Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP025397 Staphylococcus haemolyticus strain B plasmid p83131A-B, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP025396 Staphylococcus haemolyticus strain B chromosome, complete genome 1 crisprs WYL,csa3,DEDDh,cas3,DinG 0 1 9 0
NZ_CP025398 Staphylococcus haemolyticus strain B plasmid p83131B, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP025396
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025396_1 1984919-1985005 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP025396_1 1.1|1984949|27|NZ_CP025396|CRISPRCasFinder 1984949-1984975 27 MN693238 Marine virus AFVG_25M402, complete genome 24675-24701 6 0.778

1. spacer 1.1|1984949|27|NZ_CP025396|CRISPRCasFinder matches to MN693238 (Marine virus AFVG_25M402, complete genome) position: , mismatch: 6, identity: 0.778

ccccaaccccagcctgctttgcttgtg	CRISPR spacer
taagaatcccagcctgcgttgcttgtg	Protospacer
.   **.********** *********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 980156 : 987541 10 uncultured_Caudovirales_phage(50.0%) integrase attL 977383:977398|attR 985866:985881
DBSCAN-SWA_2 1100978 : 1142863 35 Staphylococcus_phage(90.0%) transposase,tRNA NA
DBSCAN-SWA_3 1411380 : 1423417 13 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_4 1606695 : 1668167 72 Staphylococcus_phage(67.31%) terminase,integrase,holin,tail,capsid,portal,transposase,head,plate,protease,tRNA attL 1644411:1644470|attR 1677000:1678323
DBSCAN-SWA_5 1887142 : 1895612 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 2122041 : 2135974 12 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_7 2150270 : 2158418 9 Pandoravirus(12.5%) transposase NA
DBSCAN-SWA_8 2221021 : 2272302 51 Staphylococcus_phage(42.86%) transposase,integrase,tRNA attL 2220917:2220976|attR 2264111:2265438
DBSCAN-SWA_9 2496953 : 2542039 48 Staphylococcus_phage(26.32%) transposase,terminase,integrase attL 2501022:2501081|attR 2545258:2546047
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage