *

1042. spacer 12.6|4029297|32|NZ_CP022578|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

atcgccaccagccgcgccaaccgagccgaccc	CRISPR spacer
atcgccaccagccgcgccagcggaatccgcgc	Protospacer
*******************.* **..* .* *

1043. spacer 13.6|4030672|28|NZ_CP022578|CRT matches to NC_022050 (Paracoccus aminophilus JCM 7686 plasmid pAMI8, complete sequence) position: , mismatch: 7, identity: 0.75

ggcacggtgatggtggtgccctgtgcgc	CRISPR spacer
atcacggtgatgcgggtgccctgtggca	Protospacer
. **********  ***********   

1044. spacer 14.4|4159339|33|NZ_CP022578|CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 7, identity: 0.788

ccggcgatgttggccccgccggccccgccgttg-	CRISPR spacer
tcggcgatggtggccccgcc-gtcccgtagctgg	Protospacer
.******** ********** *.****. *.** 

1045. spacer 14.9|4159615|27|NZ_CP022578|CRT matches to AP021851 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome) position: , mismatch: 7, identity: 0.741

tacagccacgctccagagccgccggct	CRISPR spacer
agccgccacgctccagagccgcctcgc	Protospacer
 .* *******************   .

1046. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.741

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ccgccgccgccatcgccgaccgcaccg	Protospacer
*** *****************. ..  

1047. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.741

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
ttggcgccggcatcgccgaccagccgg	Protospacer
..******* ************* .. 

1048. spacer 14.13|4159831|27|NZ_CP022578|CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 7, identity: 0.741

ccggcgccgccatcgccgaccaggtac	CRISPR spacer
tcgacgccgccatcgccgaccatcgcg	Protospacer
.**.******************     

1049. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.733

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
gccggcgccgatgatgccggcaacgccgcc	Protospacer
*  . ***** *************.*** .

1050. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 8, identity: 0.733

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
gccggcgccgatgatgccggcaacgccgcc	Protospacer
*  . ***** *************.*** .

1051. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 8, identity: 0.733

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
gaagggaacgttgatgccggcaacgccgag	Protospacer
**..  . ****************.**** 

1052. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to NZ_CP021796 (Sinorhizobium meliloti strain USDA1157 plasmid accessoryA, complete sequence) position: , mismatch: 8, identity: 0.733

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
gctcacgccgttgatgccgacaacatcgcg	Protospacer
*    **************.*****.**  

1053. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 8, identity: 0.733

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
gaagggaacgttgatgccggcaacgccgag	Protospacer
**..  . ****************.**** 

1054. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 8, identity: 0.733

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
gaagggaacgttgatgccggcaacgccgag	Protospacer
**..  . ****************.**** 

1055. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.733

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
ggcggcgccgttgatgccgaccacaccgga	Protospacer
*. . **************.* ******. 

1056. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 8, identity: 0.733

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
gaagggaacgttgatgccggcaacgccgag	Protospacer
**..  . ****************.**** 

1057. spacer 8.2|3186729|30|NZ_CP022578|CRISPRCasFinder matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 8, identity: 0.733

gagaccgccgttgatgccggcaacaccgat	CRISPR spacer
gaagggaacgttgatgccggcaacgccgag	Protospacer
**..  . ****************.**** 

1058. spacer 9.4|3214531|36|NZ_CP022578|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.778

ccacg-gcgccgctggcggtgtcccggccggcgtcgg	CRISPR spacer
-cgcgctcgccgggggcggtgtcccggccggcggcat	Protospacer
 *.**  *****  ******************* *. 

1059. spacer 11.1|4009127|29|NZ_CP022578|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.724

ccggtggctgcccctccgtcggcgccatc	CRISPR spacer
gcggtggctgccccgccgtcggtctcgct	Protospacer
 ************* *******. .*...

1060. spacer 11.1|4009127|29|NZ_CP022578|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

ccggtggctgcccctccgtcggcgccatc	CRISPR spacer
gcggtggctgccccgccgtcggtctcgct	Protospacer
 ************* *******. .*...

1061. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to NZ_CP048923 (Lactobacillus plantarum strain X7022 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.724

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ttgccgccgttactgccgatgctgctttg	Protospacer
 **********.****** *****   . 

1062. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 8, identity: 0.724

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccaccgga	Protospacer
 ************.********..  *  

1063. spacer 11.6|4009544|29|NZ_CP022578|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 8, identity: 0.724

gtgccgccgttgctgccgttgctgaagct	CRISPR spacer
ctgccgccgttgccgccgttgccaccgga	Protospacer
 ************.********..  *  

1064. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 8, identity: 0.75

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
cagccggggtcgccgtcgccggtgcttcgctc	Protospacer
. ************* *********.*   *.

1065. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 8, identity: 0.75

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
cggccggggtcgccgtcgccggtgcatctctc	Protospacer
. ************* ********* * . *.

1066. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 8, identity: 0.75

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
cagccggggtcgccgtcgccggtgcttcgctc	Protospacer
. ************* *********.*   *.

1067. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 8, identity: 0.75

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
gtgtcggggtagccggcgccggtgaggtagtt	Protospacer
 **.****** *************     ***

1068. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.75

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
tcaccgcggtcggcggcgccggtgccgggttg	Protospacer
*..*** ***** ************* *  * 

1069. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP046571 (Xanthomonas albilineans strain Xa-FJ1 plasmid pXaFJ1, complete sequence) position: , mismatch: 8, identity: 0.75

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
gtcgctcgctcgccggcgccggcgccggcgtt	Protospacer
 *  *  * *************.*** *****

1070. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.75

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
tcaccgcggtcggcggcgccggtgccgggttg	Protospacer
*..*** ***** ************* *  * 

1071. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
cttgccgccggcagtgccgtggccgcggacat	Protospacer
 ************ ****** ****  **  .

1072. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
attcccgccggcattgccgttgccattcccgc	Protospacer
*** ********************. .    *

1073. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttcccgccggcattgccgttgccgttcccgc	Protospacer
.** ********************* .    *

1074. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttcccgccggcattgccgttgccgttcccgc	Protospacer
.** ********************* .    *

1075. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
attcccgccggcgttgccgttgccgttcccac	Protospacer
*** ********.************ .    *

1076. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
attcccgccggcgttgccgttgccgttcccgc	Protospacer
*** ********.************ .    *

1077. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
attcccgccggcattgccattgccgttcccgc	Protospacer
*** **************.****** .    *

1078. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gctgccgccggcattcccgctgccggcggggg	Protospacer
..************* ***.********..  

1079. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
tcaaaggccggcattgccgatgccggcgagcc	Protospacer
 . .  ************* *********.**

1080. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
tcaaaggccggcattgccgatgccggcgagcc	Protospacer
 . .  ************* *********.**

1081. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
tcaaaggccggcattgccgatgccggcgagcc	Protospacer
 . .  ************* *********.**

1082. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
tcaaaggccggcattgccgatgccggcgagcc	Protospacer
 . .  ************* *********.**

1083. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
tcaaaggccggcattgccgatgccggcgagcc	Protospacer
 . .  ************* *********.**

1084. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
tcaaaggccggcattgccgatgccggcgagcc	Protospacer
 . .  ************* *********.**

1085. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
tcaaaggccggcattgccgatgccggcgagcc	Protospacer
 . .  ************* *********.**

1086. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
tcaaaggccggcattgccgatgccggcgagcc	Protospacer
 . .  ************* *********.**

1087. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
tcaaaggccggcattgccgatgccggcgagcc	Protospacer
 . .  ************* *********.**

1088. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
tcaaaggccggcattgccgatgccggcgagcc	Protospacer
 . .  ************* *********.**

1089. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to JN699011 (Mycobacterium phage Stinger, complete genome) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttgccgccgacattgccgctgccggtgttgt	Protospacer
.*********.********.******.*   .

1090. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_KM406416 (Bifidobacterium breve strain JCM 7017 plasmid megaplasmid pMP7017, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttgccgccggtgttgccgttgccgtggtagt	Protospacer
.**********..************  * * .

1091. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NC_019018 (Mycobacterium marinum DL240490 plasmid pMUM003, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ttgcccgccggcgttgccgtggccggcgcaat	Protospacer
 *  ********.******* ******* * .

1092. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NC_011355 (Mycobacterium liflandii 128FXT plasmid pMUM002, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ttgcccgccggcgttgccgtggccggcgcaat	Protospacer
 *  ********.******* ******* * .

1093. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gtagtcgtcgacattgccgttgccggcgcgcg	Protospacer
.* *.**.**.***************** .* 

1094. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ttggccgccggcattgctgatgccggccacga	Protospacer
 * **************.* ******* *   

1095. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_AP017625 (Mycobacterium ulcerans subsp. shinshuense strain ATCC 33728 plasmid pShTP, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ttgcccgccggcgttgccgtggccggcgcaat	Protospacer
 *  ********.******* ******* * .

1096. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP027853 (Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-1, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
attgccgccggcattactgttgctgcagcgcg	Protospacer
***************.*.*****.*  * .* 

1097. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 8, identity: 0.75

attgccgccggcattgccgttgccggcgaacc-----	CRISPR spacer
gttgccgccgccattgccattgcc-----acctttgg	Protospacer
.********* *******.*****     ***     

1098. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgcgcctccggtgccgccgccgccgccgatcg	Protospacer
  * ** ************.********..* 

1099. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgagccgccggtgccgccgtctccgccgttgc	Protospacer
    ***************** ****** . *

1100. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
attgccgccgttgccgccgttgccgccggggt	Protospacer
.*. ****** *********.********  .

1101. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ccctccgccggcgccgccgtcgccgcccttgc	Protospacer
 .*.*******.***************  . *

1102. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggtgccgcccgcgccgccgtcgccgccgcggc	Protospacer
* . ***** *.****************   *

1103. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgtaccgccgttgccgccgtcgcctccgtcac	Protospacer
  . ****** ************* *** * *

1104. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgcaccgccgttgccgccggcgccgccgatcg	Protospacer
  * ****** ******** ********..* 

1105. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggctgcgccggtgccgcccgcgccgccgatac	Protospacer
* *. *************  ********.. *

1106. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gtagacgccggtaccgccgtcggcgccgcgca	Protospacer
**   *******.********* *****  * 

1107. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gaagccgccgacgccgccgtcgccgcccgttc	Protospacer
*   ******..*************** *..*

1108. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gcgtccgccggcgccgccggcgccgcccgttc	Protospacer
*. .*******.******* ******* *..*

1109. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgtgccgccggtgccgccattgccgccgccgc	Protospacer
  . **************.*.******* * *

1110. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tgcttccccggtgccgccgtcgcggcccgcgc	Protospacer
  *..* **************** *** ** *

1111. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggtaccgccggtgccgcccccgccgccgaagc	Protospacer
* . ************** .********.  *

1112. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgacccgccggtgccgccgacgccacccgtgc	Protospacer
   **************** ****.** *. *

1113. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gacgccggcgatgccgccgtcgccgcctccgg	Protospacer
* * *** **.****************  *  

1114. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ctcgccgccgctgccgccgtcgccctggcgcc	Protospacer
 ** ****** ************* . *  **

1115. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cccgccgccgctgccgccgtccccgccgctgc	Protospacer
 .* ****** ********** ****** . *

1116. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gaagccgccgttgccgccgccgccgcctaccg	Protospacer
*   ****** ********.******* .** 

1117. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MF141540 (Mycobacterium phage Avocado, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ccgcccgccggtgccgccggcgccgcgggtga	Protospacer
 . **************** ****** **.  

1118. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to KR080198 (Mycobacterium phage Cambiare, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ccgcccgccggtgccgccggcgccgcgggtga	Protospacer
 . **************** ****** **.  

1119. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggcgcggccgatgccgccgccgccgccggtga	Protospacer
* * * ****.********.*********.  

1120. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgccacgccggtgccgccggcgccgcctccag	Protospacer
  ** ************** *******  *  

1121. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tccggcgccggtgtcgccgtcgcggccggact	Protospacer
 .*  ********.********* ***** *.

1122. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggccccccaggtgccgccgtcgccgaccctgc	Protospacer
* **** * **************** *  . *

1123. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP026974 (Achromobacter insolitus strain FDAARGOS_88 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ctgcaccgcggcgccgccgacgccgccggccg	Protospacer
 * * *  ***.******* *********** 

1124. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_020275 (Mycobacterium intracellulare subsp. yongonense 05-1390 plasmid pMyong1, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gcccgcgccggtgccgacgtcgccgcgctgct	Protospacer
*.** *********** *********    *.

1125. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgc	Protospacer
    ***** *********.******** * *

1126. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP047145 (Streptomyces sp. HF10 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ttccccgccggtgcggccgccgccggccacgg	Protospacer
 ************* ****.***** * .*  

1127. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgc	Protospacer
    ***** *********.******** * *

1128. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cggtgcgccggtgccgccgccgccgccgcgcc	Protospacer
   . **************.********  **

1129. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cttgccgccgtcgccgccgtcgccgcccgtgc	Protospacer
 *. ****** .*************** *. *

1130. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gccgatgccggtgtcggcgtcgccgccgggcg	Protospacer
*.*  .*******.** ************ * 

1131. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggacacgccggtggtgccgtcgccgccgaagc	Protospacer
*  * ******** .*************.  *

1132. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggtat	Protospacer
*.. ****** *********.********. .

1133. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggtat	Protospacer
*.. ****** *********.********. .

1134. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggtat	Protospacer
*.. ****** *********.********. .

1135. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggtat	Protospacer
*.. ****** *********.********. .

1136. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
atagccgccgttgccgccgttgccgccggtga	Protospacer
.*  ****** *********.********.  

1137. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggagccgccgttgccgccgttgccgccggagg	Protospacer
*   ****** *********.********   

1138. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggaaa	Protospacer
*.. ****** *********.********   

1139. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggtat	Protospacer
*.. ****** *********.********. .

1140. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggtat	Protospacer
*.. ****** *********.********. .

1141. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggaaa	Protospacer
*.. ****** *********.********   

1142. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggaaa	Protospacer
*.. ****** *********.********   

1143. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggtat	Protospacer
*.. ****** *********.********. .

1144. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggaaa	Protospacer
*.. ****** *********.********   

1145. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
atagccgccgttgccgccgttgccgccggtga	Protospacer
.*  ****** *********.********.  

1146. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggaga	Protospacer
*.. ****** *********.********   

1147. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MH338241 (Mycobacterium phage Tarynearal, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
aacgtcgccgttgccgccgtcgccgccgcgac	Protospacer
. * .***** *****************   *

1148. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggaga	Protospacer
*.. ****** *********.********   

1149. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggaaa	Protospacer
*.. ****** *********.********   

1150. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggtat	Protospacer
*.. ****** *********.********. .

1151. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggtat	Protospacer
*.. ****** *********.********. .

1152. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
atagccgccgttgccgccgttgccgccggtga	Protospacer
.*  ****** *********.********.  

1153. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggaaa	Protospacer
*.. ****** *********.********   

1154. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggaaa	Protospacer
*.. ****** *********.********   

1155. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggagccgccgttgccgccgttgccgccggagg	Protospacer
*   ****** *********.********   

1156. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
atagccgccgttgccgccgttgccgccggtga	Protospacer
.*  ****** *********.********.  

1157. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggtat	Protospacer
*.. ****** *********.********. .

1158. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggagccgccgttgccgccgttgccgccggagg	Protospacer
*   ****** *********.********   

1159. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
atagccgccgttgccgccgttgccgccggtga	Protospacer
.*  ****** *********.********.  

1160. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggaga	Protospacer
*.. ****** *********.********   

1161. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
atagccgccgttgccgccgttgccgccggtga	Protospacer
.*  ****** *********.********.  

1162. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgttgccgccggaga	Protospacer
*.. ****** *********.********   

1163. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgtgccgccggtgccggcgtcgccaccgccac	Protospacer
  . ************ *******.*** * *

1164. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_008712 (Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgcgaggccggtgacgccggcgccgccggcac	Protospacer
  *   ******* ***** ********** *

1165. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gaagccgccgatgccgccgccgccgccgttca	Protospacer
*   ******.********.******** .* 

1166. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggcggcgccggtgccgctgtcggcgccgctca	Protospacer
* *  ************.**** ***** .* 

1167. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gaagccgccgttgccgccgttgccgccgctcg	Protospacer
*   ****** *********.******* .* 

1168. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gccaacgccggtggcgccttcgccgccgacgt	Protospacer
*.*  ******** **** *********.* .

1169. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggcgcggccgatgccgctgtcgccgccggtga	Protospacer
* * * ****.******.***********.  

1170. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gactgtgctggtgccgccgtcgcagccggcga	Protospacer
* *. .**.************** ******  

1171. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_008539 (Arthrobacter sp. FB24 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ctggcggccgcggccgccgtcgccgccggctt	Protospacer
 *  * ****  ******************..

1172. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ctggccgccggttccgccttcgccgccgccat	Protospacer
 *  ******** ***** ********* * .

1173. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gccgggtgcgatgccgccgttgccgccggccc	Protospacer
*.*     **.*********.***********

1174. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP046330 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tgacgcaccggtgccggcgccgccgccggcca	Protospacer
   * *.********* **.*********** 

1175. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gttgtcggcggtgccgccgttgccgccggtgg	Protospacer
**. .** ************.********.  

1176. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc--	CRISPR spacer
caccccgccggtgccgccggtgccgc--gcttga	Protospacer
  ***************** .*****  **..  

1177. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
acccgcgccggcgccgccgtcgccgctcgacg	Protospacer
..** ******.**************. * * 

1178. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
attggcgccggcgacgccgtcgccgccggttc	Protospacer
.*.  ******.* ***************..*

1179. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gtggtggccggtgccgccgcggccgccggaca	Protospacer
**  . *************. ******** * 

1180. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgtgccgccggtgccggcgtcgccaccgccac	Protospacer
  . ************ *******.*** * *

1181. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gacgacgccggtgccgccgacgccgacgatca	Protospacer
* *  ************** ***** **..* 

1182. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP023550 (Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
atcgccgccgttgccgccgtcgccgtcaccgt	Protospacer
.** ****** **************.*. * .

1183. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgccggagccgccgccgccgccgccgc	Protospacer
    ******* *******.******** * *

1184. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_006525 (Cupriavidus metallidurans CH34 plasmid pMOL28, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tgacgcaccggtgccggcgccgccgccggcca	Protospacer
   * *.********* **.*********** 

1185. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgctccgccggtgccgctgttgccgccgtcat	Protospacer
  *.*************.**.******* * .

1186. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
accgccgccggtgccgccggtgccgccgcgct	Protospacer
..* *************** .*******  *.

1187. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MH669003 (Mycobacterium phage Girr, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tttgacgtcggtgccgccgtcgccgcaggagc	Protospacer
 *.  **.****************** **  *

1188. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MK016504 (Mycobacterium phage Whouxphf, complete genome) position: , mismatch: 8, identity: 0.75

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tttgacgtcggtgccgccgtcgccgcaggagc	Protospacer
 *.  **.****************** **  *

1189. spacer 12.5|4029243|32|NZ_CP022578|CRT matches to NZ_CP021406 (Celeribacter manganoxidans strain DY25 plasmid pDY25-B, complete sequence) position: , mismatch: 8, identity: 0.75

attgcctgcggtgccgccgaaaccggcgaagc	CRISPR spacer
aaaccaggtggttccgccgaaaccggcgacgc	Protospacer
*   *  *.*** **************** **

1190. spacer 12.5|4029243|32|NZ_CP022578|CRT matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 8, identity: 0.75

attgcctgcggtgccgccgaaaccggcgaagc	CRISPR spacer
gtggatcgcggtgccgccgaagacggcgaacc	Protospacer
.* * ..**************. ******* *

1191. spacer 12.5|4029243|32|NZ_CP022578|CRT matches to NZ_CP010872 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6003, complete sequence) position: , mismatch: 8, identity: 0.75

attgcctgcggtgccgccgaaaccggcgaagc	CRISPR spacer
aaaccaggtggttccgccgaaaccggcgacgc	Protospacer
*   *  *.*** **************** **

1192. spacer 12.5|4029243|32|NZ_CP022578|CRT matches to NZ_CP040823 (Paraoceanicella profunda strain D4M1 plasmid pD4M1E, complete sequence) position: , mismatch: 8, identity: 0.75

attgcctgcggtgccgccgaaaccggcgaagc	CRISPR spacer
aaaccaggtggttccgccgaaaccggcgacgc	Protospacer
*   *  *.*** **************** **

1193. spacer 12.5|4029243|32|NZ_CP022578|CRT matches to NZ_CP040823 (Paraoceanicella profunda strain D4M1 plasmid pD4M1E, complete sequence) position: , mismatch: 8, identity: 0.75

attgcctgcggtgccgccgaaaccggcgaagc	CRISPR spacer
aaaccaggtggttccgccgaaaccggcgacgc	Protospacer
*   *  *.*** **************** **

1194. spacer 12.6|4029297|32|NZ_CP022578|CRT matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 8, identity: 0.75

atcgccaccagccgcgccaaccgagccgaccc	CRISPR spacer
atggccacccgccgcgccaaccggatcgtcgg	Protospacer
** ****** *************...** *  

1195. spacer 13.6|4030672|28|NZ_CP022578|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.714

ggcacggtgatggtggtgccctgtgcgc	CRISPR spacer
tctccggtgatgggggtgccctgtggaa	Protospacer
  . ********* *********** . 

1196. spacer 14.4|4159339|33|NZ_CP022578|CRT matches to MN234213 (Gordonia phage Schiebs, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgatgttggccccgccggccccgccgttg	CRISPR spacer
agggaccagtcggccccgccggccccgccggtg	Protospacer
  **    **.******************* **

1197. spacer 14.4|4159339|33|NZ_CP022578|CRT matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgatgttggccccgccggccccgccgttg	CRISPR spacer
tcggcgatggtggcgccgccggcccggagttgg	Protospacer
.******** **** ********** *   * *

1198. spacer 14.5|4159393|36|NZ_CP022578|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 8, identity: 0.778

tacagctgaccaccggccccgccggcgcc--gccgttc	CRISPR spacer
gggagctgaccacgagccccgccggcgccaagcagt--	Protospacer
 . ********** .**************  ** **  

1199. spacer 14.5|4159393|36|NZ_CP022578|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.778

tacagctgaccaccggccccgccggcgcc--gccgttc	CRISPR spacer
gggagctgaccaccagcccggccggcgccaagcagt--	Protospacer
 . ***********.**** *********  ** **  

1200. spacer 14.18|4160212|36|NZ_CP022578|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.778

-tacagccacccgccgttgccgccgaggccgccggcg	CRISPR spacer
cggtagtcg-ccgccgtggccgccgtggccgccggcg	Protospacer
  ..**.*. ******* ******* ***********

1201. spacer 14.18|4160212|36|NZ_CP022578|CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 8, identity: 0.778

-tacagccacccgccgttgccgccgaggccgccggcg	CRISPR spacer
ccgcacccg-tcgtcgtggccgccgaggccgccggcg	Protospacer
 ..** **. .**.*** *******************

1202. spacer 14.18|4160212|36|NZ_CP022578|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.778

tacagccacccgccgttgccgccgaggccgccggcg	CRISPR spacer
tgccgctcaccgccgaagccgccgaggccgccggca	Protospacer
*.* **.  ******  ******************.

1203. spacer 3.7|1499938|30|NZ_CP022578|CRT matches to NZ_CP022197 (Celeribacter ethanolicus strain TSPH2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

gacggcgggttgttcttcggcgtgggcggt	CRISPR spacer
cggagcgggttgttcgtcggcgtggagcga	Protospacer
 . .*********** *********.  * 

1204. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
tccaccaacatttcggcttgccgttcgttcc	Protospacer
    *****. ****************. *.

1205. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
cgcctcagcggttcggcttaccgttcgctta	Protospacer
 * ..**.***********.******** . 

1206. spacer 5.1|2856753|31|NZ_CP022578|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71

gggtccaacggttcggcttgccgttcgcgct	CRISPR spacer
cgcctcagcggttcggcttaccgttcgctta	Protospacer
 * ..**.***********.******** . 

1207. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NC_010509 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD02, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
acatggtcgtcgccggcgccagtgccagcgtt	Protospacer
 ... *  ************.***** *****

1208. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
cggccggggtcgccgtcgctggtgcatcgctc	Protospacer
. ************* ***.***** *   *.

1209. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
cggccggggttgccgtcgccggtgcttcgctc	Protospacer
. ********.**** *********.*   *.

1210. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
cggccggggtcgccgtcgctggtgcatcgctc	Protospacer
. ************* ***.***** *   *.

1211. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
tgccccgggtcgccggcgccgatgccgatgac	Protospacer
*  ** ***************.**** ..* .

1212. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
gcgccggggtcgtcggcgccgttgcgcgccac	Protospacer
 .**********.******** *** .**  .

1213. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
gggccggggtcggcggcgccgatgcaggagag	Protospacer
  ********** ********.***  * *  

1214. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
cggccggagtcgccgtcgccggtgcatcgctc	Protospacer
. *****.******* ********* *   *.

1215. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP017300 (Rhodococcus sp. YL-1 plasmid pYLC1, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
ctgtcggggtcgccgccgccggtgatgtccgt	Protospacer
.**.*********** ******** .  *  *

1216. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
ttgccggtgacgccggcgccggtccggaggcg	Protospacer
******* * ************* *  . *. 

1217. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
cggccggggtcgccgtcgcgggtgcatcactg	Protospacer
. ************* *** ***** *   * 

1218. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
cggccggggtcgccgtcgctggtgcatcgctc	Protospacer
. ************* ***.***** *   *.

1219. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to MH632120 (Mycobacterium phage Thonko, complete genome) position: , mismatch: 9, identity: 0.719

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
gtgtgccactcggcggcgtcggtgcctgcgtt	Protospacer
 **.   . *** *****.*************

1220. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttcccgccggcattgccgttgccattcccgc	Protospacer
.** ********************. .    *

1221. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttcccgccgccattgccgttgccgttcccgc	Protospacer
.** ****** ************** .    *

1222. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttcccgccggcgttgccgttgccgttcccgc	Protospacer
.** ********.************ .    *

1223. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttcccgccggcgttgccgttgccgttcccgc	Protospacer
.** ********.************ .    *

1224. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttcccgccggcattgccattgccgttcccgc	Protospacer
.** **************.****** .    *

1225. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttcccgccggcattgccattgccgttcccgc	Protospacer
.** **************.****** .    *

1226. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttgccgccgggattgccgttgccattgccgt	Protospacer
.********** ************. .*   .

1227. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttgccgccgggattgccgttgccattgccgt	Protospacer
.********** ************. .*   .

1228. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttgccgccgggattgccgttgccattgccgt	Protospacer
.********** ************. .*   .

1229. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttgccgccgggattgccgttgccattgccgt	Protospacer
.********** ************. .*   .

1230. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttgccgccgggattgccgttgccattgccgt	Protospacer
.********** ************. .*   .

1231. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP032678 (Pseudomonas sp. Leaf58 plasmid pBASL58, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ccagccggcgccattgccgttgccggcgtgat	Protospacer
 . **** ** ***************** . .

1232. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ttggccgccggaattgcctttgccggaccgca	Protospacer
 * ******** ****** *******   .* 

1233. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_LR723676 (Rhizobium sp. TCK plasmid 2) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
atttccgccgccattgccgttgccaccagctg	Protospacer
*** ****** *************. *.. . 

1234. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gagaccgcccgccttgccgttgccggcggcgc	Protospacer
.  .***** ** ***************.  *

1235. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gagaccgcccgccttgccgttgccggcggcgc	Protospacer
.  .***** ** ***************.  *

1236. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gagaccgcccgccttgccgttgccggcggcgc	Protospacer
.  .***** ** ***************.  *

1237. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gagaccgcccgccttgccgttgccggcggcgc	Protospacer
.  .***** ** ***************.  *

1238. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttgccgccgccattgccattgccgccaccat	Protospacer
.********* *******.****** *.   .

1239. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP053022 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-A-Sy, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
cttgccgccggcattggcgatgcccaacacca	Protospacer
 *************** ** **** .  * * 

1240. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
accgaggccggcattggcgttgccgacgacag	Protospacer
*..*  ********** ********.***   

1241. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to CP003952 (Rhodococcus opacus PD630 plasmid 3, complete sequence) position: , mismatch: 9, identity: 0.719

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gccggcttcggcatcgccggtgccggcgaact	Protospacer
...* * .******.**** ***********.

1242. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgtgccgccgttgccgccgttgccgccgttgc	Protospacer
  . ****** *********.******* . *

1243. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgaaccgccgttaccgccgtcgccgccgcgtc	Protospacer
    ****** *.***************  .*

1244. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgtcgcgccggtgccgccgtcgtggccggaga	Protospacer
  .* *****************. *****   

1245. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cggttggccgctgcggccgtcgccgccggctc	Protospacer
   .. **** *** ***************.*

1246. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tgatccgccgttgccgccgtcgcctccgttgc	Protospacer
   .****** ************* *** . *

1247. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gggaccgtcgctgccgccgtcgccgccctcga	Protospacer
*   ***.** ****************  *  

1248. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgtgccacccgtgccgccgtcgccgcccgaac	Protospacer
  . **.** ***************** *  *

1249. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ccgtccgccagagccgccgtcgccgcccgtgc	Protospacer
 . .*****.* *************** *. *

1250. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggtgccgccggtgccgccgccgcggccattgc	Protospacer
* . ***************.*** ***. . *

1251. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgccgccgccgatgg	Protospacer
*.. ****** ********.********..  

1252. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1253. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
attgccgccggcgccgccggcgccgccattgc	Protospacer
.*. *******.******* *******. . *

1254. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tttgacgtcggtgccgccgtcgccgcaggagt	Protospacer
 *.  **.****************** **  .

1255. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tttgacgtcggtgccgccgtcgccgcaggagt	Protospacer
 *.  **.****************** **  .

1256. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
agcggcgccggtggcgccgtcgtcgccgcgcg	Protospacer
. *  ******** ********.*****  * 

1257. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
agcggcgccggtggcgccgtcgtcgccgcgcg	Protospacer
. *  ******** ********.*****  * 

1258. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gccctcgctggtgccgccgtcgccgcacaggg	Protospacer
*.**.***.*****************  .   

1259. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1260. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1261. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1262. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
agcgcggccgatgccgccggcgccgccggtga	Protospacer
. * * ****.******** *********.  

1263. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1264. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1265. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgcgcggccggtgcctccggcgccgccggaat	Protospacer
  * * ********* *** *********  .

1266. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1267. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1268. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1269. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1270. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1271. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1272. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1273. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1274. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1275. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tacatcgtcggtgccggcgtcgccgccgaggc	Protospacer
  * .**.******** ***********.  *

1276. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1277. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgcgcggccggtgcctccggcgccgccggaat	Protospacer
  * * ********* *** *********  .

1278. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1279. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gaggacgcccatgccgccgtcgccgccgccaa	Protospacer
*    **** .***************** *  

1280. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1281. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1282. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1283. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caacgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1284. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1285. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1286. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caacgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1287. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
agcgcggccgatgccgccggcgccgccggtga	Protospacer
. * * ****.******** *********.  

1288. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cagcgcaatggcgccgccgtcgccgccggtcc	Protospacer
   * *. .**.*****************.**

1289. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gggtccgccgttgccaccgtcgccgccacctg	Protospacer
*  .****** ****.***********. *. 

1290. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
ggtgacgccggtgccgccgccgctgccggaga	Protospacer
* .  **************.***.*****   

1291. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tttgacgtcggtgccgccgtcgccgcaggagt	Protospacer
 *.  **.****************** **  .

1292. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tttgacgtcggtgccgccgtcgccgcaggagt	Protospacer
 *.  **.****************** **  .

1293. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tttgacgtcggtgccgccgtcgccgcaggagt	Protospacer
 *.  **.****************** **  .

1294. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgccccccaggtgccgccgtcgccgaccctgc	Protospacer
  **** * **************** *  . *

1295. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
agctgcgccggtttcgccgtcgccgccgccgt	Protospacer
. *. ******* .************** * .

1296. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_015184 (Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgcaaggccggtcccgccttcgccgccggctg	Protospacer
  *   ****** ***** ***********. 

1297. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tctggcgccggtgtcgtcgtcgccgccggact	Protospacer
 ..  ********.**.************ *.

1298. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgccgccgccgatgg	Protospacer
*.. ****** ********.********..  

1299. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
gctgccgccgttgccgccgccgccgccaacag	Protospacer
*.. ****** ********.*******..*  

1300. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
aatttcgccggggccgccgccgccgccggtct	Protospacer
. ...****** *******.*********.*.

1301. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_001759 (Streptomyces phaeochromogenes plasmid pJV1, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tgggccgccggtaccgccgtggccgccgtcgg	Protospacer
    ********.******* ******* *  

1302. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
aacaccgccgtcgccgccgtcgccgccgagat	Protospacer
. * ****** .****************.  .

1303. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tccattgccggtgccgcccgcgccgccggatc	Protospacer
 .* ..************  ********* .*

1304. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MH051248 (Mycobacterium phage BigPhil, complete genome) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tttgacgtcggtgccgccgtcgccgcaggagt	Protospacer
 *.  **.****************** **  .

1305. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MF668281 (Mycobacterium phage RitaG, complete genome) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tttgacgtcggtgccgccgtcgccgcaggagt	Protospacer
 *.  **.****************** **  .

1306. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MN369749 (Mycobacterium phage MinionDave, complete genome) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tttgacgtcggtgccgccgtcgccgcaggagt	Protospacer
 *.  **.****************** **  .

1307. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MT684597 (Mycobacterium phage Mandlovu, complete genome) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tttgacgtcggtgccgccgtcgccgcaggagt	Protospacer
 *.  **.****************** **  .

1308. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to KY012363 (Mycobacterium phage Empress, complete genome) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tttgacgtcggtgccgccgtcgccgcaggagt	Protospacer
 *.  **.****************** **  .

1309. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MN585973 (Mycobacterium phage StAnnes, complete genome) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tttgacgtcggtgccgccgtcgccgcaggagt	Protospacer
 *.  **.****************** **  .

1310. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MH077578 (Mycobacterium phage DillTech15, complete genome) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tttgacgtcggtgccgccgtcgccgcaggagt	Protospacer
 *.  **.****************** **  .

1311. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MH020235 (Mycobacterium phage Batiatus, complete genome) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tttgacgtcggtgccgccgtcgccgcaggagt	Protospacer
 *.  **.****************** **  .

1312. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to KY471267 (Mycobacterium phage SassyB, complete genome) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tttgacgtcggtgccgccgtcgccgcaggagt	Protospacer
 *.  **.****************** **  .

1313. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MG872841 (Mycobacterium phage Priscilla, complete genome) position: , mismatch: 9, identity: 0.719

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tttgacgtcggtgccgccgtcgccgcaggagt	Protospacer
 *.  **.****************** **  .

1314. spacer 12.5|4029243|32|NZ_CP022578|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.719

attgcctgcggtgccgccgaaaccggcgaagc	CRISPR spacer
ctcggtgccggtgccgccgaggccggcgaaga	Protospacer
 *.* .  ************..********* 

1315. spacer 12.5|4029243|32|NZ_CP022578|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.719

attgcctgcggtgccgccgaaaccggcgaagc	CRISPR spacer
ctcggtgccggtgccgccgaggccggcgaaga	Protospacer
 *.* .  ************..********* 

1316. spacer 12.5|4029243|32|NZ_CP022578|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 9, identity: 0.719

attgcctgcggtgccgccgaaaccggcgaagc	CRISPR spacer
cagggctgcggtggcgccgagaccggcgcaaa	Protospacer
   * ******** ******.******* *. 

1317. spacer 12.5|4029243|32|NZ_CP022578|CRT matches to NZ_CP015221 (Rhodococcus sp. PBTS 2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

attgcctgcggtgccgccgaaaccggcgaagc	CRISPR spacer
tccgcctgcggtgccggcgataccggtggtga	Protospacer
 ..************* *** *****.*. * 

1318. spacer 12.6|4029297|32|NZ_CP022578|CRT matches to NZ_CP013071 (Sphingobium indicum B90A plasmid pSRL1, complete sequence) position: , mismatch: 9, identity: 0.719

atcgccaccagccgcgccaaccgagccgaccc	CRISPR spacer
tccgccagcagccgcgccaacccagcgccttc	Protospacer
 .***** ************** ***   ..*

1319. spacer 12.6|4029297|32|NZ_CP022578|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719

atcgccaccagccgcgccaaccgagccgaccc	CRISPR spacer
tgggaaaccagccgcggcaaccgcgccgatct	Protospacer
   *  ********** ****** *****.*.

1320. spacer 12.6|4029297|32|NZ_CP022578|CRT matches to NZ_CP021819 (Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719

atcgccaccagccgcgccaaccgagccgaccc	CRISPR spacer
gcaggcaacaggcgcgccaaccgagccgcagc	Protospacer
.. * ** *** ****************   *

1321. spacer 14.4|4159339|33|NZ_CP022578|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

ccggcgatgttggccccgccggccccgccgttg	CRISPR spacer
gcgatgatgatcgccccgccggccccgcccgcc	Protospacer
 **..**** * *****************  . 

1322. spacer 14.18|4160212|36|NZ_CP022578|CRT matches to NC_031262 (Mycobacterium phage Brocalys, complete genome) position: , mismatch: 9, identity: 0.75

tacagccacccgccgttgccgccgaggccgccggcg	CRISPR spacer
ccaggaaacccgccgttgccgccggtgccgccggtg	Protospacer
.  .*  *****************. ********.*

1323. spacer 14.18|4160212|36|NZ_CP022578|CRT matches to NC_004683 (Mycobacterium phage Che9c, complete genome) position: , mismatch: 9, identity: 0.75

tacagccacccgccgttgccgccgaggccgccggcg	CRISPR spacer
ccaggaaacccgccgttgccgccggtgccgccggtg	Protospacer
.  .*  *****************. ********.*

1324. spacer 14.18|4160212|36|NZ_CP022578|CRT matches to AY129333 (Mycobacterium virus Che9c, complete genome) position: , mismatch: 9, identity: 0.75

tacagccacccgccgttgccgccgaggccgccggcg	CRISPR spacer
ccaggaaacccgccgttgccgccggtgccgccggtg	Protospacer
.  .*  *****************. ********.*

1325. spacer 14.18|4160212|36|NZ_CP022578|CRT matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 9, identity: 0.75

tacagccacccgccgttgccgccgaggccgccggcg	CRISPR spacer
ccagggaacccgccgttgccgccggtgccgccggtg	Protospacer
.  .*  *****************. ********.*

1326. spacer 14.18|4160212|36|NZ_CP022578|CRT matches to KM083128 (Mycobacterium phage Sparky, complete genome) position: , mismatch: 9, identity: 0.75

tacagccacccgccgttgccgccgaggccgccggcg	CRISPR spacer
ccaggaaacccgccgttgccgccggtgccgccggtg	Protospacer
.  .*  *****************. ********.*

1327. spacer 14.18|4160212|36|NZ_CP022578|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 9, identity: 0.75

tacagccac--ccgccgttgccgccgaggccgccggcg	CRISPR spacer
--gggctgctgccgccgttgccgccgttgccgccggca	Protospacer
   .**..*  ***************  *********.

1328. spacer 14.18|4160212|36|NZ_CP022578|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 9, identity: 0.75

tacagccac--ccgccgttgccgccgaggccgccggcg	CRISPR spacer
--gggctgctgccgccgttgccgccgttgccgccggca	Protospacer
   .**..*  ***************  *********.

1329. spacer 1.7|431664|35|NZ_CP022578|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714

gccccgtggatggcggatgcgttgtgcgcgcaagt	CRISPR spacer
accgtgtggatggcgaatgtgttgtgcgcggtgac	Protospacer
.** .**********.***.**********  ...

1330. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_KU140623 (Sinorhizobium sp. M14 plasmid pSinB, complete sequence) position: , mismatch: 10, identity: 0.688

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
gacgcaaggtcgccggcctcggtgcctgcgag	Protospacer
    *..********** .***********  

1331. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 10, identity: 0.688

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
gggccgcggtcgccggtgccggtgcgggttcc	Protospacer
  **** *********.********  *. ..

1332. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP048631 (Ancylobacter pratisalsi strain DSM 102029 plasmid pLGM, complete sequence) position: , mismatch: 10, identity: 0.688

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
ccgccgggggcgccggcgccggcgcgtcaagc	Protospacer
..******* ************.** *  . .

1333. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttcccgccggcattgccgttaccattcccgc	Protospacer
.** *****************.**. .    *

1334. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttcccgccggcattgccattgccattcccgc	Protospacer
.** **************.*****. .    *

1335. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gatctcgccggcattgccgttggcgccgcgat	Protospacer
. * .***************** ** ** . .

1336. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gatctcgccggcattgccgttggcgccgcgat	Protospacer
. * .***************** ** ** . .

1337. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ggagaagccgagattgccgttgccggcgacga	Protospacer
.  *  ****. *****************   

1338. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ggagaagccgagattgccgttgccggcgacga	Protospacer
.  *  ****. *****************   

1339. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ggagaagccgagattgccgttgccggcgacga	Protospacer
.  *  ****. *****************   

1340. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ggagaagccgagattgccgttgccggcgacga	Protospacer
.  *  ****. *****************   

1341. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ggagaagccgagattgccgttgccggcgacga	Protospacer
.  *  ****. *****************   

1342. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ggagaagccgagattgccgttgccggcgacga	Protospacer
.  *  ****. *****************   

1343. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ggagaagccgagattgccgttgccggcgacga	Protospacer
.  *  ****. *****************   

1344. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ggagaagccgagattgccgttgccggcgacga	Protospacer
.  *  ****. *****************   

1345. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ggagaagccgagattgccgttgccggcgacga	Protospacer
.  *  ****. *****************   

1346. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ggagaagccgagattgccgttgccggcgacga	Protospacer
.  *  ****. *****************   

1347. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ggagaagccgagattgccgttgccggcgacga	Protospacer
.  *  ****. *****************   

1348. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ggagaagccgagattgccgttgccggcgacga	Protospacer
.  *  ****. *****************   

1349. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ggagaagccgagattgccgttgccggcgacga	Protospacer
.  *  ****. *****************   

1350. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
cttgccgccgccattgcctttgccaacagggt	Protospacer
 ********* ******* *****..*... .

1351. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ggagaagccgagattgccgttgccggcgacga	Protospacer
.  *  ****. *****************   

1352. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013523 (Rhizobium phaseoli strain R744 plasmid pRphaR744a, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttgccgctgggattgccgttgccattgccgt	Protospacer
.*******.** ************. .*   .

1353. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ggagaagccgagattgccgttgccggcgacga	Protospacer
.  *  ****. *****************   

1354. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
cggtccgccggcattgtcgtcgccggccaggg	Protospacer
    ************.***.****** *.  

1355. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttgccgctgggattgccgttgccattgccgt	Protospacer
.*******.** ************. .*   .

1356. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ggagaagccgagattgccgttgccggcgacga	Protospacer
.  *  ****. *****************   

1357. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttgccgctgggattgccgttgccattgccgt	Protospacer
.*******.** ************. .*   .

1358. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gttgccgctgggattgccgttgccattgccgt	Protospacer
.*******.** ************. .*   .

1359. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to KU935731 (Mycobacterium phage Phrann, complete genome) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gagcgcgccggtattgccgttgccgccgcgac	Protospacer
.    ******.************* ** . *

1360. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to MK224497 (Mycobacterium phage Henu3, complete genome) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gagcgcgccggtattgccgttgccgccgcgac	Protospacer
.    ******.************* ** . *

1361. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to MT498061 (Mycobacterium phage Jung, complete genome) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gagcacgccggtattgccgttgccgccgcgac	Protospacer
.    ******.************* ** . *

1362. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to MH230879 (Mycobacterium phage Xavia, complete genome) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gagcgcgccggtattgccgttgccgccgcgac	Protospacer
.    ******.************* ** . *

1363. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to MN585977 (Mycobacterium phage Atcoo, complete genome) position: , mismatch: 10, identity: 0.688

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
gagcgcgccggtattgccgttgccgccgcgac	Protospacer
.    ******.************* ** . *

1364. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 10, identity: 0.688

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgagccgccggagccgccgccgccgccgatgg	Protospacer
    ******* *******.********..  

1365. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 10, identity: 0.688

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgtaccgccggtgccgccgctgccgccatagc	Protospacer
  . ***************..******.   *

1366. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgtcggtggcgccgtcgccgccctggc	Protospacer
    ***.***** *************    *

1367. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 10, identity: 0.688

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cctgccgcccgcgccgccgtcgccgccaggaa	Protospacer
 .. ***** *.***************.*   

1368. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
catcccgccggcgccgccatcgccgcctatgg	Protospacer
  .********.******.******** ..  

1369. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 10, identity: 0.688

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgtgacgccggtgccgacgtcgccgtcgccgg	Protospacer
  .  *********** ********.** *  

1370. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to MG812488 (Mycobacterium phage Frankie, complete genome) position: , mismatch: 10, identity: 0.688

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
tctgacgtcggtgccgccgtcgccgcaggagt	Protospacer
 ..  **.****************** **  .

1371. spacer 14.5|4159393|36|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.722

tacagctgaccaccggccccgccggcgccgccgttc	CRISPR spacer
aagcctcggccaccggcgccgcctgcgccgccgttg	Protospacer
 *   ..*.******** ***** *********** 

1372. spacer 14.5|4159393|36|NZ_CP022578|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.722

tacagctgaccaccggccccgccggcgccgccgttc	CRISPR spacer
gcccctcggccgccggccccgccggccccgccgttg	Protospacer
  *  ..*.**.************** ******** 

1373. spacer 11.13|4010075|32|NZ_CP022578|CRT matches to NZ_CP015743 (Shinella sp. HZN7 plasmid pShin-07, complete sequence) position: , mismatch: 11, identity: 0.656

ttgccggggtcgccggcgccggtgcctgcgtt	CRISPR spacer
gcgccgtggtcgccggcgccgatgcggaaacc	Protospacer
 .**** **************.***  . ...

1374. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 11, identity: 0.656

attgccgccggcattgccgttgccggcgaacc	CRISPR spacer
ggaaaagccgagattgccgttgccggcgacga	Protospacer
.  .  ****. *****************   

1375. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 11, identity: 0.656

gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
aaagccgccgttgccgccgccgccgcccagtg	Protospacer
.   ****** ********.******* . . 

1376. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgg---	Protospacer
   *.* **  .* .*******.*********   

1377. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 11, identity: 0.656

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgg---	Protospacer
   *.* **  .* .*******.*********   

1378. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 11, identity: 0.656

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgg---	Protospacer
   *.* **  .* .*******.*********   

1379. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgg---	Protospacer
   *.* **  .* .*******.*********   

1380. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgg---	Protospacer
   *.* **  .* .*******.*********   

1381. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgg---	Protospacer
   *.* **  .* .*******.*********   

1382. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgg---	Protospacer
   *.* **  .* .*******.*********   

1383. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgg---	Protospacer
   *.* **  .* .*******.*********   

1384. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgg---	Protospacer
   *.* **  .* .*******.*********   

1385. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgg---	Protospacer
   *.* **  .* .*******.*********   

1386. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgg---	Protospacer
   *.* **  .* .*******.*********   

1387. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgg---	Protospacer
   *.* **  .* .*******.*********   

1388. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgg---	Protospacer
   *.* **  .* .*******.*********   

1389. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgg---	Protospacer
   *.* **  .* .*******.*********   

1390. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgg---	Protospacer
   *.* **  .* .*******.*********   

1391. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgg---	Protospacer
   *.* **  .* .*******.*********   

1392. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
caggccgcccgtgccgccgccgccgccgccgg---	Protospacer
   *.* **  .* .*******.*********   

1393. spacer 12.2|4029063|32|NZ_CP022578|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 12, identity: 0.625

attgccgccggcattgccgttgccggcgaacc-	CRISPR spacer
accagcg-cggcatcggcattgccggcggcaat	Protospacer
*... ** ******.* *.*********.    

1394. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 13, identity: 0.594

gtccccgccggtgccgccgtcgccgccggccc---	CRISPR spacer
---ctagccgccgctgccgccgtggccgccctcga	Protospacer
   *. **** .**.****.**. **** **.   

1395. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 13, identity: 0.594

gtccccgccggtgccgccgtcgccgccggccc---	CRISPR spacer
---ctggccgccgctgccgccgtggccgccctcga	Protospacer
   *. **** .**.****.**. **** **.   

1396. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 13, identity: 0.594

gtccccgccggtgccgccgtcgccgccggccc---	CRISPR spacer
---ctagccgccgctgccgccgtggccgccctcga	Protospacer
   *. **** .**.****.**. **** **.   

1397. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 13, identity: 0.594

gtccccgccggtgccgccgtcgccgccggccc---	CRISPR spacer
---ctggccgccgctgccgccgtggccgccctcga	Protospacer
   *. **** .**.****.**. **** **.   

1398. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 13, identity: 0.594

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cgagccgccgttgccgccgtcgcccccgtcgg---	Protospacer
   *.* ***..* .****.**.* ***.***   

1399. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 13, identity: 0.594

gtccccgccggtgccgccgtcgccgccggccc---	CRISPR spacer
---ctagccgccgctgccgccgtggccgccctcga	Protospacer
   *. **** .**.****.**. **** **.   

1400. spacer 12.4|4029189|32|NZ_CP022578|CRT matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 13, identity: 0.594

---gtccccgccggtgccgccgtcgccgccggccc	CRISPR spacer
cggggcgccgtcgccgccgtcgccgccgggga---	Protospacer
   * * ***.** .****.**.*****  *.   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 429885 : 470247 41 Burkholderia_virus(40.0%) integrase,transposase,tRNA attL 429844:429903|attR 470231:471585
DBSCAN-SWA_2 568455 : 581201 20 Mycobacterium_phage(57.14%) terminase,protease,capsid,integrase,head attL 572112:572139|attR 581736:581763
DBSCAN-SWA_3 4164620 : 4249238 55 Pandoravirus(33.33%) protease,transposase,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage