Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP026129 Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP026127 Acinetobacter baumannii strain ABNIH28 plasmid pNDM-0285, complete sequence 0 crisprs NA 0 0 4 0
NZ_CP026128 Acinetobacter baumannii strain ABNIH28 plasmid pABA-1fe1, complete sequence 0 crisprs DEDDh 0 0 2 0
NZ_CP026126 Acinetobacter baumannii strain ABNIH28 plasmid pABA-6973, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP026125 Acinetobacter baumannii strain ABNIH28 chromosome, complete genome 4 crisprs DEDDh,RT,csa3,cas3,WYL,TnsE_C 0 1 11 0

Results visualization

1. NZ_CP026129
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 13020 : 70783 50 Acinetobacter_phage(23.53%) transposase,integrase attL 12972:13031|attR 74994:76501
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP026128
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 80790 75 Salmonella_phage(31.58%) transposase,tail,terminase,portal NA
DBSCAN-SWA_2 84574 : 105698 23 Rhizobium_phage(25.0%) integrase,transposase attL 76368:76384|attR 99700:99716
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP026127
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 3425 3 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_2 7813 : 14880 8 Moraxella_phage(25.0%) transposase NA
DBSCAN-SWA_3 18446 : 24576 6 Tetraselmis_virus(50.0%) NA NA
DBSCAN-SWA_4 29801 : 30491 1 Mycobacterium_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP026125
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026125_1 637872-638002 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026125_2 644859-644944 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026125_3 976469-976580 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP026125_4 1256917-1257058 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP026125_1 1.2|637955|25|NZ_CP026125|CRISPRCasFinder 637955-637979 25 AP013861 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15H-MedDCM-OCT-S40-C106, *** SEQUENCING IN PROGRESS *** 15391-15415 3 0.88
NZ_CP026125_1 1.2|637955|25|NZ_CP026125|CRISPRCasFinder 637955-637979 25 NC_010630 Nostoc punctiforme PCC 73102 plasmid pNPUN03, complete sequence 18448-18472 3 0.88
NZ_CP026125_1 1.2|637955|25|NZ_CP026125|CRISPRCasFinder 637955-637979 25 MN856032 Bacteriophage sp. isolate 242, complete genome 4970-4994 4 0.84
NZ_CP026125_1 1.2|637955|25|NZ_CP026125|CRISPRCasFinder 637955-637979 25 NC_015937 Thermus phage TMA, complete genome 130919-130943 4 0.84
NZ_CP026125_1 1.2|637955|25|NZ_CP026125|CRISPRCasFinder 637955-637979 25 MN693192 Marine virus AFVG_25M42, complete genome 30603-30627 4 0.84
NZ_CP026125_1 1.2|637955|25|NZ_CP026125|CRISPRCasFinder 637955-637979 25 GU071095 Synechococcus phage S-SM2, complete genome 177140-177164 4 0.84
NZ_CP026125_1 1.2|637955|25|NZ_CP026125|CRISPRCasFinder 637955-637979 25 AP011617 Thermus phage TMA DNA, complete genome 130919-130943 4 0.84

1. spacer 1.2|637955|25|NZ_CP026125|CRISPRCasFinder matches to AP013861 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15H-MedDCM-OCT-S40-C106, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.88

ctggttattttgttgctgttgatta	CRISPR spacer
ctggtaattttgttactgttgattt	Protospacer
***** ********.********* 

2. spacer 1.2|637955|25|NZ_CP026125|CRISPRCasFinder matches to NC_010630 (Nostoc punctiforme PCC 73102 plasmid pNPUN03, complete sequence) position: , mismatch: 3, identity: 0.88

ctggttattttgttgctgttgatta	CRISPR spacer
caggctattttgttgctgctgatta	Protospacer
* **.*************.******

3. spacer 1.2|637955|25|NZ_CP026125|CRISPRCasFinder matches to MN856032 (Bacteriophage sp. isolate 242, complete genome) position: , mismatch: 4, identity: 0.84

ctggttattttgttgctgttgatta	CRISPR spacer
tggtttattttgttgctgttgaata	Protospacer
. * ****************** **

4. spacer 1.2|637955|25|NZ_CP026125|CRISPRCasFinder matches to NC_015937 (Thermus phage TMA, complete genome) position: , mismatch: 4, identity: 0.84

ctggttattttgttgctgttgatta	CRISPR spacer
caaattattttgttgcttttgatta	Protospacer
* ..************* *******

5. spacer 1.2|637955|25|NZ_CP026125|CRISPRCasFinder matches to MN693192 (Marine virus AFVG_25M42, complete genome) position: , mismatch: 4, identity: 0.84

ctggttattttgttgctgttgatta	CRISPR spacer
gtggttcttttgttgcttttgattc	Protospacer
 ***** ********** ****** 

6. spacer 1.2|637955|25|NZ_CP026125|CRISPRCasFinder matches to GU071095 (Synechococcus phage S-SM2, complete genome) position: , mismatch: 4, identity: 0.84

ctggttattttgttgctgttgatta	CRISPR spacer
caccttattttgttgctattgatta	Protospacer
*   *************.*******

7. spacer 1.2|637955|25|NZ_CP026125|CRISPRCasFinder matches to AP011617 (Thermus phage TMA DNA, complete genome) position: , mismatch: 4, identity: 0.84

ctggttattttgttgctgttgatta	CRISPR spacer
caaattattttgttgcttttgatta	Protospacer
* ..************* *******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 53144 : 63289 17 Acinetobacter_phage(57.14%) integrase attL 50960:50974|attR 64940:64954
DBSCAN-SWA_2 89879 : 150067 52 Escherichia_phage(21.05%) transposase,terminase,tail,integrase attL 118659:118677|attR 143710:143728
DBSCAN-SWA_3 288164 : 359971 60 Enterobacteria_phage(23.08%) transposase NA
DBSCAN-SWA_4 366807 : 454572 100 Acinetobacter_phage(59.38%) transposase,integrase,tRNA,tail,lysis,terminase,capsid attL 371920:371940|attR 421626:421646
DBSCAN-SWA_5 501536 : 510520 8 Staphylococcus_phage(16.67%) transposase NA
DBSCAN-SWA_6 1697629 : 1711803 13 Acinetobacter_phage(72.73%) transposase,integrase attL 1696563:1696578|attR 1720885:1720900
DBSCAN-SWA_7 1724006 : 1760858 47 Acinetobacter_phage(73.53%) terminase,capsid NA
DBSCAN-SWA_8 2020648 : 2078095 46 Enterobacteria_phage(16.67%) tRNA,transposase,protease NA
DBSCAN-SWA_9 2272949 : 2334263 53 Enterobacteria_phage(25.0%) tRNA,transposase NA
DBSCAN-SWA_10 2852569 : 2886888 29 uncultured_virus(25.0%) tRNA,transposase,protease NA
DBSCAN-SWA_11 3133447 : 3162907 25 uncultured_Caudovirales_phage(22.22%) transposase,integrase attL 3136478:3136493|attR 3167379:3167394
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage