Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP026280 Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence 0 crisprs RT 0 0 1 0
NZ_CP026278 Klebsiella oxytoca strain KONIH2 plasmid pKOR-0e8e, complete sequence 1 crisprs DEDDh 0 1 2 0
NZ_CP026281 Klebsiella oxytoca strain KONIH2 plasmid pKOR-01e8, complete sequence 0 crisprs RT,csa3 0 0 11 0
NZ_CP026282 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e3cb, complete sequence 0 crisprs WYL,csa3 0 0 7 0
NZ_CP026285 Klebsiella oxytoca strain KONIH2 chromosome, complete genome 4 crisprs RT,csa3,DEDDh,DinG,cas3,cas14j,WYL 0 1 14 0
NZ_CP026283 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence 1 crisprs RT,csa3 0 0 1 0
NZ_CP026279 Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence 2 crisprs NA 0 3 0 0
NZ_CP026284 Klebsiella oxytoca strain KONIH2 plasmid pKOR-5873, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NZ_CP026280
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3547 : 47152 47 Escherichia_phage(41.67%) transposase,integrase attL 9544:9559|attR 50398:50413
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP026278
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026278_1 8572-8667 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP026278_1 1.1|8602|36|NZ_CP026278|CRISPRCasFinder 8602-8637 36 NZ_CP026278 Klebsiella oxytoca strain KONIH2 plasmid pKOR-0e8e, complete sequence 8602-8637 0 1.0

1. spacer 1.1|8602|36|NZ_CP026278|CRISPRCasFinder matches to NZ_CP026278 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-0e8e, complete sequence) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtacaagtgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtacaagtgagg	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1424 : 20015 33 Enterobacteria_phage(30.77%) lysis NA
DBSCAN-SWA_2 23380 : 43755 25 Cronobacter_phage(45.45%) head,coat NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP026281
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 5701 5 unidentified_phage(100.0%) NA NA
DBSCAN-SWA_2 9342 : 15197 10 Wolbachia_phage(25.0%) NA NA
DBSCAN-SWA_3 18826 : 54246 46 Pseudomonas_phage(14.29%) transposase NA
DBSCAN-SWA_4 57679 : 60766 3 Caulobacter_phage(50.0%) NA NA
DBSCAN-SWA_5 92917 : 97553 5 Rhizobium_phage(25.0%) NA NA
DBSCAN-SWA_6 106788 : 108414 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_7 114975 : 118576 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_8 123973 : 159491 33 Escherichia_phage(27.27%) transposase,integrase attL 136677:136736|attR 155555:156416
DBSCAN-SWA_9 165142 : 182687 19 uncultured_Caudovirales_phage(55.56%) transposase NA
DBSCAN-SWA_10 186210 : 187722 1 Pseudoalteromonas_phage(100.0%) NA NA
DBSCAN-SWA_11 195050 : 195323 1 uncultured_Caudovirales_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP026283
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026283_1 51226-51963 Orphan NA
20 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1231 : 54345 50 Shigella_phage(13.04%) integrase,transposase attL 37195:37208|attR 54428:54441
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP026285
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026285_1 3571620-3571775 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026285_2 3590180-3590270 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026285_3 4987892-4987987 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026285_4 5304781-5304875 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP026285_3 3.1|4987922|36|NZ_CP026285|CRISPRCasFinder 4987922-4987957 36 NZ_CP026278 Klebsiella oxytoca strain KONIH2 plasmid pKOR-0e8e, complete sequence 8602-8637 0 1.0

1. spacer 3.1|4987922|36|NZ_CP026285|CRISPRCasFinder matches to NZ_CP026278 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-0e8e, complete sequence) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtacaagtgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtacaagtgagg	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 607 : 44419 52 Escherichia_phage(23.91%) terminase,capsid,transposase,integrase,holin,tail,portal,protease,head attL 389:413|attR 45190:45214
DBSCAN-SWA_2 138769 : 218073 69 Enterobacteria_phage(13.64%) terminase,capsid,transposase,holin,tail,portal,protease,head NA
DBSCAN-SWA_3 224220 : 233198 6 Pseudomonas_phage(66.67%) NA NA
DBSCAN-SWA_4 378640 : 387034 8 Planktothrix_phage(33.33%) tRNA NA
DBSCAN-SWA_5 447887 : 457524 9 Enterobacteria_phage(37.5%) transposase NA
DBSCAN-SWA_6 598922 : 634476 48 uncultured_Caudovirales_phage(33.33%) lysis,tail,terminase,integrase attL 590263:590276|attR 600391:600404
DBSCAN-SWA_7 986116 : 1060704 56 Escherichia_phage(40.0%) integrase,transposase,plate attL 1021752:1021768|attR 1047694:1047710
DBSCAN-SWA_8 1740729 : 1749153 14 Cronobacter_phage(28.57%) holin,tail NA
DBSCAN-SWA_9 1753802 : 1798153 45 Escherichia_phage(36.36%) tRNA,protease,transposase,plate NA
DBSCAN-SWA_10 1975679 : 2039272 69 Enterobacteria_phage(52.94%) terminase,plate,tRNA,integrase,tail,portal,capsid,head attL 1980967:1980984|attR 2018021:2018038
DBSCAN-SWA_11 3617249 : 3694730 80 Enterobacteria_phage(32.5%) terminase,plate,tRNA,transposase,integrase,tail,portal,capsid,head,protease attL 3621032:3621072|attR 3658068:3658108
DBSCAN-SWA_12 4956298 : 5023072 82 Enterobacteria_phage(24.07%) terminase,tRNA,transposase,integrase,lysis,head,coat attL 4979308:4979345|attR 5027940:5027977
DBSCAN-SWA_13 5150753 : 5201984 41 Catovirus(14.29%) holin,transposase,integrase attL 5145315:5145329|attR 5172739:5172753
DBSCAN-SWA_14 6057396 : 6069938 10 Escherichia_coli_O157_typing_phage(37.5%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_CP026282
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 55863 46 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_2 65059 : 65902 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_3 69782 : 79222 10 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_4 82961 : 126707 40 Salmonella_phage(41.67%) transposase NA
DBSCAN-SWA_5 132937 : 231362 114 Salmonella_phage(21.74%) integrase,transposase attL 137163:137222|attR 184716:185936
DBSCAN-SWA_6 247844 : 256341 8 uncultured_Caudovirales_phage(60.0%) transposase NA
DBSCAN-SWA_7 259343 : 260987 1 Streptococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_CP026279
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026279_1 409-531 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026279_2 23195-23292 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP026279 Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence 430-459 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_KX784503 Citrobacter freundii strain 17285 plasmid p17285-IMP, complete sequence 10818-10847 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_KX784502 Klebsiella oxytoca strain 7121 plasmid p7121-IMP, complete sequence 10803-10832 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_KT148595 Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence 31444-31473 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_KT345947 Klebsiella pneumoniae strain 2013050801 plasmid p0801-IMP, complete sequence 10925-10954 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP010378 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-59.134kb, complete sequence 51328-51357 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 MK368725 Escherichia coli strain JN24 plasmid pJN24NDM1, complete sequence 10938-10967 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NC_019163 Klebsiella pneumoniae plasmid pTR4, complete sequence 10936-10965 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 139306-139335 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP029112 Escherichia coli strain AR436 plasmid unnamed3, complete sequence 51995-52024 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP026205 Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence 62-91 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP034398 Escherichia coli strain CRE1 plasmid pCRE1.4, complete sequence 8399-8428 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP042548 Klebsiella michiganensis strain C52 plasmid pC52_003, complete sequence 16610-16639 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NC_015872 Escherichia coli plasmid p271A, complete sequence 20501-20530 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP027137 Escherichia coli strain AR_0369 plasmid unnamed1, complete sequence 47619-47648 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP026232 Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence 47721-47750 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP019907 Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence 18681-18710 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NC_024954 Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence 10938-10967 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP010382 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence 52732-52761 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP034403 Escherichia coli strain CRE10 plasmid pCRE10.4, complete sequence 34770-34799 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_EF219134 Klebsiella pneumoniae isolate JIE137 plasmid pJIE137, complete sequence 51099-51128 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP022277 Citrobacter freundii strain 18-1 plasmid pD18-1, complete sequence 20194-20223 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP050010 Citrobacter sp. Y3 plasmid unnamed1, complete sequence 32499-32528 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP027617 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence 20352-20381 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP024879 Klebsiella pneumoniae strain NH25 plasmid pNH25.5, complete sequence 34877-34906 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP043856 Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid pIMPIncN3_52kb, complete sequence 320-349 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP026184 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence 39054-39083 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP011646 Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence 33174-33203 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP040826 Enterobacter cloacae strain NH77 plasmid pEcloNH77, complete sequence 29868-29897 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP043516 Enterobacter kobei strain EB_P8_L5_01.19 plasmid pIMPIncN3_57kb, complete sequence 44808-44837 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP027125 Escherichia coli strain AR_0374 plasmid unnamed3 3425-3454 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP026279 Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence 481-510 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_KX784503 Citrobacter freundii strain 17285 plasmid p17285-IMP, complete sequence 10869-10898 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_KX784502 Klebsiella oxytoca strain 7121 plasmid p7121-IMP, complete sequence 10854-10883 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP015078 Escherichia coli strain Ecol_448 plasmid pEC448_OXA163, complete sequence 32880-32909 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_KT148595 Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence 31495-31524 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_KT345947 Klebsiella pneumoniae strain 2013050801 plasmid p0801-IMP, complete sequence 10976-11005 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP034403 Escherichia coli strain CRE10 plasmid pCRE10.4, complete sequence 34719-34748 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP010378 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-59.134kb, complete sequence 51379-51408 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_EF219134 Klebsiella pneumoniae isolate JIE137 plasmid pJIE137, complete sequence 51048-51077 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 MN967025 Klebsiella pneumoniae strain KP2611 plasmid pKP2611-N, complete sequence 11482-11511 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP022277 Citrobacter freundii strain 18-1 plasmid pD18-1, complete sequence 20143-20172 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 MK368725 Escherichia coli strain JN24 plasmid pJN24NDM1, complete sequence 10989-11018 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NC_019163 Klebsiella pneumoniae plasmid pTR4, complete sequence 10987-11016 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 139357-139386 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP050010 Citrobacter sp. Y3 plasmid unnamed1, complete sequence 32448-32477 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP027617 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence 20301-20330 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP024879 Klebsiella pneumoniae strain NH25 plasmid pNH25.5, complete sequence 34826-34855 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP029112 Escherichia coli strain AR436 plasmid unnamed3, complete sequence 52046-52075 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP043856 Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid pIMPIncN3_52kb, complete sequence 269-298 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP026205 Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence 113-142 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_LT985223 Escherichia coli strain 711 plasmid RCS25_p, complete sequence 3799-3828 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP026184 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence 39003-39032 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP034398 Escherichia coli strain CRE1 plasmid pCRE1.4, complete sequence 8450-8479 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP042548 Klebsiella michiganensis strain C52 plasmid pC52_003, complete sequence 16661-16690 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NC_015872 Escherichia coli plasmid p271A, complete sequence 20552-20581 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP011646 Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence 33123-33152 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP040826 Enterobacter cloacae strain NH77 plasmid pEcloNH77, complete sequence 29817-29846 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP043516 Enterobacter kobei strain EB_P8_L5_01.19 plasmid pIMPIncN3_57kb, complete sequence 44757-44786 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP027137 Escherichia coli strain AR_0369 plasmid unnamed1, complete sequence 47670-47699 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP026232 Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence 47772-47801 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 MN583554 Escherichia coli strain M17224 plasmid p17511_70, complete sequence 39760-39789 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP019907 Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence 18732-18761 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_LT985250 Escherichia coli strain 170 plasmid RCS38_p, complete sequence 186437-186466 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NC_024954 Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence 10989-11018 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP027125 Escherichia coli strain AR_0374 plasmid unnamed3 3374-3403 0 1.0
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP010382 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence 52783-52812 0 1.0
NZ_CP026279_2 2.1|23224|40|NZ_CP026279|CRISPRCasFinder 23224-23263 40 NZ_CP026279 Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence 23224-23263 0 1.0
NZ_CP026279_2 2.1|23224|40|NZ_CP026279|CRISPRCasFinder 23224-23263 40 NZ_KT148595 Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence 976-1015 0 1.0
NZ_CP026279_2 2.1|23224|40|NZ_CP026279|CRISPRCasFinder 23224-23263 40 NZ_CP026274 Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence 169583-169622 0 1.0
NZ_CP026279_2 2.1|23224|40|NZ_CP026279|CRISPRCasFinder 23224-23263 40 NZ_CP029112 Escherichia coli strain AR436 plasmid unnamed3, complete sequence 16875-16914 0 1.0
NZ_CP026279_2 2.1|23224|40|NZ_CP026279|CRISPRCasFinder 23224-23263 40 NZ_CP026232 Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence 7925-7964 0 1.0
NZ_CP026279_2 2.1|23224|40|NZ_CP026279|CRISPRCasFinder 23224-23263 40 NZ_CP010382 Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence 22397-22436 0 1.0
NZ_CP026279_2 2.1|23224|40|NZ_CP026279|CRISPRCasFinder 23224-23263 40 NZ_CP027617 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence 51791-51830 0 1.0
NZ_CP026279_2 2.1|23224|40|NZ_CP026279|CRISPRCasFinder 23224-23263 40 NZ_CP026184 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence 14118-14157 0 1.0
NZ_CP026279_2 2.1|23224|40|NZ_CP026279|CRISPRCasFinder 23224-23263 40 NZ_CP011646 Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence 74625-74664 0 1.0
NZ_CP026279_2 2.1|23224|40|NZ_CP026279|CRISPRCasFinder 23224-23263 40 NZ_CP027125 Escherichia coli strain AR_0374 plasmid unnamed3 38535-38574 0 1.0
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 MN967025 Klebsiella pneumoniae strain KP2611 plasmid pKP2611-N, complete sequence 11431-11460 1 0.967
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_LT985223 Escherichia coli strain 711 plasmid RCS25_p, complete sequence 3748-3777 1 0.967
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_LT985250 Escherichia coli strain 170 plasmid RCS38_p, complete sequence 186386-186415 1 0.967
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP015078 Escherichia coli strain Ecol_448 plasmid pEC448_OXA163, complete sequence 32931-32960 1 0.967
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 MN583554 Escherichia coli strain M17224 plasmid p17511_70, complete sequence 39811-39840 1 0.967
NZ_CP026279_2 2.1|23224|40|NZ_CP026279|CRISPRCasFinder 23224-23263 40 NZ_CP026205 Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence 22855-22894 1 0.975
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 NZ_CP035471 Escherichia coli strain U12A plasmid pU12A_D, complete sequence 8472-8501 2 0.933
NZ_CP026279_1 1.1|430|30|NZ_CP026279|PILER-CR 430-459 30 KX863569 Uncultured bacterium plasmid pTRE-131 clone TRE-131, complete sequence 11592-11621 2 0.933
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 NZ_CP035471 Escherichia coli strain U12A plasmid pU12A_D, complete sequence 8523-8552 3 0.9
NZ_CP026279_1 1.2|481|30|NZ_CP026279|PILER-CR 481-510 30 KX863569 Uncultured bacterium plasmid pTRE-131 clone TRE-131, complete sequence 11643-11672 3 0.9
NZ_CP026279_2 2.1|23224|40|NZ_CP026279|CRISPRCasFinder 23224-23263 40 NZ_CP019907 Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence 8399-8438 4 0.9
NZ_CP026279_2 2.1|23224|40|NZ_CP026279|CRISPRCasFinder 23224-23263 40 NZ_CP017587 Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ06, complete sequence 38093-38132 4 0.9

1. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP026279 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

2. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_KX784503 (Citrobacter freundii strain 17285 plasmid p17285-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

3. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_KX784502 (Klebsiella oxytoca strain 7121 plasmid p7121-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

4. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_KT148595 (Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

5. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_KT345947 (Klebsiella pneumoniae strain 2013050801 plasmid p0801-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

6. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP010378 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-59.134kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

7. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to MK368725 (Escherichia coli strain JN24 plasmid pJN24NDM1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

8. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NC_019163 (Klebsiella pneumoniae plasmid pTR4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

9. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

10. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP029112 (Escherichia coli strain AR436 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

11. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP026205 (Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

12. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP034398 (Escherichia coli strain CRE1 plasmid pCRE1.4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

13. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP042548 (Klebsiella michiganensis strain C52 plasmid pC52_003, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

14. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NC_015872 (Escherichia coli plasmid p271A, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

15. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP027137 (Escherichia coli strain AR_0369 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

16. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP026232 (Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

17. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP019907 (Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

18. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NC_024954 (Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

19. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP010382 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

20. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP034403 (Escherichia coli strain CRE10 plasmid pCRE10.4, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

21. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_EF219134 (Klebsiella pneumoniae isolate JIE137 plasmid pJIE137, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

22. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP022277 (Citrobacter freundii strain 18-1 plasmid pD18-1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

23. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP050010 (Citrobacter sp. Y3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

24. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP027617 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

25. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP024879 (Klebsiella pneumoniae strain NH25 plasmid pNH25.5, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

26. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP043856 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid pIMPIncN3_52kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

27. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP026184 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

28. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP011646 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

29. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP040826 (Enterobacter cloacae strain NH77 plasmid pEcloNH77, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

30. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP043516 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid pIMPIncN3_57kb, complete sequence) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

31. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP027125 (Escherichia coli strain AR_0374 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcgggtt	Protospacer
******************************

32. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP026279 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

33. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_KX784503 (Citrobacter freundii strain 17285 plasmid p17285-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

34. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_KX784502 (Klebsiella oxytoca strain 7121 plasmid p7121-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

35. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP015078 (Escherichia coli strain Ecol_448 plasmid pEC448_OXA163, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

36. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_KT148595 (Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

37. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_KT345947 (Klebsiella pneumoniae strain 2013050801 plasmid p0801-IMP, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

38. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP034403 (Escherichia coli strain CRE10 plasmid pCRE10.4, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

39. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP010378 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-59.134kb, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

40. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_EF219134 (Klebsiella pneumoniae isolate JIE137 plasmid pJIE137, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

41. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to MN967025 (Klebsiella pneumoniae strain KP2611 plasmid pKP2611-N, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

42. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP022277 (Citrobacter freundii strain 18-1 plasmid pD18-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

43. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to MK368725 (Escherichia coli strain JN24 plasmid pJN24NDM1, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

44. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NC_019163 (Klebsiella pneumoniae plasmid pTR4, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

45. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

46. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP050010 (Citrobacter sp. Y3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

47. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP027617 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

48. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP024879 (Klebsiella pneumoniae strain NH25 plasmid pNH25.5, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

49. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP029112 (Escherichia coli strain AR436 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

50. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP043856 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid pIMPIncN3_52kb, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

51. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP026205 (Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

52. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_LT985223 (Escherichia coli strain 711 plasmid RCS25_p, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

53. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP026184 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

54. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP034398 (Escherichia coli strain CRE1 plasmid pCRE1.4, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

55. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP042548 (Klebsiella michiganensis strain C52 plasmid pC52_003, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

56. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NC_015872 (Escherichia coli plasmid p271A, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

57. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP011646 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

58. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP040826 (Enterobacter cloacae strain NH77 plasmid pEcloNH77, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

59. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP043516 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid pIMPIncN3_57kb, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

60. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP027137 (Escherichia coli strain AR_0369 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

61. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP026232 (Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

62. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to MN583554 (Escherichia coli strain M17224 plasmid p17511_70, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

63. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP019907 (Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

64. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_LT985250 (Escherichia coli strain 170 plasmid RCS38_p, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

65. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NC_024954 (Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

66. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP027125 (Escherichia coli strain AR_0374 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

67. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP010382 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence) position: , mismatch: 0, identity: 1.0

gtttcttctgttgctcactggctccggctg	CRISPR spacer
gtttcttctgttgctcactggctccggctg	Protospacer
******************************

68. spacer 2.1|23224|40|NZ_CP026279|CRISPRCasFinder matches to NZ_CP026279 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

69. spacer 2.1|23224|40|NZ_CP026279|CRISPRCasFinder matches to NZ_KT148595 (Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

70. spacer 2.1|23224|40|NZ_CP026279|CRISPRCasFinder matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

71. spacer 2.1|23224|40|NZ_CP026279|CRISPRCasFinder matches to NZ_CP029112 (Escherichia coli strain AR436 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

72. spacer 2.1|23224|40|NZ_CP026279|CRISPRCasFinder matches to NZ_CP026232 (Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

73. spacer 2.1|23224|40|NZ_CP026279|CRISPRCasFinder matches to NZ_CP010382 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

74. spacer 2.1|23224|40|NZ_CP026279|CRISPRCasFinder matches to NZ_CP027617 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

75. spacer 2.1|23224|40|NZ_CP026279|CRISPRCasFinder matches to NZ_CP026184 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

76. spacer 2.1|23224|40|NZ_CP026279|CRISPRCasFinder matches to NZ_CP011646 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

77. spacer 2.1|23224|40|NZ_CP026279|CRISPRCasFinder matches to NZ_CP027125 (Escherichia coli strain AR_0374 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
tattacccccccctagcaagataaattgcccccctaaccg	Protospacer
****************************************

78. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to MN967025 (Klebsiella pneumoniae strain KP2611 plasmid pKP2611-N, complete sequence) position: , mismatch: 1, identity: 0.967

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcggggt	Protospacer
**************************** *

79. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_LT985223 (Escherichia coli strain 711 plasmid RCS25_p, complete sequence) position: , mismatch: 1, identity: 0.967

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcggggt	Protospacer
**************************** *

80. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_LT985250 (Escherichia coli strain 170 plasmid RCS38_p, complete sequence) position: , mismatch: 1, identity: 0.967

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcggggt	Protospacer
**************************** *

81. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP015078 (Escherichia coli strain Ecol_448 plasmid pEC448_OXA163, complete sequence) position: , mismatch: 1, identity: 0.967

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcggggt	Protospacer
**************************** *

82. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to MN583554 (Escherichia coli strain M17224 plasmid p17511_70, complete sequence) position: , mismatch: 1, identity: 0.967

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
cttttttcacctgctcagacttcgcggggt	Protospacer
**************************** *

83. spacer 2.1|23224|40|NZ_CP026279|CRISPRCasFinder matches to NZ_CP026205 (Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence) position: , mismatch: 1, identity: 0.975

-tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
atatta-ccccccctagcaagataaattgcccccctaaccg	Protospacer
 ***** **********************************

84. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to NZ_CP035471 (Escherichia coli strain U12A plasmid pU12A_D, complete sequence) position: , mismatch: 2, identity: 0.933

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
ctttttttacctgctcagacttcgcgggct	Protospacer
*******.********************.*

85. spacer 1.1|430|30|NZ_CP026279|PILER-CR matches to KX863569 (Uncultured bacterium plasmid pTRE-131 clone TRE-131, complete sequence) position: , mismatch: 2, identity: 0.933

cttttttcacctgctcagacttcgcgggtt	CRISPR spacer
ctttttttacctgctcagacttcgcgggct	Protospacer
*******.********************.*

86. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to NZ_CP035471 (Escherichia coli strain U12A plasmid pU12A_D, complete sequence) position: , mismatch: 3, identity: 0.9

gtttcttctgttgctcactggctccggctg	CRISPR spacer
ttttcttttgttgctcactggctccggttg	Protospacer
 ******.*******************.**

87. spacer 1.2|481|30|NZ_CP026279|PILER-CR matches to KX863569 (Uncultured bacterium plasmid pTRE-131 clone TRE-131, complete sequence) position: , mismatch: 3, identity: 0.9

gtttcttctgttgctcactggctccggctg	CRISPR spacer
ttttcttttgttgctcactggctccggttg	Protospacer
 ******.*******************.**

88. spacer 2.1|23224|40|NZ_CP026279|CRISPRCasFinder matches to NZ_CP019907 (Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.9

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
aaattaccccccctagcaagataaattgcccccctaaccg	Protospacer
 * *  **********************************

89. spacer 2.1|23224|40|NZ_CP026279|CRISPRCasFinder matches to NZ_CP017587 (Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ06, complete sequence) position: , mismatch: 4, identity: 0.9

tattacccccccctagcaagataaattgcccccctaaccg	CRISPR spacer
aaattaccccccctagcaagataaattgcccccctaaccg	Protospacer
 * *  **********************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_CP026284
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 15328 : 104889 102 Escherichia_phage(27.78%) integrase,transposase,tRNA attL 86067:86085|attR 99806:99824
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage