Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP024809 Staphylococcus haemolyticus strain 83131A chromosome, complete genome 1 crisprs WYL,csa3,DEDDh,cas3,DinG 0 1 10 0
NZ_CP024810 Staphylococcus haemolyticus strain 83131A plasmid p83131A-A, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. NZ_CP024809
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024809_1 1985916-1986002 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP024809_1 1.1|1985946|27|NZ_CP024809|CRISPRCasFinder 1985946-1985972 27 MN693238 Marine virus AFVG_25M402, complete genome 24675-24701 6 0.778

1. spacer 1.1|1985946|27|NZ_CP024809|CRISPRCasFinder matches to MN693238 (Marine virus AFVG_25M402, complete genome) position: , mismatch: 6, identity: 0.778

ccccaaccccagcctgctttgcttgtg	CRISPR spacer
taagaatcccagcctgcgttgcttgtg	Protospacer
.   **.********** *********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 60487 : 97569 38 Staphylococcus_phage(83.33%) transposase,protease NA
DBSCAN-SWA_2 980153 : 987538 10 uncultured_Caudovirales_phage(50.0%) integrase attL 977380:977395|attR 985863:985878
DBSCAN-SWA_3 1101975 : 1143860 35 Staphylococcus_phage(90.0%) tRNA,transposase NA
DBSCAN-SWA_4 1412377 : 1424414 13 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_5 1607692 : 1669164 72 Staphylococcus_phage(67.31%) holin,tRNA,transposase,integrase,plate,head,tail,capsid,portal,terminase,protease attL 1645408:1645467|attR 1677997:1679320
DBSCAN-SWA_6 1888139 : 1896609 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_7 2123038 : 2136971 12 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_8 2151267 : 2159415 9 Pandoravirus(12.5%) transposase NA
DBSCAN-SWA_9 2222018 : 2273299 52 Staphylococcus_phage(42.86%) integrase,tRNA,transposase attL 2221918:2221977|attR 2269618:2270941
DBSCAN-SWA_10 2497518 : 2542604 48 Staphylococcus_phage(26.32%) terminase,integrase,transposase attL 2501587:2501646|attR 2545823:2546612
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage