Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP026755 Escherichia coli strain AR_0077 chromosome, complete genome 1 crisprs DinG,cas3,DEDDh,csa3 0 1 9 0
NZ_CP026754 Escherichia coli strain AR_0077 plasmid tig00000042_pilon, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP026755
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026755_1 773404-773551 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP026755_1 1.2|773492|32|NZ_CP026755|CRISPRCasFinder 773492-773523 32 NZ_CP045060 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence 9736-9767 9 0.719
NZ_CP026755_1 1.2|773492|32|NZ_CP026755|CRISPRCasFinder 773492-773523 32 NZ_CP045053 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence 9737-9768 9 0.719
NZ_CP026755_1 1.2|773492|32|NZ_CP026755|CRISPRCasFinder 773492-773523 32 NZ_CP045057 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence 9736-9767 9 0.719

1. spacer 1.2|773492|32|NZ_CP026755|CRISPRCasFinder matches to NZ_CP045060 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcactggtaacatactccacccgcccaccat	CRISPR spacer
tgtcctggtaacatgttccacccgcccggtgt	Protospacer
* . **********..***********. ..*

2. spacer 1.2|773492|32|NZ_CP026755|CRISPRCasFinder matches to NZ_CP045053 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcactggtaacatactccacccgcccaccat	CRISPR spacer
tgtcctggtaacatgttccacccgcccggtgt	Protospacer
* . **********..***********. ..*

3. spacer 1.2|773492|32|NZ_CP026755|CRISPRCasFinder matches to NZ_CP045057 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcactggtaacatactccacccgcccaccat	CRISPR spacer
tgtcctggtaacatgttccacccgcccggtgt	Protospacer
* . **********..***********. ..*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7192 : 55424 43 Vibrio_phage(33.33%) transposase,plate NA
DBSCAN-SWA_2 368109 : 449039 90 Enterobacteria_phage(47.54%) head,tail,tRNA,terminase,capsid,transposase,protease,lysis,integrase,portal attL 378260:378306|attR 426053:426099
DBSCAN-SWA_3 759911 : 773189 15 uncultured_Caudovirales_phage(28.57%) head,terminase,capsid,protease,integrase attL 759237:759251|attR 764113:764127
DBSCAN-SWA_4 1028673 : 1076033 62 Enterobacteria_phage(57.69%) head,tail,tRNA,terminase,capsid,lysis,holin,integrase,portal attL 1033915:1033937|attR 1081296:1081318
DBSCAN-SWA_5 1269688 : 1323747 55 Escherichia_phage(51.06%) tail,tRNA,terminase,lysis,integrase attL 1260007:1260023|attR 1324021:1324037
DBSCAN-SWA_6 1509988 : 1562045 65 Enterobacteria_phage(51.06%) tail,terminase,protease,lysis,portal,integrase attL 1537052:1537067|attR 1566741:1566756
DBSCAN-SWA_7 1945924 : 1985025 50 Escherichia_phage(40.48%) head,tail,terminase,capsid,protease,holin,portal,integrase attL 1966884:1966898|attR 1999192:1999206
DBSCAN-SWA_8 2169301 : 2177610 9 Enterobacteria_phage(83.33%) NA NA
DBSCAN-SWA_9 2438473 : 2451395 6 Escherichia_phage(83.33%) integrase attL 2443970:2443983|attR 2452440:2452453
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage