Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021257 Legionella pneumophila subsp. fraseri strain Lansing 3 chromosome, complete genome 4 crisprs cas2,cas1,cas9,RT,WYL,cas3,PD-DExK,DinG,DEDDh,csa3 0 2 6 0

Results visualization

1. NZ_CP021257
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021257_1 206564-207540 TypeII NA
13 spacers
cas4,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021257_2 628265-628437 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021257_3 664204-664309 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021257_4 1633154-1633357 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP021257_2 2.1|628296|40|NZ_CP021257|CRISPRCasFinder 628296-628335 40 NZ_LR134418 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9 257659-257698 1 0.975
NZ_CP021257_1 1.9|207181|35|NZ_CP021257|CRISPRCasFinder,CRT,PILER-CR 207181-207215 35 JX094500 Cronobacter phage CR5, complete genome 89715-89749 8 0.771

1. spacer 2.1|628296|40|NZ_CP021257|CRISPRCasFinder matches to NZ_LR134418 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9) position: , mismatch: 1, identity: 0.975

aataaatttattattgcatttttttgcattaattcaccat	CRISPR spacer
aataaatttattattgcatttatttgcattaattcaccat	Protospacer
********************* ******************

2. spacer 1.9|207181|35|NZ_CP021257|CRISPRCasFinder,CRT,PILER-CR matches to JX094500 (Cronobacter phage CR5, complete genome) position: , mismatch: 8, identity: 0.771

tcaagttgaaaatgccaaagaagccttaaaagacg	CRISPR spacer
aaaactggctaaagccaaagaagcgttaaaagacg	Protospacer
  ** * *  ** *********** **********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 216486 : 246233 27 Acidithiobacillus_phage(40.0%) transposase,integrase attL 216267:216326|attR 246394:248986
DBSCAN-SWA_2 573988 : 651935 60 Acidithiobacillus_phage(50.0%) transposase,integrase,protease attL 631936:631995|attR 649562:652155
DBSCAN-SWA_3 1175420 : 1185536 7 Micromonas_pusilla_virus(16.67%) NA NA
DBSCAN-SWA_4 2073908 : 2083404 9 Staphylococcus_phage(42.86%) NA NA
DBSCAN-SWA_5 2351326 : 2358209 9 Acinetobacter_phage(42.86%) NA NA
DBSCAN-SWA_6 3115113 : 3121821 7 Acidithiobacillus_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage