Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014122 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed4, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP014123 Klebsiella pneumoniae strain FDAARGOS_156 chromosome, complete genome 4 crisprs csa3,cas3,DEDDh,DinG,cas8e,cse2gr11,cas6e,cas7,cas5,cas1,cas2,WYL 1 12 418 0
NZ_CP014124 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed2 0 crisprs RT 0 0 1 0
NZ_CP014121 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence 0 crisprs csa3,RT,cas3 0 0 2 0
NZ_CP014125 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed3 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP014123
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014123_1 1095837-1095943 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014123_2 2145125-2145701 TypeI-E I-E,II-B
9 spacers
cas3,cas8e,cse2gr11,cas6e,cas7,cas5,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014123_3 2154455-2155466 TypeI-E I-B,III-A,III-B
16 spacers
cas2,cas1,cas5,cas7,cas6e,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014123_4 4437419-4437553 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP014123_3 3.1|2154483|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2154483-2154515 33 NZ_CP014123.1 1378629-1378661 0 1.0

1. spacer 3.1|2154483|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to position: 1378629-1378661, mismatch: 0, identity: 1.0

tattttttcgccagcttgtcgtaggtgccgtcc	CRISPR spacer
tattttttcgccagcttgtcgtaggtgccgtcc	Protospacer
*********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014123_2 2.7|2145519|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2145519-2145551 33 MK416013 Klebsiella phage ST16-OXA48phi5.1, complete genome 24820-24852 0 1.0
NZ_CP014123_2 2.7|2145519|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2145519-2145551 33 MN098327 Klebsiella phage Mulock, complete genome 34857-34889 0 1.0
NZ_CP014123_2 2.7|2145519|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2145519-2145551 33 MK448230 Klebsiella phage ST16-OXA48phi5.2, complete genome 13815-13847 0 1.0
NZ_CP014123_2 2.7|2145519|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2145519-2145551 33 KY271399 Klebsiella phage 5 LV-2017, complete genome 11401-11433 0 1.0
NZ_CP014123_2 2.7|2145519|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2145519-2145551 33 KY271396 Klebsiella phage 2 LV-2017, complete genome 32703-32735 0 1.0
NZ_CP014123_3 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155093-2155125 33 KY271395 Klebsiella phage 2b LV-2017, complete genome 31975-32007 0 1.0
NZ_CP014123_2 2.7|2145519|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2145519-2145551 33 KY271395 Klebsiella phage 2b LV-2017, complete genome 12308-12340 1 0.97
NZ_CP014123_2 2.9|2145641|33|NZ_CP014123|CRISPRCasFinder,CRT 2145641-2145673 33 MN098327 Klebsiella phage Mulock, complete genome 25513-25545 2 0.939
NZ_CP014123_2 2.9|2145641|33|NZ_CP014123|CRISPRCasFinder,CRT 2145641-2145673 33 KY271400 Klebsiella phage 6 LV-2017, complete genome 17605-17637 2 0.939
NZ_CP014123_3 3.1|2154483|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2154483-2154515 33 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 228766-228798 3 0.909
NZ_CP014123_3 3.1|2154483|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2154483-2154515 33 NZ_CP032703 Pantoea dispersa strain DSM 32899 plasmid unnamed1, complete sequence 369997-370029 3 0.909
NZ_CP014123_3 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155093-2155125 33 MK714353 Klebsiella phage ST13-OXA48phi12.5, complete genome 29756-29788 3 0.909
NZ_CP014123_3 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155093-2155125 33 KY271396 Klebsiella phage 2 LV-2017, complete genome 12692-12724 5 0.848
NZ_CP014123_3 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155093-2155125 33 CP022016 Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence 91561-91593 6 0.818
NZ_CP014123_3 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155093-2155125 33 MN855766 Bacteriophage sp. isolate 10, complete genome 32885-32917 6 0.818
NZ_CP014123_3 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155093-2155125 33 NC_010392 Phage Gifsy-1, complete genome 32776-32808 7 0.788
NZ_CP014123_3 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155093-2155125 33 NC_048759 Serratia phage MTx, partial genome 43445-43477 7 0.788
NZ_CP014123_3 3.14|2155276|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155276-2155308 33 NZ_CP010860 Marinovum algicola DG 898 plasmid pMaD5, complete sequence 48711-48743 7 0.788
NZ_CP014123_2 2.1|2145153|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2145153-2145185 33 NZ_CP013709 Clostridium botulinum strain F634 plasmid pRSJ2_2, complete sequence 161886-161918 8 0.758
NZ_CP014123_2 2.1|2145153|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2145153-2145185 33 NZ_CP013844 Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence 207310-207342 8 0.758
NZ_CP014123_2 2.3|2145275|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2145275-2145307 33 NC_011667 Thauera sp. MZ1T plasmid pTha01, complete sequence 13391-13423 8 0.758
NZ_CP014123_3 3.2|2154544|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2154544-2154576 33 NZ_CP022523 Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence 212998-213030 8 0.758
NZ_CP014123_3 3.2|2154544|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2154544-2154576 33 NZ_CP015355 Bacillus thuringiensis strain MYBT18246 plasmid p109822, complete sequence 79431-79463 8 0.758
NZ_CP014123_3 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155093-2155125 33 NC_014120 Paraburkholderia sp. CCGE1002 plasmid pBC201, complete sequence 437676-437708 8 0.758
NZ_CP014123_3 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155093-2155125 33 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 163494-163526 8 0.758
NZ_CP014123_3 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155093-2155125 33 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 550453-550485 8 0.758
NZ_CP014123_3 3.12|2155154|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155154-2155186 33 NC_048198 Erwinia phage vB_EhrS_59, complete genome 21191-21223 8 0.758
NZ_CP014123_3 3.14|2155276|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155276-2155308 33 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 309364-309396 8 0.758
NZ_CP014123_2 2.1|2145153|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2145153-2145185 33 AP014331 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S36-C30, *** SEQUENCING IN PROGRESS *** 27278-27310 9 0.727
NZ_CP014123_3 3.2|2154544|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2154544-2154576 33 NC_010010 Bacillus megaterium QM B1551 plasmid pBM300, complete sequence 26092-26124 9 0.727
NZ_CP014123_3 3.9|2154971|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2154971-2155003 33 NZ_CP025810 Sulfitobacter sp. SK025 plasmid unnamed2, complete sequence 124096-124128 9 0.727
NZ_CP014123_3 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155093-2155125 33 NZ_CP045066 Enterobacter roggenkampii strain WCHER090065 plasmid p1_090065, complete sequence 1927-1959 9 0.727
NZ_CP014123_3 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155093-2155125 33 MH389777 Dickeya phage vB_DsoM_JA11, complete genome 68141-68173 9 0.727
NZ_CP014123_3 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155093-2155125 33 MH460462 Dickeya phage vB_DsoM_JA33, complete genome 68131-68163 9 0.727
NZ_CP014123_3 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155093-2155125 33 MH460460 Dickeya phage vB_DsoM_JA13, complete genome 68336-68368 9 0.727
NZ_CP014123_2 2.5|2145397|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2145397-2145429 33 JQ807227 Environmental Halophage eHP-6, partial genome 15495-15527 10 0.697
NZ_CP014123_3 3.6|2154788|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2154788-2154820 33 NZ_CP016621 Microvirga ossetica strain V5/3m plasmid unnamed5, complete sequence 49362-49394 10 0.697
NZ_CP014123_3 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155093-2155125 33 NZ_CP040096 Pantoea sp. SO10 plasmid unnamed1, complete sequence 649799-649831 10 0.697
NZ_CP014123_3 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2155093-2155125 33 NC_048053 Dickeya phage vB_DsoM_JA29, complete genome 68571-68603 10 0.697
NZ_CP014123_2 2.1|2145153|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT 2145153-2145185 33 NZ_LR735422 Staphylococcus epidermidis strain none isolate Se_BPH0697 plasmid 2 52052-52084 11 0.667

1. spacer 2.7|2145519|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to MK416013 (Klebsiella phage ST16-OXA48phi5.1, complete genome) position: , mismatch: 0, identity: 1.0

tgcaggacgagcaggcagtaaagcgccaggcgg	CRISPR spacer
tgcaggacgagcaggcagtaaagcgccaggcgg	Protospacer
*********************************

2. spacer 2.7|2145519|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to MN098327 (Klebsiella phage Mulock, complete genome) position: , mismatch: 0, identity: 1.0

tgcaggacgagcaggcagtaaagcgccaggcgg	CRISPR spacer
tgcaggacgagcaggcagtaaagcgccaggcgg	Protospacer
*********************************

3. spacer 2.7|2145519|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to MK448230 (Klebsiella phage ST16-OXA48phi5.2, complete genome) position: , mismatch: 0, identity: 1.0

tgcaggacgagcaggcagtaaagcgccaggcgg	CRISPR spacer
tgcaggacgagcaggcagtaaagcgccaggcgg	Protospacer
*********************************

4. spacer 2.7|2145519|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to KY271399 (Klebsiella phage 5 LV-2017, complete genome) position: , mismatch: 0, identity: 1.0

tgcaggacgagcaggcagtaaagcgccaggcgg	CRISPR spacer
tgcaggacgagcaggcagtaaagcgccaggcgg	Protospacer
*********************************

5. spacer 2.7|2145519|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 0, identity: 1.0

tgcaggacgagcaggcagtaaagcgccaggcgg	CRISPR spacer
tgcaggacgagcaggcagtaaagcgccaggcgg	Protospacer
*********************************

6. spacer 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to KY271395 (Klebsiella phage 2b LV-2017, complete genome) position: , mismatch: 0, identity: 1.0

ttaaaaaaggccgccatatggcagcctgatggg	CRISPR spacer
ttaaaaaaggccgccatatggcagcctgatggg	Protospacer
*********************************

7. spacer 2.7|2145519|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to KY271395 (Klebsiella phage 2b LV-2017, complete genome) position: , mismatch: 1, identity: 0.97

tgcaggacgagcaggcagtaaagcgccaggcgg	CRISPR spacer
tgcaggacgagcaggcagtaaagcgccatgcgg	Protospacer
**************************** ****

8. spacer 2.9|2145641|33|NZ_CP014123|CRISPRCasFinder,CRT matches to MN098327 (Klebsiella phage Mulock, complete genome) position: , mismatch: 2, identity: 0.939

ttcatcacgtgtgagcggatttggctctatcct	CRISPR spacer
ttcatcacgtgtgagcggatctggttctatcct	Protospacer
********************.***.********

9. spacer 2.9|2145641|33|NZ_CP014123|CRISPRCasFinder,CRT matches to KY271400 (Klebsiella phage 6 LV-2017, complete genome) position: , mismatch: 2, identity: 0.939

ttcatcacgtgtgagcggatttggctctatcct	CRISPR spacer
ttcatcacgtgtgagcggatctggttctatcct	Protospacer
********************.***.********

10. spacer 3.1|2154483|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 3, identity: 0.909

tattttttcgccagcttgtcgtaggtgccgtcc	CRISPR spacer
tatttcttcgccagcttgtcgtaagtgccgtct	Protospacer
*****.*****************.********.

11. spacer 3.1|2154483|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032703 (Pantoea dispersa strain DSM 32899 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

tattttttcgccagcttgtcgtaggtgccgtcc	CRISPR spacer
tattttttcgccagctggtcataggtgccgttc	Protospacer
**************** ***.**********.*

12. spacer 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to MK714353 (Klebsiella phage ST13-OXA48phi12.5, complete genome) position: , mismatch: 3, identity: 0.909

ttaaaaaaggccgccatatggcagcctgatggg	CRISPR spacer
aataaaaaggccgccatatggcagcctgatggg	Protospacer
   ******************************

13. spacer 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 5, identity: 0.848

ttaaaaaaggccgccatatggcagcctgatggg	CRISPR spacer
ataaaaaaggccgccagatggcagcctgttagt	Protospacer
 *************** *********** *.* 

14. spacer 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to CP022016 (Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818

ttaaaaaaggccgccatatggcagcctgatggg	CRISPR spacer
ataaaaaaggccgccatatggcagcccgtggta	Protospacer
 *************************.*  * .

15. spacer 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to MN855766 (Bacteriophage sp. isolate 10, complete genome) position: , mismatch: 6, identity: 0.818

ttaaaaaaggccgccatatggcagcctgatggg	CRISPR spacer
ataaaaaaggccaccataaggcagcctgttagt	Protospacer
 ***********.***** ********* *.* 

16. spacer 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NC_010392 (Phage Gifsy-1, complete genome) position: , mismatch: 7, identity: 0.788

ttaaaaaaggccgccatatggcagcctgatggg	CRISPR spacer
ataaaaaaggccgccgaatggcagcctcaaatg	Protospacer
 **************. ********** * . *

17. spacer 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NC_048759 (Serratia phage MTx, partial genome) position: , mismatch: 7, identity: 0.788

ttaaaaaaggccgccatatggcagcc--tgatggg	CRISPR spacer
gtgaaaaaggccgccgaatggcagcctttgatt--	Protospacer
 *.************. *********  ****   

18. spacer 3.14|2155276|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 7, identity: 0.788

-cgggctgcaggcgcgcgcgtcctccgacctggc	CRISPR spacer
gcagaaggc-ggcgcgcgcggccgccgacctggc	Protospacer
 *.*.  ** ********** ** **********

19. spacer 2.1|2145153|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013709 (Clostridium botulinum strain F634 plasmid pRSJ2_2, complete sequence) position: , mismatch: 8, identity: 0.758

caattttatgtgtatataattattttttgttct	CRISPR spacer
aaattttatatgtatatagttatttttaataac	Protospacer
 ********.********.******** .*  .

20. spacer 2.1|2145153|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013844 (Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence) position: , mismatch: 8, identity: 0.758

caattttatgtgtatataattattttttgttct	CRISPR spacer
aaattttatatgtatatagttatttttaataac	Protospacer
 ********.********.******** .*  .

21. spacer 2.3|2145275|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NC_011667 (Thauera sp. MZ1T plasmid pTha01, complete sequence) position: , mismatch: 8, identity: 0.758

cgactggatcacgtacctgatcagcgtagtggt	CRISPR spacer
cgattggatcacgtacatgatcaggatggctga	Protospacer
***.************ ******* .*.*. * 

22. spacer 3.2|2154544|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 8, identity: 0.758

gagtaaagttgtttttttgcttaatcagatttc----	CRISPR spacer
aagtaaaattgtttttttgctttat----ttacaacg	Protospacer
.******.************** **    ** *    

23. spacer 3.2|2154544|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015355 (Bacillus thuringiensis strain MYBT18246 plasmid p109822, complete sequence) position: , mismatch: 8, identity: 0.758

gagtaaagttgtttttttgcttaatcagatttc	CRISPR spacer
tagtaaagaagtttttttgcttaataacgttca	Protospacer
 *******  *************** * .**. 

24. spacer 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NC_014120 (Paraburkholderia sp. CCGE1002 plasmid pBC201, complete sequence) position: , mismatch: 8, identity: 0.758

ttaaaaaaggccgccatatggcagcctgatggg	CRISPR spacer
ataaaaaaggccgccatacggcagccaatattg	Protospacer
 *****************.******* .    *

25. spacer 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 8, identity: 0.758

ttaaaaaaggccgccatatggcagcctgatggg	CRISPR spacer
ctggcagcggccgacagatggcagcctgatggg	Protospacer
.*.. *. ***** ** ****************

26. spacer 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 8, identity: 0.758

ttaaaaaaggccgccatatggcagcctgatggg	CRISPR spacer
ctggcagcggccgacagatggcagcctgatggg	Protospacer
.*.. *. ***** ** ****************

27. spacer 3.12|2155154|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NC_048198 (Erwinia phage vB_EhrS_59, complete genome) position: , mismatch: 8, identity: 0.758

tgtcgtcac-atagtgctctatccactggttagc	CRISPR spacer
-gcagccctgatagtgctcgatccaccggttagc	Protospacer
 *. *.* . ********* ******.*******

28. spacer 3.14|2155276|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.758

cgggctgcaggcgcgcgcgtcctccgacctggc	CRISPR spacer
tcggctgcaggcgcgcgcgtccgccggcgggcg	Protospacer
. ******************** ***.*  *  

29. spacer 2.1|2145153|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to AP014331 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S36-C30, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.727

caattttatgtgtatataattattttttgttct	CRISPR spacer
tgtattgtcgtgtaaataattattttctgttct	Protospacer
..  **  .***** ***********.******

30. spacer 3.2|2154544|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NC_010010 (Bacillus megaterium QM B1551 plasmid pBM300, complete sequence) position: , mismatch: 9, identity: 0.727

gagtaaagttgtttttttgcttaatcagatttc	CRISPR spacer
attttaagatgtttttttgcttaatctgatagt	Protospacer
.  * *** ***************** ***  .

31. spacer 3.9|2154971|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025810 (Sulfitobacter sp. SK025 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727

cggtcagcacttccagaaaggcggatattccac	CRISPR spacer
cggtcagcacttccttaaaggcggccaccgcgt	Protospacer
**************  ******** .*.. *..

32. spacer 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045066 (Enterobacter roggenkampii strain WCHER090065 plasmid p1_090065, complete sequence) position: , mismatch: 9, identity: 0.727

ttaaaaaaggccgccatatggcagcctgatggg	CRISPR spacer
cgtaaaaaggccgccatctggcagcctttttca	Protospacer
.  ************** *********  *  .

33. spacer 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to MH389777 (Dickeya phage vB_DsoM_JA11, complete genome) position: , mismatch: 9, identity: 0.727

ttaaaaaaggccgccatatggcagcctgatggg	CRISPR spacer
aagaaaaaggccgccaaaaggcagccttaaagt	Protospacer
  .************* * ******** * .* 

34. spacer 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to MH460462 (Dickeya phage vB_DsoM_JA33, complete genome) position: , mismatch: 9, identity: 0.727

ttaaaaaaggccgccatatggcagcctgatggg	CRISPR spacer
aagaaaaaggccgccaaaaggcagccttaaagt	Protospacer
  .************* * ******** * .* 

35. spacer 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to MH460460 (Dickeya phage vB_DsoM_JA13, complete genome) position: , mismatch: 9, identity: 0.727

ttaaaaaaggccgccatatggcagcctgatggg	CRISPR spacer
aagaaaaaggccgccaaaaggcagccttaaagt	Protospacer
  .************* * ******** * .* 

36. spacer 2.5|2145397|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to JQ807227 (Environmental Halophage eHP-6, partial genome) position: , mismatch: 10, identity: 0.697

cgatcccggttcctgatgccgtcgttgtgccgg	CRISPR spacer
ccgacccggttcctggtgccgtcgatgtaagtc	Protospacer
* . ***********.******** ***.    

37. spacer 3.6|2154788|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016621 (Microvirga ossetica strain V5/3m plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.697

cgaggaaatgatcgccattgaccgtaaggcgat	CRISPR spacer
gactggtttgatcgccatggaccggaaggcgag	Protospacer
 .  *.  ********** ***** ******* 

38. spacer 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040096 (Pantoea sp. SO10 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

ttaaaaaaggccgccatatggcagcctgatggg	CRISPR spacer
aagaaaaaggccgccggatggcagcctcgcgtt	Protospacer
  .************. ********** ..*  

39. spacer 3.11|2155093|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NC_048053 (Dickeya phage vB_DsoM_JA29, complete genome) position: , mismatch: 10, identity: 0.697

ttaaaaaaggccgccatatggcagcctgatggg	CRISPR spacer
aagaaaaaggccgccaaaaggcagccttaaatt	Protospacer
  .************* * ******** * .  

40. spacer 2.1|2145153|33|NZ_CP014123|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR735422 (Staphylococcus epidermidis strain none isolate Se_BPH0697 plasmid 2) position: , mismatch: 11, identity: 0.667

caattttatgtgtatataattattttttgttct---------	CRISPR spacer
caattttatgtgtttatacttat---------taaaataaga	Protospacer
************* **** ****         *         

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 3357 2 Liberibacter_phage(100.0%) NA NA
DBSCAN-SWA_2 10085 : 11297 1 Enterobacteria_phage(100.0%) integrase attL 3157:3169|attR 23643:23655
DBSCAN-SWA_3 21830 : 23222 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_4 26356 : 27208 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_5 38189 : 46480 7 Bordetella_phage(25.0%) NA NA
DBSCAN-SWA_6 51522 : 52440 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_7 57079 : 61816 7 Xanthomonas_phage(25.0%) NA NA
DBSCAN-SWA_8 74584 : 83734 9 Prochlorococcus_phage(20.0%) NA NA
DBSCAN-SWA_9 98385 : 100227 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_10 108201 : 109743 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_11 115211 : 116207 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_12 120110 : 123603 4 Mannheimia_phage(33.33%) transposase NA
DBSCAN-SWA_13 127005 : 127977 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_14 133136 : 135876 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_15 146934 : 152907 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_16 196640 : 198683 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_17 207206 : 207998 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_18 214100 : 218207 3 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_19 224507 : 228867 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_20 231951 : 237752 5 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_21 246650 : 248883 4 Anomala_cuprea_entomopoxvirus(66.67%) NA NA
DBSCAN-SWA_22 252309 : 254117 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_23 271860 : 274308 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_24 277379 : 278138 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_25 281483 : 283874 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_26 296699 : 300471 3 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_27 315293 : 316121 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_28 327522 : 337166 9 Acinetobacter_phage(25.0%) NA NA
DBSCAN-SWA_29 345011 : 348380 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_30 368283 : 369755 2 Prochlorococcus_phage(50.0%) tRNA NA
DBSCAN-SWA_31 397279 : 398323 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_32 416032 : 417400 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_33 421345 : 421840 1 Pseudomonas_phage(100.0%) protease NA
DBSCAN-SWA_34 429285 : 430218 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_35 434162 : 447093 15 Hokovirus(16.67%) NA NA
DBSCAN-SWA_36 451142 : 452584 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_37 459182 : 462059 2 Micromonas_pusilla_virus(50.0%) protease NA
DBSCAN-SWA_38 466323 : 472942 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_39 478356 : 480288 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_40 485981 : 493858 10 Invertebrate_iridovirus(25.0%) NA NA
DBSCAN-SWA_41 499132 : 500278 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_42 517183 : 518155 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_43 527718 : 529206 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_44 540555 : 547030 4 Herpes_simplex_virus(50.0%) tRNA NA
DBSCAN-SWA_45 565107 : 579461 13 Acanthocystis_turfacea_Chlorella_virus(20.0%) tRNA NA
DBSCAN-SWA_46 588754 : 589996 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_47 595107 : 601985 9 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_48 606330 : 608226 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_49 611537 : 621440 8 Stx_converting_phage(25.0%) NA NA
DBSCAN-SWA_50 641148 : 642525 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_51 650992 : 652075 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_52 656737 : 657547 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_53 670418 : 671573 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_54 687563 : 688796 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_55 696663 : 699537 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_56 704112 : 705546 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_57 710241 : 722363 10 Brevibacillus_phage(14.29%) tRNA,integrase NA
DBSCAN-SWA_58 728636 : 729656 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_59 732734 : 736866 4 uncultured_Caudovirales_phage(75.0%) NA NA
DBSCAN-SWA_60 751331 : 753011 2 Escherichia_phage(100.0%) integrase attL 745352:745366|attR 755132:755146
DBSCAN-SWA_61 773603 : 777074 3 Trichoplusia_ni_ascovirus(33.33%) NA NA
DBSCAN-SWA_62 782837 : 783965 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_63 789677 : 790679 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_64 796666 : 808584 11 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_65 814095 : 825775 6 Hokovirus(25.0%) NA NA
DBSCAN-SWA_66 858427 : 859252 1 Amsacta_moorei_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_67 864196 : 866697 3 Pandoravirus(50.0%) tRNA NA
DBSCAN-SWA_68 878242 : 878998 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_69 885402 : 886425 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_70 896680 : 897526 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_71 904940 : 910406 3 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_72 913948 : 919285 4 Only_Syngen_Nebraska_virus(33.33%) NA NA
DBSCAN-SWA_73 928051 : 930084 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_74 933154 : 939573 7 uncultured_Mediterranean_phage(40.0%) NA NA
DBSCAN-SWA_75 943039 : 946534 2 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_76 958277 : 959099 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_77 969464 : 970865 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_78 997805 : 998771 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_79 1004523 : 1012761 8 Bodo_saltans_virus(20.0%) tRNA NA
DBSCAN-SWA_80 1027464 : 1032763 5 Bacillus_virus(25.0%) NA NA
DBSCAN-SWA_81 1037944 : 1038847 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_82 1061005 : 1062526 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_83 1104475 : 1106878 2 Escherichia_phage(50.0%) integrase attL 1104412:1104425|attR 1114132:1114145
DBSCAN-SWA_84 1122225 : 1123296 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_85 1130086 : 1132660 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_86 1138562 : 1139861 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_87 1145159 : 1149688 5 Streptomyces_phage(25.0%) tRNA NA
DBSCAN-SWA_88 1155457 : 1177525 19 Bacillus_phage(25.0%) tRNA NA
DBSCAN-SWA_89 1192772 : 1199093 8 Faustovirus(20.0%) NA NA
DBSCAN-SWA_90 1209605 : 1210037 1 Powai_lake_megavirus(100.0%) NA NA
DBSCAN-SWA_91 1220357 : 1226536 4 Bodo_saltans_virus(33.33%) integrase attL 1217298:1217312|attR 1233167:1233181
DBSCAN-SWA_92 1233815 : 1234091 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_93 1237990 : 1239859 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_94 1243628 : 1243802 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_95 1250231 : 1251907 2 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_96 1255446 : 1258441 3 Enterobacteria_phage(50.0%) transposase NA
DBSCAN-SWA_97 1265087 : 1265801 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_98 1300700 : 1304277 5 Paenibacillus_phage(50.0%) NA NA
DBSCAN-SWA_99 1307630 : 1309755 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_100 1313363 : 1323290 9 Hokovirus(25.0%) NA NA
DBSCAN-SWA_101 1337780 : 1340227 2 Clostridioides_phage(50.0%) NA NA
DBSCAN-SWA_102 1343498 : 1348081 5 Pandoravirus(25.0%) NA NA
DBSCAN-SWA_103 1357196 : 1358282 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_104 1366767 : 1367904 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_105 1374346 : 1375864 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_106 1380160 : 1380934 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_107 1393333 : 1393933 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_108 1426018 : 1427224 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_109 1435069 : 1447201 7 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_110 1451341 : 1454754 3 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_111 1458674 : 1459835 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_112 1466201 : 1467209 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_113 1471445 : 1477532 5 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_114 1483287 : 1487599 4 Clostridioides_phage(50.0%) NA NA
DBSCAN-SWA_115 1495431 : 1496286 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_116 1500686 : 1504593 3 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_117 1508357 : 1509878 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_118 1521516 : 1522251 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_119 1526644 : 1527199 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_120 1533733 : 1540789 7 Enterobacteria_phage(50.0%) tRNA NA
DBSCAN-SWA_121 1567808 : 1574713 6 Planktothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_122 1591833 : 1598905 5 Catovirus(25.0%) NA NA
DBSCAN-SWA_123 1617893 : 1638448 16 Cafeteria_roenbergensis_virus(18.18%) NA NA
DBSCAN-SWA_124 1645159 : 1646059 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_125 1650566 : 1655661 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_126 1671182 : 1672019 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_127 1686123 : 1689359 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_128 1693270 : 1694218 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_129 1710943 : 1711129 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_130 1718695 : 1746189 11 Bacillus_phage(28.57%) transposase,integrase attL 1715193:1715207|attR 1746138:1746152
DBSCAN-SWA_131 1756572 : 1758279 1 Faustovirus(100.0%) NA NA
DBSCAN-SWA_132 1762821 : 1770570 4 Erysipelothrix_phage(66.67%) integrase attL 1761536:1761550|attR 1778317:1778331
DBSCAN-SWA_133 1777063 : 1785507 8 Burkholderia_phage(40.0%) NA NA
DBSCAN-SWA_134 1792108 : 1792861 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_135 1809468 : 1810983 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_136 1817920 : 1834467 18 Tupanvirus(25.0%) tRNA NA
DBSCAN-SWA_137 1838392 : 1839868 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_138 1847293 : 1848262 2 Pseudoalteromonas_phage(50.0%) NA NA
DBSCAN-SWA_139 1851985 : 1852639 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_140 1860146 : 1862195 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_141 1867432 : 1867642 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_142 1875082 : 1876642 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_143 1880562 : 1887931 7 Pandoravirus(33.33%) tRNA NA
DBSCAN-SWA_144 1903558 : 1904170 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_145 1921309 : 1923604 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_146 1927465 : 1938209 11 Staphylococcus_phage(40.0%) NA NA
DBSCAN-SWA_147 1951523 : 1954242 4 Microcystis_phage(66.67%) NA NA
DBSCAN-SWA_148 1970984 : 1973736 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_149 1976948 : 1982662 7 Pseudomonas_phage(33.33%) NA NA
DBSCAN-SWA_150 1988173 : 1988962 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_151 2005454 : 2006990 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_152 2011178 : 2017448 8 Synechococcus_phage(25.0%) NA NA
DBSCAN-SWA_153 2025707 : 2028605 3 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_154 2038260 : 2045429 8 Tupanvirus(25.0%) tRNA NA
DBSCAN-SWA_155 2052497 : 2060466 8 Brazilian_cedratvirus(25.0%) NA NA
DBSCAN-SWA_156 2070445 : 2071207 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_157 2087699 : 2088920 1 environmental_halophage(100.0%) NA NA
DBSCAN-SWA_158 2098840 : 2099590 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_159 2107027 : 2108991 2 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_160 2119641 : 2120415 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_161 2123456 : 2124278 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_162 2143801 : 2144872 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_163 2162423 : 2163047 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_164 2171378 : 2172230 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_165 2190744 : 2191575 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_166 2201156 : 2201921 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_167 2205091 : 2205790 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_168 2212128 : 2213290 1 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_169 2222409 : 2224358 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_170 2229542 : 2230313 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_171 2235789 : 2246827 10 Burkholderia_virus(20.0%) NA NA
DBSCAN-SWA_172 2250099 : 2250972 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_173 2255159 : 2256647 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_174 2260453 : 2261815 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_175 2265150 : 2266425 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_176 2277680 : 2279051 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_177 2284602 : 2286653 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_178 2293478 : 2296119 2 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_179 2306550 : 2308512 1 Phage_TP(100.0%) NA NA
DBSCAN-SWA_180 2315440 : 2316454 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_181 2332146 : 2334252 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_182 2338817 : 2339369 1 Leuconostoc_phage(100.0%) NA NA
DBSCAN-SWA_183 2345307 : 2346087 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_184 2355522 : 2356227 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_185 2361658 : 2363203 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_186 2369310 : 2370810 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_187 2377289 : 2378063 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_188 2389334 : 2390951 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_189 2394540 : 2399276 4 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_190 2405129 : 2407467 3 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_191 2412274 : 2412679 1 Stx_converting_phage(100.0%) NA NA
DBSCAN-SWA_192 2422706 : 2425319 1 Rathayibacter_phage(100.0%) NA NA
DBSCAN-SWA_193 2431481 : 2432162 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_194 2447559 : 2449640 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_195 2454438 : 2458556 4 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_196 2464548 : 2465805 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_197 2491931 : 2492669 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_198 2508265 : 2509318 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_199 2522401 : 2522920 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_200 2537196 : 2537970 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_201 2545265 : 2546822 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_202 2554184 : 2555360 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_203 2581150 : 2582530 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_204 2593023 : 2593815 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_205 2606850 : 2608275 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_206 2613672 : 2614434 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_207 2618957 : 2619908 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_208 2624985 : 2625360 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_209 2628606 : 2630112 2 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_210 2634263 : 2650157 15 Escherichia_phage(70.0%) NA NA
DBSCAN-SWA_211 2659303 : 2669299 10 uncultured_Caudovirales_phage(20.0%) NA NA
DBSCAN-SWA_212 2674058 : 2676185 3 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_213 2693309 : 2694269 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_214 2705945 : 2708723 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_215 2728073 : 2728589 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_216 2739828 : 2741130 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_217 2753949 : 2757477 6 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_218 2769656 : 2770862 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_219 2779548 : 2784186 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_220 2810387 : 2811377 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_221 2816495 : 2823611 7 Escherichia_phage(40.0%) tRNA NA
DBSCAN-SWA_222 2826933 : 2827947 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_223 2853515 : 2854614 1 Leptospira_phage(100.0%) transposase NA
DBSCAN-SWA_224 2860682 : 2865849 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_225 2873835 : 2876346 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_226 2890158 : 2895931 3 Hokovirus(50.0%) NA NA
DBSCAN-SWA_227 2926617 : 2928421 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_228 2933051 : 2934986 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_229 2940576 : 2941179 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_230 2946019 : 2951385 5 Tupanvirus(50.0%) protease NA
DBSCAN-SWA_231 2956666 : 2957251 1 uncultured_archaeal_virus(100.0%) NA NA
DBSCAN-SWA_232 2969069 : 2972027 2 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_233 2984270 : 2984948 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_234 2992243 : 2997976 5 Trichoplusia_ni_ascovirus(50.0%) NA NA
DBSCAN-SWA_235 3004240 : 3005068 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_236 3011751 : 3012972 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_237 3019029 : 3019662 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_238 3024964 : 3026911 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_239 3033404 : 3035470 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_240 3039154 : 3039970 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_241 3043283 : 3052810 12 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_242 3059739 : 3063325 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_243 3066614 : 3068399 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_244 3083021 : 3084272 1 Phage_21(100.0%) NA NA
DBSCAN-SWA_245 3087500 : 3088871 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_246 3096328 : 3097465 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_247 3101898 : 3107964 6 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_248 3127688 : 3128330 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_249 3131609 : 3132791 2 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_250 3151947 : 3152199 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_251 3155440 : 3156361 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_252 3164712 : 3165240 1 Infectious_spleen_and_kidney_necrosis_virus(100.0%) NA NA
DBSCAN-SWA_253 3174474 : 3177006 2 uncultured_Caudovirales_phage(50.0%) integrase attL 3168836:3168859|attR 3180063:3180086
DBSCAN-SWA_254 3180452 : 3181241 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_255 3198075 : 3201401 4 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_256 3216236 : 3222812 4 Hokovirus(50.0%) NA NA
DBSCAN-SWA_257 3225882 : 3228075 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_258 3233073 : 3238592 3 Iris_mild_mosaic_virus(50.0%) protease NA
DBSCAN-SWA_259 3243535 : 3245590 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_260 3258283 : 3260191 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_261 3268957 : 3274080 3 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_262 3280142 : 3283214 2 Bandra_megavirus(50.0%) tRNA NA
DBSCAN-SWA_263 3300577 : 3305120 3 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_264 3309293 : 3310382 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_265 3314433 : 3344524 21 Tetraselmis_virus(13.33%) protease,tRNA NA
DBSCAN-SWA_266 3357336 : 3361686 4 Roseobacter_phage(50.0%) NA NA
DBSCAN-SWA_267 3364830 : 3376418 13 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_268 3383891 : 3385891 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_269 3392450 : 3392672 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_270 3401774 : 3404229 3 Shigella_phage(66.67%) transposase NA
DBSCAN-SWA_271 3408705 : 3409314 1 Agrobacterium_phage(100.0%) protease NA
DBSCAN-SWA_272 3415518 : 3416654 2 Shigella_phage(100.0%) transposase NA
DBSCAN-SWA_273 3427226 : 3429086 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_274 3433329 : 3435762 1 Bacteriophage(100.0%) NA NA
DBSCAN-SWA_275 3443342 : 3444935 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_276 3447946 : 3449323 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_277 3453325 : 3458477 6 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_278 3462551 : 3470504 8 Erwinia_phage(20.0%) NA NA
DBSCAN-SWA_279 3475709 : 3477449 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_280 3487616 : 3488522 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_281 3495019 : 3495742 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_282 3499545 : 3505125 4 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_283 3511723 : 3519579 4 Acanthocystis_turfacea_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_284 3522689 : 3523424 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_285 3528270 : 3534793 7 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_286 3539154 : 3542665 4 Edwardsiella_phage(33.33%) NA NA
DBSCAN-SWA_287 3566975 : 3567767 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_288 3573576 : 3581006 6 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_289 3587832 : 3588606 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_290 3593293 : 3597095 2 Escherichia_phage(50.0%) tRNA NA
DBSCAN-SWA_291 3601848 : 3603513 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_292 3607553 : 3608600 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_293 3614604 : 3622570 5 Planktothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_294 3629614 : 3632101 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_295 3636976 : 3637637 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_296 3641727 : 3643798 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_297 3646933 : 3660649 12 Streptococcus_phage(20.0%) NA NA
DBSCAN-SWA_298 3677761 : 3682182 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_299 3694643 : 3699384 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_300 3710766 : 3712311 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_301 3719015 : 3724929 4 Vibrio_phage(50.0%) holin NA
DBSCAN-SWA_302 3729486 : 3731014 2 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_303 3734495 : 3739175 5 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_304 3748128 : 3750852 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_305 3777695 : 3779560 3 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_306 3794928 : 3795726 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_307 3802348 : 3808150 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_308 3816392 : 3819717 2 Catovirus(50.0%) tRNA NA
DBSCAN-SWA_309 3825941 : 3826862 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_310 3833478 : 3842558 8 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_311 3846450 : 3856515 10 Morganella_phage(20.0%) tRNA,integrase attL 3851725:3851738|attR 3853637:3853650
DBSCAN-SWA_312 3865060 : 3865747 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_313 3868929 : 3874136 5 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_314 3884254 : 3892073 9 uncultured_Mediterranean_phage(25.0%) transposase NA
DBSCAN-SWA_315 3897594 : 3906989 11 Leptospira_phage(33.33%) NA NA
DBSCAN-SWA_316 3916163 : 3917273 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_317 3928177 : 3931721 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_318 3936148 : 3936850 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_319 3940080 : 3945249 4 Sodalis_phage(25.0%) protease NA
DBSCAN-SWA_320 3959555 : 3961235 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_321 3974037 : 3978697 6 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_322 3982295 : 3986634 4 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_323 4003461 : 4011981 6 Bacillus_phage(60.0%) NA NA
DBSCAN-SWA_324 4033484 : 4034252 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_325 4045255 : 4048977 5 Anomala_cuprea_entomopoxvirus(66.67%) NA NA
DBSCAN-SWA_326 4058050 : 4058893 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_327 4065505 : 4069215 3 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_328 4079369 : 4079906 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_329 4090807 : 4091272 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_330 4096828 : 4098112 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_331 4115375 : 4115957 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_332 4121464 : 4125674 5 Bradyrhizobium_phage(33.33%) NA NA
DBSCAN-SWA_333 4129739 : 4130543 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_334 4137144 : 4138176 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_335 4151159 : 4155259 2 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_336 4164090 : 4164849 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_337 4176427 : 4177861 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_338 4181816 : 4182161 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_339 4188128 : 4188926 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_340 4211057 : 4217828 6 Acanthamoeba_polyphaga_mimivirus(50.0%) tRNA NA
DBSCAN-SWA_341 4223232 : 4229879 6 Anomala_cuprea_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_342 4241453 : 4242878 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_343 4254218 : 4254782 1 Sphingobium_phage(100.0%) NA NA
DBSCAN-SWA_344 4259049 : 4260093 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_345 4286285 : 4288010 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_346 4299410 : 4300166 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_347 4308865 : 4309567 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_348 4315863 : 4321315 2 Fish_lymphocystis_disease_virus(50.0%) NA NA
DBSCAN-SWA_349 4333773 : 4335354 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_350 4341835 : 4342984 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_351 4349550 : 4359503 7 Tupanvirus(25.0%) tRNA NA
DBSCAN-SWA_352 4363898 : 4364852 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_353 4382009 : 4387169 3 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_354 4393500 : 4394823 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_355 4399558 : 4402279 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_356 4415501 : 4416781 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_357 4419941 : 4423109 3 Sodalis_phage(50.0%) transposase NA
DBSCAN-SWA_358 4458219 : 4459146 1 Sodalis_phage(100.0%) transposase NA
DBSCAN-SWA_359 4474735 : 4476220 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_360 4480136 : 4482881 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_361 4492790 : 4494897 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_362 4498135 : 4503093 4 Leptospira_phage(33.33%) NA NA
DBSCAN-SWA_363 4529613 : 4534924 7 Staphylococcus_phage(33.33%) transposase NA
DBSCAN-SWA_364 4569138 : 4570401 1 Stenotrophomonas_phage(100.0%) integrase attL 4564625:4564638|attR 4577017:4577030
DBSCAN-SWA_365 4573558 : 4578381 5 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_366 4593460 : 4602510 6 Klebsiella_phage(33.33%) tRNA NA
DBSCAN-SWA_367 4606656 : 4612714 5 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_368 4620472 : 4623692 3 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_369 4640048 : 4646627 6 Klosneuvirus(33.33%) NA NA
DBSCAN-SWA_370 4685470 : 4689814 3 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_371 4695744 : 4698970 2 Wolbachia_phage(50.0%) NA NA
DBSCAN-SWA_372 4703812 : 4704358 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_373 4711712 : 4716906 6 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_374 4727632 : 4733279 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_375 4756318 : 4760950 7 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_376 4765314 : 4766817 1 Burkholderia_virus(100.0%) NA NA
DBSCAN-SWA_377 4772176 : 4773723 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_378 4779103 : 4780624 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_379 4786565 : 4788713 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_380 4791855 : 4793814 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_381 4806099 : 4807449 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_382 4814978 : 4816010 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_383 4827989 : 4833296 3 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_384 4836477 : 4839004 2 Yellowstone_lake_mimivirus(50.0%) NA NA
DBSCAN-SWA_385 4844999 : 4845608 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_386 4852697 : 4853807 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_387 4871710 : 4875394 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_388 4888968 : 4890558 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_389 4895979 : 4897743 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_390 4906168 : 4918612 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_391 4922839 : 4925960 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_392 4935801 : 4936416 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_393 4945133 : 4948477 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_394 4960478 : 4963940 3 Sodalis_phage(50.0%) transposase NA
DBSCAN-SWA_395 4967776 : 4971621 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_396 4988015 : 4994157 6 uncultured_marine_virus(20.0%) NA NA
DBSCAN-SWA_397 4998207 : 5000144 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_398 5004635 : 5006657 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_399 5014760 : 5016407 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_400 5026540 : 5028379 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_401 5043009 : 5043672 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_402 5061064 : 5062399 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_403 5066901 : 5070405 4 Feldmannia_irregularis_virus(33.33%) NA NA
DBSCAN-SWA_404 5078743 : 5080255 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_405 5098007 : 5098925 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_406 5105747 : 5108215 2 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_407 5112103 : 5114896 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_408 5129184 : 5135063 5 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_409 5138228 : 5139221 1 Heterosigma_akashiwo_virus(100.0%) NA NA
DBSCAN-SWA_410 5151565 : 5159125 6 Chrysochromulina_ericina_virus(25.0%) NA NA
DBSCAN-SWA_411 5164901 : 5166239 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_412 5173731 : 5181261 7 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_413 5187028 : 5188177 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_414 5191618 : 5192577 2 Cyanophage(50.0%) NA NA
DBSCAN-SWA_415 5204547 : 5209984 7 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_416 5222173 : 5223286 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_417 5241541 : 5242705 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_418 5259860 : 5260910 1 Tupanvirus(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP014124
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12504 : 27875 12 Escherichia_phage(33.33%) integrase,transposase attL 6945:6959|attR 31265:31279
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP014121
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4597 : 71489 54 uncultured_Caudovirales_phage(19.23%) integrase,transposase,holin attL 39771:39787|attR 74501:74517
DBSCAN-SWA_2 124448 : 179830 42 Stx2-converting_phage(21.43%) integrase,transposase,bacteriocin attL 121297:121314|attR 160666:160683
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage