Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP027394 Escherichia coli O104:H4 strain FDAARGOS_349 chromosome, complete genome 4 crisprs c2c9_V-U4,DEDDh,DinG,cas3,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,RT,PrimPol 0 12 13 0
NZ_CP027395 Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed1 0 crisprs NA 0 0 1 0
NZ_CP027392 Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 10 0
NZ_CP027396 Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed3 0 crisprs NA 0 0 0 0
NZ_CP027393 Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed4 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP027394
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027394_1 498903-499033 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027394_2 1848351-1848440 TypeI-E I-E
1 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027394_3 1875487-1876308 Orphan I-E
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP027394_4 4448788-4448884 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP027394_1 1.1|498944|49|NZ_CP027394|CRISPRCasFinder 498944-498992 49 KJ603229 Shigella phage POCJ13, complete genome 10125-10173 0 1.0
NZ_CP027394_1 1.1|498944|49|NZ_CP027394|CRISPRCasFinder 498944-498992 49 NC_029120 Shigella phage 75/02 Stx, complete genome 10125-10173 0 1.0
NZ_CP027394_3 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT 1875943-1875974 32 MN693005 Marine virus AFVG_117M50, complete genome 6262-6293 7 0.781
NZ_CP027394_3 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT 1876187-1876218 32 NZ_CP038598 Salmonella enterica subsp. enterica serovar Hadar strain 12-2388 plasmid p12-2388.3, complete sequence 2052-2083 7 0.781
NZ_CP027394_3 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT 1876187-1876218 32 NZ_CP033827 Klebsiella sp. FDAARGOS_511 plasmid unnamed4, complete sequence 693-724 7 0.781
NZ_CP027394_3 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT 1876187-1876218 32 NZ_CP029125 Enterobacter hormaechei strain AR432 plasmid unnamed2, complete sequence 518-549 7 0.781
NZ_CP027394_3 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT 1876187-1876218 32 NZ_AP019693 Salmonella enterica subsp. enterica serovar Senftenberg strain SL180013 plasmid pSL180013-1, complete sequence 2812-2843 7 0.781
NZ_CP027394_3 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT 1876187-1876218 32 NZ_CP030192 Salmonella enterica strain SA20104250 plasmid pSA20104250.2, complete sequence 1835-1866 7 0.781
NZ_CP027394_3 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT 1876187-1876218 32 NZ_CP039274 Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.4, complete sequence 118-149 7 0.781
NZ_CP027394_3 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT 1876187-1876218 32 NZ_CP016528 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_4, complete sequence 53-84 7 0.781
NZ_CP027394_3 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT 1876187-1876218 32 NZ_CP030227 Salmonella enterica strain SA20041605 plasmid pSA20041605.2, complete sequence 3124-3155 7 0.781
NZ_CP027394_3 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT 1876187-1876218 32 NC_013090 Endophytic bacterium LOB-07 plasmid pLK39, complete sequence 53-84 7 0.781
NZ_CP027394_3 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT 1876187-1876218 32 NZ_CP030009 Enterobacter hormaechei subsp. xiangfangensis strain Pb204 plasmid pPb204002, complete sequence 2572-2603 7 0.781
NZ_CP027394_3 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT 1876187-1876218 32 NZ_CP011606 Citrobacter freundii strain CAV1321 plasmid pCAV1321-4310, complete sequence 3835-3866 7 0.781
NZ_CP027394_3 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT 1876187-1876218 32 NZ_CP044113 Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed4, complete sequence 3639-3670 7 0.781
NZ_CP027394_3 3.25|1876187|33|NZ_CP027394|PILER-CR 1876187-1876219 33 NZ_CP038598 Salmonella enterica subsp. enterica serovar Hadar strain 12-2388 plasmid p12-2388.3, complete sequence 2051-2083 7 0.788
NZ_CP027394_3 3.25|1876187|33|NZ_CP027394|PILER-CR 1876187-1876219 33 NZ_CP033827 Klebsiella sp. FDAARGOS_511 plasmid unnamed4, complete sequence 692-724 7 0.788
NZ_CP027394_3 3.25|1876187|33|NZ_CP027394|PILER-CR 1876187-1876219 33 NZ_CP029125 Enterobacter hormaechei strain AR432 plasmid unnamed2, complete sequence 518-550 7 0.788
NZ_CP027394_3 3.25|1876187|33|NZ_CP027394|PILER-CR 1876187-1876219 33 NZ_AP019693 Salmonella enterica subsp. enterica serovar Senftenberg strain SL180013 plasmid pSL180013-1, complete sequence 2811-2843 7 0.788
NZ_CP027394_3 3.25|1876187|33|NZ_CP027394|PILER-CR 1876187-1876219 33 NZ_CP030192 Salmonella enterica strain SA20104250 plasmid pSA20104250.2, complete sequence 1835-1867 7 0.788
NZ_CP027394_3 3.25|1876187|33|NZ_CP027394|PILER-CR 1876187-1876219 33 NZ_CP039274 Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.4, complete sequence 118-150 7 0.788
NZ_CP027394_3 3.25|1876187|33|NZ_CP027394|PILER-CR 1876187-1876219 33 NZ_CP016528 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_4, complete sequence 52-84 7 0.788
NZ_CP027394_3 3.25|1876187|33|NZ_CP027394|PILER-CR 1876187-1876219 33 NZ_CP030227 Salmonella enterica strain SA20041605 plasmid pSA20041605.2, complete sequence 3123-3155 7 0.788
NZ_CP027394_3 3.25|1876187|33|NZ_CP027394|PILER-CR 1876187-1876219 33 NC_013090 Endophytic bacterium LOB-07 plasmid pLK39, complete sequence 52-84 7 0.788
NZ_CP027394_3 3.25|1876187|33|NZ_CP027394|PILER-CR 1876187-1876219 33 NZ_CP030009 Enterobacter hormaechei subsp. xiangfangensis strain Pb204 plasmid pPb204002, complete sequence 2572-2604 7 0.788
NZ_CP027394_3 3.25|1876187|33|NZ_CP027394|PILER-CR 1876187-1876219 33 NZ_CP011606 Citrobacter freundii strain CAV1321 plasmid pCAV1321-4310, complete sequence 3835-3867 7 0.788
NZ_CP027394_3 3.25|1876187|33|NZ_CP027394|PILER-CR 1876187-1876219 33 NZ_CP044113 Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed4, complete sequence 3638-3670 7 0.788
NZ_CP027394_3 3.3|1875638|32|NZ_CP027394|CRISPRCasFinder,CRT 1875638-1875669 32 MK016501 Mycobacterium phage Nebkiss, complete genome 21454-21485 8 0.75
NZ_CP027394_3 3.3|1875638|32|NZ_CP027394|CRISPRCasFinder,CRT 1875638-1875669 32 NC_026590 Mycobacterium phage Gaia, complete genome 21453-21484 8 0.75
NZ_CP027394_3 3.5|1875760|32|NZ_CP027394|CRISPRCasFinder,CRT 1875760-1875791 32 NZ_CP010769 Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence 121002-121033 8 0.75
NZ_CP027394_3 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT 1875943-1875974 32 MK295204 Shigella phage vB_SdyM_006, complete genome 16122-16153 8 0.75
NZ_CP027394_3 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT 1875943-1875974 32 MG696114 Proteus phage phiP4-3, complete genome 149804-149835 8 0.75
NZ_CP027394_3 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT 1875943-1875974 32 NZ_CP017949 Tenericutes bacterium MO-XQ plasmid unnamed, complete sequence 58006-58037 8 0.75
NZ_CP027394_3 3.10|1876065|32|NZ_CP027394|CRISPRCasFinder,CRT 1876065-1876096 32 AB452989 Serratia phage KSP20 orf7 to orf11 genes for scaffolding protein, major capsid protein, terminase, head completion protein, hypothetical protein, complete and partial cds 1966-1997 8 0.75
NZ_CP027394_3 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT 1876187-1876218 32 NC_019341 Pseudomonas syringae plasmid pNCPPB880-40, complete sequence 6612-6643 8 0.75
NZ_CP027394_3 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT 1876248-1876279 32 NZ_CP012265 Cronobacter condimenti 1330 strain LMG 26250 plasmid pCCO1, complete sequence 26063-26094 8 0.75
NZ_CP027394_3 3.16|1875638|33|NZ_CP027394|PILER-CR 1875638-1875670 33 MK016501 Mycobacterium phage Nebkiss, complete genome 21453-21485 8 0.758
NZ_CP027394_3 3.16|1875638|33|NZ_CP027394|PILER-CR 1875638-1875670 33 NC_026590 Mycobacterium phage Gaia, complete genome 21452-21484 8 0.758
NZ_CP027394_3 3.21|1875943|33|NZ_CP027394|PILER-CR 1875943-1875975 33 MN693005 Marine virus AFVG_117M50, complete genome 6262-6294 8 0.758
NZ_CP027394_3 3.26|1876248|33|NZ_CP027394|PILER-CR 1876248-1876280 33 NZ_CP012265 Cronobacter condimenti 1330 strain LMG 26250 plasmid pCCO1, complete sequence 26062-26094 8 0.758
NZ_CP027394_3 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT 1875943-1875974 32 AP022649 Bacillus wiedmannii PL1 plasmid pBwiPL1-6 DNA, complete sequence 5394-5425 9 0.719
NZ_CP027394_3 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT 1875943-1875974 32 KC821606 Cellulophaga phage phi12:2, complete genome 1257-1288 9 0.719
NZ_CP027394_3 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT 1875943-1875974 32 KT070867 Bacillus phage PBC2, complete genome 154855-154886 9 0.719
NZ_CP027394_3 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT 1876248-1876279 32 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 460266-460297 9 0.719
NZ_CP027394_3 3.21|1875943|33|NZ_CP027394|PILER-CR 1875943-1875975 33 MK295204 Shigella phage vB_SdyM_006, complete genome 16121-16153 9 0.727
NZ_CP027394_3 3.21|1875943|33|NZ_CP027394|PILER-CR 1875943-1875975 33 MG696114 Proteus phage phiP4-3, complete genome 149804-149836 9 0.727
NZ_CP027394_3 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT 1875943-1875974 32 KC821631 Cellulophaga phage phi48:1, complete genome 1257-1288 10 0.688
NZ_CP027394_3 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT 1875943-1875974 32 KC821628 Cellulophaga phage phi18:4, complete genome 1257-1288 10 0.688
NZ_CP027394_3 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT 1875943-1875974 32 NC_021805 Cellulophaga phage phi12a:1, complete genome 1257-1288 10 0.688
NZ_CP027394_3 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT 1876248-1876279 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1538980-1539011 10 0.688
NZ_CP027394_3 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT 1876248-1876279 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1187025-1187056 10 0.688
NZ_CP027394_3 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT 1876248-1876279 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1615960-1615991 10 0.688
NZ_CP027394_3 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT 1876248-1876279 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1459996-1460027 10 0.688
NZ_CP027394_3 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT 1876248-1876279 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1531874-1531905 10 0.688
NZ_CP027394_3 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT 1876248-1876279 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1459018-1459049 10 0.688
NZ_CP027394_3 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT 1876248-1876279 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1526371-1526402 10 0.688
NZ_CP027394_3 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT 1876248-1876279 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1526372-1526403 10 0.688
NZ_CP027394_3 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT 1876248-1876279 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1459988-1460019 10 0.688
NZ_CP027394_3 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT 1876248-1876279 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1459341-1459372 10 0.688
NZ_CP027394_3 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT 1876248-1876279 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1459978-1460009 10 0.688
NZ_CP027394_3 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT 1876248-1876279 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1539145-1539176 10 0.688
NZ_CP027394_3 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT 1876248-1876279 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1539126-1539157 10 0.688
NZ_CP027394_3 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT 1876248-1876279 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1539107-1539138 10 0.688
NZ_CP027394_3 3.21|1875943|33|NZ_CP027394|PILER-CR 1875943-1875975 33 AP022649 Bacillus wiedmannii PL1 plasmid pBwiPL1-6 DNA, complete sequence 5394-5426 10 0.697
NZ_CP027394_3 3.4|1875699|32|NZ_CP027394|CRISPRCasFinder,CRT 1875699-1875730 32 KU160664 Arthrobacter phage Salgado, complete genome 140-171 11 0.656
NZ_CP027394_3 3.4|1875699|32|NZ_CP027394|CRISPRCasFinder,CRT 1875699-1875730 32 MF140418 Arthrobacter phage LiSara, complete genome 140-171 11 0.656
NZ_CP027394_3 3.4|1875699|32|NZ_CP027394|CRISPRCasFinder,CRT 1875699-1875730 32 KU160654 Arthrobacter phage Laroye, complete genome 140-171 11 0.656

1. spacer 1.1|498944|49|NZ_CP027394|CRISPRCasFinder matches to KJ603229 (Shigella phage POCJ13, complete genome) position: , mismatch: 0, identity: 1.0

gactgcacattggtgtgactgcacatcttcacagacggtcccggtatct	CRISPR spacer
gactgcacattggtgtgactgcacatcttcacagacggtcccggtatct	Protospacer
*************************************************

2. spacer 1.1|498944|49|NZ_CP027394|CRISPRCasFinder matches to NC_029120 (Shigella phage 75/02 Stx, complete genome) position: , mismatch: 0, identity: 1.0

gactgcacattggtgtgactgcacatcttcacagacggtcccggtatct	CRISPR spacer
gactgcacattggtgtgactgcacatcttcacagacggtcccggtatct	Protospacer
*************************************************

3. spacer 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT matches to MN693005 (Marine virus AFVG_117M50, complete genome) position: , mismatch: 7, identity: 0.781

attaaaggattattttgatgagtctgaaaaat	CRISPR spacer
agttatagattattttgatgagtatgaacaaa	Protospacer
* * * .**************** **** ** 

4. spacer 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP038598 (Salmonella enterica subsp. enterica serovar Hadar strain 12-2388 plasmid p12-2388.3, complete sequence) position: , mismatch: 7, identity: 0.781

----cgataacacagggccgtcaatgcggccctttt	CRISPR spacer
tctccga----aaagggccgctaatgcggccctttt	Protospacer
    ***    * *******..**************

5. spacer 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP033827 (Klebsiella sp. FDAARGOS_511 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781

----cgataacacagggccgtcaatgcggccctttt	CRISPR spacer
tctccga----aaagggccgctaatgcggccctttt	Protospacer
    ***    * *******..**************

6. spacer 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP029125 (Enterobacter hormaechei strain AR432 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

----cgataacacagggccgtcaatgcggccctttt	CRISPR spacer
tctccga----aaagggccgctaatgcggccctttt	Protospacer
    ***    * *******..**************

7. spacer 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_AP019693 (Salmonella enterica subsp. enterica serovar Senftenberg strain SL180013 plasmid pSL180013-1, complete sequence) position: , mismatch: 7, identity: 0.781

----cgataacacagggccgtcaatgcggccctttt	CRISPR spacer
tctccga----aaagggccgctaatgcggccctttt	Protospacer
    ***    * *******..**************

8. spacer 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP030192 (Salmonella enterica strain SA20104250 plasmid pSA20104250.2, complete sequence) position: , mismatch: 7, identity: 0.781

----cgataacacagggccgtcaatgcggccctttt	CRISPR spacer
tctccga----aaagggccgctaatgcggccctttt	Protospacer
    ***    * *******..**************

9. spacer 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP039274 (Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.4, complete sequence) position: , mismatch: 7, identity: 0.781

----cgataacacagggccgtcaatgcggccctttt	CRISPR spacer
tctccga----aaagggccgctaatgcggccctttt	Protospacer
    ***    * *******..**************

10. spacer 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP016528 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_4, complete sequence) position: , mismatch: 7, identity: 0.781

----cgataacacagggccgtcaatgcggccctttt	CRISPR spacer
tctccga----aaagggccgctaatgcggccctttt	Protospacer
    ***    * *******..**************

11. spacer 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP030227 (Salmonella enterica strain SA20041605 plasmid pSA20041605.2, complete sequence) position: , mismatch: 7, identity: 0.781

----cgataacacagggccgtcaatgcggccctttt	CRISPR spacer
tctccga----aaagggccgctaatgcggccctttt	Protospacer
    ***    * *******..**************

12. spacer 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NC_013090 (Endophytic bacterium LOB-07 plasmid pLK39, complete sequence) position: , mismatch: 7, identity: 0.781

----cgataacacagggccgtcaatgcggccctttt	CRISPR spacer
tctccga----aaagggccgctaatgcggccctttt	Protospacer
    ***    * *******..**************

13. spacer 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP030009 (Enterobacter hormaechei subsp. xiangfangensis strain Pb204 plasmid pPb204002, complete sequence) position: , mismatch: 7, identity: 0.781

----cgataacacagggccgtcaatgcggccctttt	CRISPR spacer
tctccga----aaagggccgctaatgcggccctttt	Protospacer
    ***    * *******..**************

14. spacer 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP011606 (Citrobacter freundii strain CAV1321 plasmid pCAV1321-4310, complete sequence) position: , mismatch: 7, identity: 0.781

----cgataacacagggccgtcaatgcggccctttt	CRISPR spacer
tctccga----aaagggccgctaatgcggccctttt	Protospacer
    ***    * *******..**************

15. spacer 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP044113 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781

----cgataacacagggccgtcaatgcggccctttt	CRISPR spacer
tctccga----aaagggccgctaatgcggccctttt	Protospacer
    ***    * *******..**************

16. spacer 3.25|1876187|33|NZ_CP027394|PILER-CR matches to NZ_CP038598 (Salmonella enterica subsp. enterica serovar Hadar strain 12-2388 plasmid p12-2388.3, complete sequence) position: , mismatch: 7, identity: 0.788

----cgataacacagggccgtcaatgcggcccttttc	CRISPR spacer
tctccga----aaagggccgctaatgcggcccttttc	Protospacer
    ***    * *******..***************

17. spacer 3.25|1876187|33|NZ_CP027394|PILER-CR matches to NZ_CP033827 (Klebsiella sp. FDAARGOS_511 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.788

----cgataacacagggccgtcaatgcggcccttttc	CRISPR spacer
tctccga----aaagggccgctaatgcggcccttttc	Protospacer
    ***    * *******..***************

18. spacer 3.25|1876187|33|NZ_CP027394|PILER-CR matches to NZ_CP029125 (Enterobacter hormaechei strain AR432 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788

----cgataacacagggccgtcaatgcggcccttttc	CRISPR spacer
tctccga----aaagggccgctaatgcggcccttttc	Protospacer
    ***    * *******..***************

19. spacer 3.25|1876187|33|NZ_CP027394|PILER-CR matches to NZ_AP019693 (Salmonella enterica subsp. enterica serovar Senftenberg strain SL180013 plasmid pSL180013-1, complete sequence) position: , mismatch: 7, identity: 0.788

----cgataacacagggccgtcaatgcggcccttttc	CRISPR spacer
tctccga----aaagggccgctaatgcggcccttttc	Protospacer
    ***    * *******..***************

20. spacer 3.25|1876187|33|NZ_CP027394|PILER-CR matches to NZ_CP030192 (Salmonella enterica strain SA20104250 plasmid pSA20104250.2, complete sequence) position: , mismatch: 7, identity: 0.788

----cgataacacagggccgtcaatgcggcccttttc	CRISPR spacer
tctccga----aaagggccgctaatgcggcccttttc	Protospacer
    ***    * *******..***************

21. spacer 3.25|1876187|33|NZ_CP027394|PILER-CR matches to NZ_CP039274 (Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.4, complete sequence) position: , mismatch: 7, identity: 0.788

----cgataacacagggccgtcaatgcggcccttttc	CRISPR spacer
tctccga----aaagggccgctaatgcggcccttttc	Protospacer
    ***    * *******..***************

22. spacer 3.25|1876187|33|NZ_CP027394|PILER-CR matches to NZ_CP016528 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_4, complete sequence) position: , mismatch: 7, identity: 0.788

----cgataacacagggccgtcaatgcggcccttttc	CRISPR spacer
tctccga----aaagggccgctaatgcggcccttttc	Protospacer
    ***    * *******..***************

23. spacer 3.25|1876187|33|NZ_CP027394|PILER-CR matches to NZ_CP030227 (Salmonella enterica strain SA20041605 plasmid pSA20041605.2, complete sequence) position: , mismatch: 7, identity: 0.788

----cgataacacagggccgtcaatgcggcccttttc	CRISPR spacer
tctccga----aaagggccgctaatgcggcccttttc	Protospacer
    ***    * *******..***************

24. spacer 3.25|1876187|33|NZ_CP027394|PILER-CR matches to NC_013090 (Endophytic bacterium LOB-07 plasmid pLK39, complete sequence) position: , mismatch: 7, identity: 0.788

----cgataacacagggccgtcaatgcggcccttttc	CRISPR spacer
tctccga----aaagggccgctaatgcggcccttttc	Protospacer
    ***    * *******..***************

25. spacer 3.25|1876187|33|NZ_CP027394|PILER-CR matches to NZ_CP030009 (Enterobacter hormaechei subsp. xiangfangensis strain Pb204 plasmid pPb204002, complete sequence) position: , mismatch: 7, identity: 0.788

----cgataacacagggccgtcaatgcggcccttttc	CRISPR spacer
tctccga----aaagggccgctaatgcggcccttttc	Protospacer
    ***    * *******..***************

26. spacer 3.25|1876187|33|NZ_CP027394|PILER-CR matches to NZ_CP011606 (Citrobacter freundii strain CAV1321 plasmid pCAV1321-4310, complete sequence) position: , mismatch: 7, identity: 0.788

----cgataacacagggccgtcaatgcggcccttttc	CRISPR spacer
tctccga----aaagggccgctaatgcggcccttttc	Protospacer
    ***    * *******..***************

27. spacer 3.25|1876187|33|NZ_CP027394|PILER-CR matches to NZ_CP044113 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.788

----cgataacacagggccgtcaatgcggcccttttc	CRISPR spacer
tctccga----aaagggccgctaatgcggcccttttc	Protospacer
    ***    * *******..***************

28. spacer 3.3|1875638|32|NZ_CP027394|CRISPRCasFinder,CRT matches to MK016501 (Mycobacterium phage Nebkiss, complete genome) position: , mismatch: 8, identity: 0.75

atcttcttgttcaggaacgtcagtagaggtgt	CRISPR spacer
atgaatacgttcaggaacgccagtggaggtgt	Protospacer
**   . .***********.****.*******

29. spacer 3.3|1875638|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NC_026590 (Mycobacterium phage Gaia, complete genome) position: , mismatch: 8, identity: 0.75

atcttcttgttcaggaacgtcagtagaggtgt	CRISPR spacer
atgaatacgttcaggaacgccagtggaggtgt	Protospacer
**   . .***********.****.*******

30. spacer 3.5|1875760|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP010769 (Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence) position: , mismatch: 8, identity: 0.75

gcgggcgttaacgcggtgatactgtttgacgg	CRISPR spacer
ttgatcgttaacgcgatgctactgtttgtggg	Protospacer
 .*. **********.** *********  **

31. spacer 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT matches to MK295204 (Shigella phage vB_SdyM_006, complete genome) position: , mismatch: 8, identity: 0.75

-----attaaaggattattttgatgagtctgaaaaat	CRISPR spacer
tggtcat-----gattattttgatgattatgaaaaac	Protospacer
     **     ************** * *******.

32. spacer 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT matches to MG696114 (Proteus phage phiP4-3, complete genome) position: , mismatch: 8, identity: 0.75

-----attaaaggattattttgatgagtctgaaaaat	CRISPR spacer
tggtcat-----gattattttgatgattatgaaaaac	Protospacer
     **     ************** * *******.

33. spacer 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP017949 (Tenericutes bacterium MO-XQ plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

attaaaggattattttgatgagtctgaaaaat-----	CRISPR spacer
attaaaggattatttagatgggtt-----aatcactg	Protospacer
*************** ****.**.     ***     

34. spacer 3.10|1876065|32|NZ_CP027394|CRISPRCasFinder,CRT matches to AB452989 (Serratia phage KSP20 orf7 to orf11 genes for scaffolding protein, major capsid protein, terminase, head completion protein, hypothetical protein, complete and partial cds) position: , mismatch: 8, identity: 0.75

taccggtgtgaattacagcaccaccgccaccc	CRISPR spacer
ggccggtgtgaacaacagcaccaccacgcgcc	Protospacer
 .**********. ***********.*   **

35. spacer 3.12|1876187|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NC_019341 (Pseudomonas syringae plasmid pNCPPB880-40, complete sequence) position: , mismatch: 8, identity: 0.75

cgataacacagggccgtcaatgcggccctttt	CRISPR spacer
caaattaaaagggccgctaatgcggccctttt	Protospacer
*.*    * *******..**************

36. spacer 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP012265 (Cronobacter condimenti 1330 strain LMG 26250 plasmid pCCO1, complete sequence) position: , mismatch: 8, identity: 0.75

ataccgggttttgctccagcagcgccagttcc	CRISPR spacer
ctttgcggattttctccagcagcgccagttct	Protospacer
 * .  ** *** ******************.

37. spacer 3.16|1875638|33|NZ_CP027394|PILER-CR matches to MK016501 (Mycobacterium phage Nebkiss, complete genome) position: , mismatch: 8, identity: 0.758

atcttcttgttcaggaacgtcagtagaggtgtc	CRISPR spacer
atgaatacgttcaggaacgccagtggaggtgtc	Protospacer
**   . .***********.****.********

38. spacer 3.16|1875638|33|NZ_CP027394|PILER-CR matches to NC_026590 (Mycobacterium phage Gaia, complete genome) position: , mismatch: 8, identity: 0.758

atcttcttgttcaggaacgtcagtagaggtgtc	CRISPR spacer
atgaatacgttcaggaacgccagtggaggtgtc	Protospacer
**   . .***********.****.********

39. spacer 3.21|1875943|33|NZ_CP027394|PILER-CR matches to MN693005 (Marine virus AFVG_117M50, complete genome) position: , mismatch: 8, identity: 0.758

attaaaggattattttgatgagtctgaaaaatc	CRISPR spacer
agttatagattattttgatgagtatgaacaaag	Protospacer
* * * .**************** **** **  

40. spacer 3.26|1876248|33|NZ_CP027394|PILER-CR matches to NZ_CP012265 (Cronobacter condimenti 1330 strain LMG 26250 plasmid pCCO1, complete sequence) position: , mismatch: 8, identity: 0.758

ataccgggttttgctccagcagcgccagttcct	CRISPR spacer
ctttgcggattttctccagcagcgccagttctt	Protospacer
 * .  ** *** ******************.*

41. spacer 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT matches to AP022649 (Bacillus wiedmannii PL1 plasmid pBwiPL1-6 DNA, complete sequence) position: , mismatch: 9, identity: 0.719

attaaaggattattttgatgagtctgaaaaat	CRISPR spacer
cgcaaaggattattttgatgaatatgataggg	Protospacer
  .******************.* *** *.. 

42. spacer 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT matches to KC821606 (Cellulophaga phage phi12:2, complete genome) position: , mismatch: 9, identity: 0.719

attaaaggattattttgatgagtctgaaaaat	CRISPR spacer
ggtaggttattattttgatgagtttaaaaaac	Protospacer
. **..  ***************.*.*****.

43. spacer 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT matches to KT070867 (Bacillus phage PBC2, complete genome) position: , mismatch: 9, identity: 0.719

attaaaggattattttgatgagtctgaaaaat	CRISPR spacer
ttccgactgttcttttgataagtctgaaaaat	Protospacer
 *. .*  .** *******.************

44. spacer 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

ataccgggttttgctccagcagcgccagttcc	CRISPR spacer
ggtccgggttctgttccagcagcgccttggcc	Protospacer
.  *******.**.************    **

45. spacer 3.21|1875943|33|NZ_CP027394|PILER-CR matches to MK295204 (Shigella phage vB_SdyM_006, complete genome) position: , mismatch: 9, identity: 0.727

-----attaaaggattattttgatgagtctgaaaaatc	CRISPR spacer
tggtcat-----gattattttgatgattatgaaaaacg	Protospacer
     **     ************** * *******. 

46. spacer 3.21|1875943|33|NZ_CP027394|PILER-CR matches to MG696114 (Proteus phage phiP4-3, complete genome) position: , mismatch: 9, identity: 0.727

-----attaaaggattattttgatgagtctgaaaaatc	CRISPR spacer
tggtcat-----gattattttgatgattatgaaaaacg	Protospacer
     **     ************** * *******. 

47. spacer 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT matches to KC821631 (Cellulophaga phage phi48:1, complete genome) position: , mismatch: 10, identity: 0.688

attaaaggattattttgatgagtctgaaaaat	CRISPR spacer
ggtgggttattattttgatgagtttaaaaaac	Protospacer
. *...  ***************.*.*****.

48. spacer 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT matches to KC821628 (Cellulophaga phage phi18:4, complete genome) position: , mismatch: 10, identity: 0.688

attaaaggattattttgatgagtctgaaaaat	CRISPR spacer
ggtgggttattattttgatgagtttaaaaaac	Protospacer
. *...  ***************.*.*****.

49. spacer 3.8|1875943|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NC_021805 (Cellulophaga phage phi12a:1, complete genome) position: , mismatch: 10, identity: 0.688

attaaaggattattttgatgagtctgaaaaat	CRISPR spacer
ggtgggttattattttgatgagtttaaaaaac	Protospacer
. *...  ***************.*.*****.

50. spacer 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ataccgggttttgctccagcagcgccagttcc	CRISPR spacer
gccgctcgttgtcctccagcagcgccagttga	Protospacer
..  *  *** * *****************  

51. spacer 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

ataccgggttttgctccagcagcgccagttcc	CRISPR spacer
ccgcggggttctgctccagcaccgccagcagg	Protospacer
 ..* *****.********** ******.   

52. spacer 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 10, identity: 0.688

ataccgggttttgctccagcagcgccagttcc	CRISPR spacer
gccgctcgttgtcctccagcagcgccagttga	Protospacer
..  *  *** * *****************  

53. spacer 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ataccgggttttgctccagcagcgccagttcc	CRISPR spacer
gccgctcgttgtcctccagcagcgccagttga	Protospacer
..  *  *** * *****************  

54. spacer 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ataccgggttttgctccagcagcgccagttcc	CRISPR spacer
gccgctcgttgtcctccagcagcgccagttga	Protospacer
..  *  *** * *****************  

55. spacer 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

ataccgggttttgctccagcagcgccagttcc	CRISPR spacer
gccgctcgttgtcctccagcagcgccagttga	Protospacer
..  *  *** * *****************  

56. spacer 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ataccgggttttgctccagcagcgccagttcc	CRISPR spacer
gccgctcgttgtcctccagcagcgccagttga	Protospacer
..  *  *** * *****************  

57. spacer 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ataccgggttttgctccagcagcgccagttcc	CRISPR spacer
gccgctcgttgtcctccagcagcgccagttga	Protospacer
..  *  *** * *****************  

58. spacer 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ataccgggttttgctccagcagcgccagttcc	CRISPR spacer
gccgctcgttgtcctccagcagcgccagttga	Protospacer
..  *  *** * *****************  

59. spacer 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ataccgggttttgctccagcagcgccagttcc	CRISPR spacer
gccgctcgttgtcctccagcagcgccagttga	Protospacer
..  *  *** * *****************  

60. spacer 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ataccgggttttgctccagcagcgccagttcc	CRISPR spacer
gccgctcgttgtcctccagcagcgccagttga	Protospacer
..  *  *** * *****************  

61. spacer 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ataccgggttttgctccagcagcgccagttcc	CRISPR spacer
gccgctcgttgtcctccagcagcgccagttga	Protospacer
..  *  *** * *****************  

62. spacer 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ataccgggttttgctccagcagcgccagttcc	CRISPR spacer
gccgctcgttgtcctccagcagcgccagttga	Protospacer
..  *  *** * *****************  

63. spacer 3.13|1876248|32|NZ_CP027394|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ataccgggttttgctccagcagcgccagttcc	CRISPR spacer
gccgctcgttgtcctccagcagcgccagttga	Protospacer
..  *  *** * *****************  

64. spacer 3.21|1875943|33|NZ_CP027394|PILER-CR matches to AP022649 (Bacillus wiedmannii PL1 plasmid pBwiPL1-6 DNA, complete sequence) position: , mismatch: 10, identity: 0.697

attaaaggattattttgatgagtctgaaaaatc	CRISPR spacer
cgcaaaggattattttgatgaatatgataggga	Protospacer
  .******************.* *** *..  

65. spacer 3.4|1875699|32|NZ_CP027394|CRISPRCasFinder,CRT matches to KU160664 (Arthrobacter phage Salgado, complete genome) position: , mismatch: 11, identity: 0.656

agcattaacccccaccagctcgacgtgtgtgg	CRISPR spacer
tacattcacccccaccagcccgacgccccgtt	Protospacer
 .**** ************.*****. .    

66. spacer 3.4|1875699|32|NZ_CP027394|CRISPRCasFinder,CRT matches to MF140418 (Arthrobacter phage LiSara, complete genome) position: , mismatch: 11, identity: 0.656

agcattaacccccaccagctcgacgtgtgtgg	CRISPR spacer
tacattcacccccaccagcccgacgccccgtt	Protospacer
 .**** ************.*****. .    

67. spacer 3.4|1875699|32|NZ_CP027394|CRISPRCasFinder,CRT matches to KU160654 (Arthrobacter phage Laroye, complete genome) position: , mismatch: 11, identity: 0.656

agcattaacccccaccagctcgacgtgtgtgg	CRISPR spacer
tacattcacccccaccagcccgacgccccgtt	Protospacer
 .**** ************.*****. .    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 96701 : 158168 72 Enterobacteria_phage(44.0%) head,integrase,tail,terminase,protease,capsid,portal,holin attL 92517:92531|attR 113456:113470
DBSCAN-SWA_2 446016 : 512988 77 Shigella_phage(43.48%) integrase,tail,lysis,terminase,capsid,holin,portal attL 488479:488496|attR 516529:516546
DBSCAN-SWA_3 640393 : 698973 71 Enterobacteria_phage(77.55%) head,integrase,tail,terminase,transposase,tRNA,capsid,holin,portal,plate attL 636386:636402|attR 688593:688609
DBSCAN-SWA_4 800072 : 891088 107 Enterobacteria_phage(35.29%) head,tail,protease,tRNA,terminase,capsid,portal NA
DBSCAN-SWA_5 1189050 : 1198492 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_6 1399220 : 1464252 68 Enterobacteria_phage(45.95%) head,integrase,transposase,tRNA,terminase,protease,portal attL 1429025:1429041|attR 1466705:1466721
DBSCAN-SWA_7 2063815 : 2121909 44 Staphylococcus_phage(20.0%) tRNA,integrase,transposase,protease attL 2064800:2064817|attR 2109738:2109755
DBSCAN-SWA_8 2933212 : 2963298 24 Escherichia_phage(27.27%) tRNA,integrase,transposase attL 2947476:2947505|attR 2969350:2969379
DBSCAN-SWA_9 3542005 : 3618605 55 Enterobacteria_phage(21.43%) tRNA,integrase,protease,transposase attL 3550074:3550089|attR 3590803:3590818
DBSCAN-SWA_10 3687160 : 3749094 56 Enterobacteria_phage(25.0%) tRNA,integrase,holin,transposase attL 3679282:3679297|attR 3718756:3718771
DBSCAN-SWA_11 4059267 : 4121590 51 Emiliania_huxleyi_virus(12.5%) tRNA,transposase,plate,protease NA
DBSCAN-SWA_12 4689659 : 4732093 55 Enterobacteria_phage(58.82%) head,integrase,tail,lysis,capsid,portal attL 4687937:4687952|attR 4711088:4711103
DBSCAN-SWA_13 4997011 : 5059874 71 Escherichia_phage(94.29%) tail,bacteriocin,lysis,terminase,capsid,holin,portal NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP027395
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 53039 : 63337 12 Salmonella_phage(22.22%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP027392
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 5690 5 Bacillus_phage(50.0%) transposase NA
DBSCAN-SWA_2 14895 : 15876 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_3 19956 : 20193 1 Enterobacteria_phage(100.0%) transposase NA
DBSCAN-SWA_4 24039 : 24669 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_5 29713 : 30495 2 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_6 36755 : 37556 1 Yersinia_phage(100.0%) NA NA
DBSCAN-SWA_7 45280 : 52233 7 Stx2-converting_phage(66.67%) transposase NA
DBSCAN-SWA_8 56350 : 58347 2 Macacine_betaherpesvirus(50.0%) integrase attL 54810:54823|attR 64944:64957
DBSCAN-SWA_9 61446 : 67624 7 Enterobacteria_phage(50.0%) integrase attL 54810:54823|attR 64944:64957
DBSCAN-SWA_10 73621 : 74346 2 Stx2-converting_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage