1. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 0, identity: 1.0
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggtgtc Protospacer
**********************
2. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 0, identity: 1.0
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggtgtc Protospacer
**********************
3. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 0, identity: 1.0
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggtgtc Protospacer
**********************
4. spacer 8.7|1212289|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 1, identity: 0.955
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggcggtgcc Protospacer
********************.*
5. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
6. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
7. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
8. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
9. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
10. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
11. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
12. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
13. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
14. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
15. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
16. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
17. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
18. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
19. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
20. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
21. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
22. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
23. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
24. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
25. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
26. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
27. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
28. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
29. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
30. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
31. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
32. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
33. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
34. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
35. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
36. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
37. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
38. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
39. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
40. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
41. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
42. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
43. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
44. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cggcggcggcgtcggcggtgtc Protospacer
** *******************
45. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
46. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
47. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
48. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
49. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
50. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggtgtcggcggtgtc Protospacer
*********.************
51. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcgccggtgtc Protospacer
************** *******
52. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
53. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
54. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
55. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
56. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
57. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
58. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
59. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
60. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
61. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcctcggcggtgtc Protospacer
********** ***********
62. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to MN369761 (Mycobacterium phage Malthus, complete genome) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
63. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to KJ944841 (Mycobacterium phage Cheetobro, complete genome) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
64. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to AP018469 (Mycobacterium phage Y10 DNA, complete genome, note: sample1) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
65. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to KY087992 (Mycobacterium phage Mitti, complete genome) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
66. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to MF140402 (Mycobacterium phage Chancellor, complete genome) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
67. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to AP018470 (Mycobacterium phage Y2 DNA, complete genome) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
68. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to KT361920 (Mycobacterium phage Slarp, complete genome) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
69. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to MH926058 (Mycobacterium phage Reptar3000, complete genome) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
70. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to MT310882 (Mycobacterium phage JF1, complete genome) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
71. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to AP018471 (Mycobacterium phage Y10 DNA, complete genome, note: sample2) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
72. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to MF140435 (Mycobacterium phage Wintermute, complete genome) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
73. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NC_027365 (Mycobacterium virus Fionnbarth, complete genome) position: , mismatch: 1, identity: 0.955
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtc Protospacer
******************.***
74. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
75. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
76. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcgggccggcggca Protospacer
**********.***********
77. spacer 9.15|1573139|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
78. spacer 9.15|1573139|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
79. spacer 9.15|1573139|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
80. spacer 9.15|1573139|22|NZ_CP025594|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
81. spacer 1.7|335793|24|NZ_CP025594|CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 2, identity: 0.917
atgagcccgccggcgccgccgttg CRISPR spacer
aagagcacgccggcgccgccgttg Protospacer
* **** *****************
82. spacer 1.7|335793|24|NZ_CP025594|CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.917
atgagcccgccggcgccgccgttg CRISPR spacer
atgaggacgccggcgccgccgttg Protospacer
***** *****************
83. spacer 8.7|1212289|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggcggtggg Protospacer
********************
84. spacer 8.7|1212289|22|NZ_CP025594|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
agtcggcggtgccgacggtgtc Protospacer
*************.*******
85. spacer 8.7|1212289|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggcgtc Protospacer
.*****************.***
86. spacer 8.7|1212289|22|NZ_CP025594|CRISPRCasFinder matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgtcggcggtgtc Protospacer
.**********.**********
87. spacer 8.7|1212289|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
ggtcggcggtgccggcggcgtc Protospacer
*****************.***
88. spacer 8.7|1212289|22|NZ_CP025594|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggccgtgta Protospacer
**************** ****
89. spacer 8.7|1212289|22|NZ_CP025594|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggccgtgta Protospacer
**************** ****
90. spacer 8.7|1212289|22|NZ_CP025594|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
ggtcggcggtgccggccgtgtc Protospacer
*************** *****
91. spacer 8.7|1212289|22|NZ_CP025594|CRISPRCasFinder matches to NC_047977 (Microbacterium phage Hendrix, complete genome) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgacggcggtgccggcggtgtg Protospacer
** ******************
92. spacer 8.15|1212673|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 2, identity: 0.909
ggacggtggtaccggcggtcag CRISPR spacer
tgacggtggtgccggcggtcag Protospacer
*********.***********
93. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
ggtcggcggcgtcggcggtgta Protospacer
********************
94. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
tgtcggcggcgtcgacggtgtc Protospacer
.*************.*******
95. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
ggtcggcggcgtcggcggtgcc Protospacer
*******************.*
96. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtg Protospacer
******************.**
97. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtt Protospacer
******************.**.
98. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtt Protospacer
******************.**.
99. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NC_041989 (Mycobacterium phage Shauna1, complete genome) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
ggtcggcggcgtcggcggcgtc Protospacer
*****************.***
100. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
ggtcggcggcgtcggcggcgtc Protospacer
*****************.***
101. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to KY702574 (Mycobacterium phage Kingsley, complete genome) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
ggtcggcggcgtcggcggcgtc Protospacer
*****************.***
102. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
ggtcggcggcgtcggcggcgtc Protospacer
*****************.***
103. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtt Protospacer
******************.**.
104. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcgccggtgtg Protospacer
************** ******
105. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
tgtcggcggcggcggcggtgtc Protospacer
.********** **********
106. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcggcggcgtt Protospacer
******************.**.
107. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
cgtcggcggcgtcgtcggtgtg Protospacer
************** ******
108. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to MF541410 (Streptomyces phage Ozzie, complete genome) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
ggttggcggcgtcggcggtgtc Protospacer
**.******************
109. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to MF541403 (Streptomyces phage BeardedLady, complete genome) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
ggttggcggcgtcggcggtgtc Protospacer
**.******************
110. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to NC_028892 (Streptomyces phage Caliburn, complete genome) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
ggttggcggcgtcggcggtgtc Protospacer
**.******************
111. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to MF541409 (Streptomyces phage Oliynyk, complete genome) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
ggttggcggcgtcggcggtgtc Protospacer
**.******************
112. spacer 8.17|1212763|22|NZ_CP025594|CRISPRCasFinder matches to KT124229 (Streptomyces phage Hydra, complete genome) position: , mismatch: 2, identity: 0.909
cgtcggcggcgtcggcggtgtc CRISPR spacer
ggttggcggcgtcggcggtgtc Protospacer
**.******************
113. spacer 9.2|1572212|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
114. spacer 9.2|1572212|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
115. spacer 9.2|1572212|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
116. spacer 9.2|1572212|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
117. spacer 9.2|1572212|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
118. spacer 9.3|1572266|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909
ggtaccgtcctcgccggcggtg CRISPR spacer
ggcaccgtcctcgccggcggtt Protospacer
**.******************
119. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
120. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
121. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
122. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
123. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
124. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
125. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
126. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
127. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
128. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgggg Protospacer
******************** .
129. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
accgccgatcaggccggcggca Protospacer
..********************
130. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ctcggcgatcaggccggcggca Protospacer
*** *****************
131. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
132. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
133. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
134. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
135. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcg Protospacer
***************** ***.
136. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ggcgccgatcaggccggcggcc Protospacer
* *******************
137. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggcctgcggcg Protospacer
*************** *****.
138. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
139. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgccg Protospacer
******************* *.
140. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgagcaggccggcggcc Protospacer
******** ************
141. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
142. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
143. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
144. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
145. spacer 1.7|335793|24|NZ_CP025594|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ttgagccagccggcgccgccgttc Protospacer
****** ***************
146. spacer 1.7|335793|24|NZ_CP025594|CRT matches to MN010758 (Gordonia phage Dardanus, complete genome) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtgaacccgccggcgccgccgttc Protospacer
.***.******************
147. spacer 1.7|335793|24|NZ_CP025594|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
148. spacer 1.7|335793|24|NZ_CP025594|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
149. spacer 1.7|335793|24|NZ_CP025594|CRT matches to NZ_CP044330 (Methylocystis rosea strain BRCS1 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgacgccgccggcgccgccgttg Protospacer
*** ******************
150. spacer 1.7|335793|24|NZ_CP025594|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
atcagcccgccggcgccgccgaag Protospacer
** ****************** *
151. spacer 1.7|335793|24|NZ_CP025594|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
152. spacer 1.7|335793|24|NZ_CP025594|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
153. spacer 1.7|335793|24|NZ_CP025594|CRT matches to MT740732 (Ralstonia phage Darius, complete genome) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgagcccgccggcgccgccatag Protospacer
*******************.* *
154. spacer 1.7|335793|24|NZ_CP025594|CRT matches to MH638294 (Ralstonia phage GP4, complete genome) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgagcccgccggcgccgccatag Protospacer
*******************.* *
155. spacer 1.7|335793|24|NZ_CP025594|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
gtcagcgcgccggcgccgccgttg Protospacer
.* *** *****************
156. spacer 1.7|335793|24|NZ_CP025594|CRT matches to NZ_CP025550 (Mycobacterium paragordonae strain 49061 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
atgagcccgccagcgccgccgcgg Protospacer
***********.*********. *
157. spacer 1.7|335793|24|NZ_CP025594|CRT matches to NZ_CP034088 (Methylocystis rosea strain GW6 plasmid pGW6_2, complete sequence) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgacgccgccggcgccgccgttg Protospacer
*** ******************
158. spacer 1.7|335793|24|NZ_CP025594|CRT matches to MT740740 (Ralstonia phage Gervaise, complete genome) position: , mismatch: 3, identity: 0.875
atgagcccgccggcgccgccgttg CRISPR spacer
ctgagcccgccggcgccgccatag Protospacer
*******************.* *
159. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgacctcggcggcgcgggcga Protospacer
.***************** ****.
160. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctgggcggcgctggcgg Protospacer
****.*** **************
161. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
162. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
agccgacctcggcggcgatggcgc Protospacer
*.*************** *****
163. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
164. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
165. spacer 6.16|927325|24|NZ_CP025594|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
166. spacer 6.16|927325|24|NZ_CP025594|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
167. spacer 6.16|927325|24|NZ_CP025594|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
168. spacer 6.16|927325|24|NZ_CP025594|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
169. spacer 6.16|927325|24|NZ_CP025594|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
170. spacer 6.16|927325|24|NZ_CP025594|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
171. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aaccggcctcggcggcgctgccgc Protospacer
*****.************** **
172. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccgagctcggcggcgctgccgg Protospacer
***** ************* ***
173. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctcggcggcgcgggcgg Protospacer
****.************ *****
174. spacer 6.16|927325|24|NZ_CP025594|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aacccacctcggcggcgatggcgc Protospacer
**** ************ *****
175. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 3, identity: 0.88
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgcgggcggcctcggcgtagcgctt Protospacer
*** *******************..
176. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 3, identity: 0.88
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgcgggcggcctcggcgtagcgctt Protospacer
*** *******************..
177. spacer 8.7|1212289|22|NZ_CP025594|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtgag Protospacer
.*******************
178. spacer 8.7|1212289|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
gtgcggcggtgccggcggtgtc Protospacer
*******************
179. spacer 8.7|1212289|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
gtgcggcggtgccggcggtgtc Protospacer
*******************
180. spacer 8.7|1212289|22|NZ_CP025594|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtgag Protospacer
.*******************
181. spacer 8.7|1212289|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtggt Protospacer
.******************* .
182. spacer 8.7|1212289|22|NZ_CP025594|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
catcggcggtgccggcggtgtg Protospacer
..*******************
183. spacer 8.11|1212472|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.864
gctgtggggcggcggtggtgcc CRISPR spacer
cgtgtggggcggcggtggtgca Protospacer
*******************
184. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgcgg Protospacer
******************* .
185. spacer 9.4|1572320|22|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
ttcgccgatcaggccggcggtg Protospacer
*******************..
186. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
ctcgccgaacacgcggaagccgtct Protospacer
**.*********** *********
187. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
attgtcgaacacgcggaagccgtcg Protospacer
***.********* **********
188. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
189. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
190. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
191. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
catgcggaacacgccgaatccgtcg Protospacer
* *** ************ ******
192. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgatcacgccgtagccgttg Protospacer
******** ******* ******.*
193. spacer 9.15|1573139|22|NZ_CP025594|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864
caatccggcggcgccgccggca CRISPR spacer
gaatccggcggcgccgccgggc Protospacer
*******************
194. spacer 10.5|2088445|24|NZ_CP025594|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
195. spacer 10.5|2088445|24|NZ_CP025594|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
196. spacer 1.7|335793|24|NZ_CP025594|CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.833
atgagcccgccggcgccgccgttg CRISPR spacer
tcgagcccgccggcgccgccattc Protospacer
.******************.**
197. spacer 1.7|335793|24|NZ_CP025594|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
atgagcccgccggcgccgccgttg CRISPR spacer
tccagcccgccggcgccggcgttg Protospacer
. *************** *****
198. spacer 3.1|366483|27|NZ_CP025594|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
199. spacer 3.1|366483|27|NZ_CP025594|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
200. spacer 3.7|366879|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
201. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
202. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
203. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.867
accacgccggtgaccacgccg-ccaacgacg CRISPR spacer
accacgccggtggccacgccgaccagcggc- Protospacer
************.******** ***.**.*
204. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010326 (Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggctgggctggcggggatat Protospacer
********** ************* .
205. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP021045 (Phaeobacter gallaeciensis strain P129 plasmid pP129_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
206. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010678 (Phaeobacter gallaeciensis strain P75 plasmid pP75_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
207. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NC_023142 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
208. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010789 (Phaeobacter gallaeciensis strain P63 plasmid pP63_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
209. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010642 (Phaeobacter gallaeciensis strain P73 plasmid pP73_f, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
210. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010593 (Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
211. spacer 6.6|926884|27|NZ_CP025594|CRT matches to AM419438 (Archaeal BJ1 virus complete genome) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcggcggcgggggtggcgggggcgg Protospacer
****.********* ********. **
212. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NC_008695 (Archaeal BJ1 virus, complete genome) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcggcggcgggggtggcgggggcgg Protospacer
****.********* ********. **
213. spacer 6.10|927040|27|NZ_CP025594|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgcatccggcggcggcggttgcgttct Protospacer
** **************** ***** .
214. spacer 6.10|927040|27|NZ_CP025594|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggcctcggcggcggcggtggcgttgc Protospacer
*** ..*************.*******
215. spacer 6.10|927040|27|NZ_CP025594|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggccgcggcggcggcggtagcggtgc Protospacer
*** . ***************** ***
216. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc Protospacer
************ ********* ***.**
217. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
218. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
gcccgatctcggcggcgctggcgt Protospacer
. ****.****************
219. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
220. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgtcgacgtcggcggcgctggcgg Protospacer
..**** ****************
221. spacer 6.16|927325|24|NZ_CP025594|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cttcgacttcggcggcgctggcgg Protospacer
.****.****************
222. spacer 6.16|927325|24|NZ_CP025594|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
223. spacer 6.16|927325|24|NZ_CP025594|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
224. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
225. spacer 6.16|927325|24|NZ_CP025594|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
226. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgccgacctcggcggcggtggcga Protospacer
.*************** *****.
227. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
228. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
229. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tctcgacctcggcggcgatggcgg Protospacer
.************** ******
230. spacer 6.16|927325|24|NZ_CP025594|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tgccgacctcggctgcgctggcgc Protospacer
.*********** *********
231. spacer 6.16|927325|24|NZ_CP025594|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ggtcgacctcgacggcgctggcgg Protospacer
...********.************
232. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggcggcctcggcggagcgctg Protospacer
**************** *****.
233. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggcggcctcggcggagcgctg Protospacer
**************** *****.
234. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
235. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to CP003956 (Rhodococcus opacus PD630 plasmid 7, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
gtccggcggccttggcgtagcgcct Protospacer
**********.***********.
236. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
237. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggccccggcgtcgcgcga Protospacer
***********.****** ****
238. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtaatggtc Protospacer
*******************..* .*
239. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggcatcggcgtagcggcg Protospacer
.********* *********** *
240. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggcctccgcgtcgcgcct Protospacer
.************ **** *****.
241. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgtcggcggcctcggcgtagcgggc Protospacer
.*.******************* *
242. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NC_022437 (Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggccgcgtcgtagcgcca Protospacer
.********** ** *********
243. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
244. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggtgtcctcggcgtagcgcga Protospacer
******.* **************
245. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctccgcgaagcgctt Protospacer
************* *** *****..
246. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggctgcctcggcatagcgccg Protospacer
****** ********.*******
247. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
248. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggtggcctcggcgtagccccg Protospacer
.*****.************** **
249. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctccgcgaagcgctt Protospacer
************* *** *****..
250. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tggcggcggcctcgccgtagcgctt Protospacer
** *********** ********..
251. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgtcggcggcctcggcgtagcggac Protospacer
.*.******************* *
252. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
agccggcggcctcggcctcgcgccg Protospacer
*************** * *****
253. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
254. spacer 9.1|1572152|28|NZ_CP025594|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
255. spacer 9.1|1572152|28|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
256. spacer 9.1|1572152|28|NZ_CP025594|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
257. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
tccgccgaacgcgccgaagccgtcg Protospacer
...*******.**************
258. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
259. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
260. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
261. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
262. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
263. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacacgccgatgccctgc Protospacer
***************** *** *
264. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
aatgccgaattcgccgaagccgtcg Protospacer
*******. **************
265. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cccgtagaacacgccgaagccgtcg Protospacer
*..*. *******************
266. spacer 9.14|1573082|25|NZ_CP025594|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgccaccgacccccccttgc CRISPR spacer
ttttccgacaccgacccccccttga Protospacer
.** *** ****************
267. spacer 10.5|2088445|24|NZ_CP025594|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
268. spacer 10.5|2088445|24|NZ_CP025594|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
269. spacer 10.5|2088445|24|NZ_CP025594|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
270. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 5, identity: 0.848
-ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gtcggcg-tgccgatgacgccggccgggccggat Protospacer
.***** .**** ************ *******
271. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 5, identity: 0.848
-ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gtcggcg-tgccgatgacgccggccgggccggat Protospacer
.***** .**** ************ *******
272. spacer 3.1|366483|27|NZ_CP025594|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
273. spacer 3.1|366483|27|NZ_CP025594|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
274. spacer 3.7|366879|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
275. spacer 3.7|366879|27|NZ_CP025594|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
276. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
277. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
278. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
279. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
280. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
281. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
282. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
283. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
284. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
285. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
286. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
287. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
288. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
289. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
290. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
291. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
292. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
293. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
294. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
295. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
296. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
297. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
298. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
299. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
300. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
301. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
302. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
303. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
304. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
305. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
306. spacer 6.6|926884|27|NZ_CP025594|CRT matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggctgggcaggcggggatat Protospacer
********** **** ******** .
307. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcaccggcggggctggcggcatcgg Protospacer
***** *************** . **
308. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP045223 (Achromobacter xylosoxidans strain DN002 plasmid unnamed) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
ccaaagcggcgagactggcggggaggg Protospacer
* *******.*.*************
309. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
tgttcacggcggggctggcggggacgg Protospacer
.**. .****************** **
310. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cggcagcggcggggctggcggagccgc Protospacer
** ******************.* *
311. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cggcagcggcggggctggcggagccgc Protospacer
** ******************.* *
312. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
actcgccggcgcggctggcggggaggg Protospacer
**. ***** ***************
313. spacer 6.10|927040|27|NZ_CP025594|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
314. spacer 6.10|927040|27|NZ_CP025594|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
315. spacer 6.10|927040|27|NZ_CP025594|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
316. spacer 6.10|927040|27|NZ_CP025594|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
317. spacer 6.10|927040|27|NZ_CP025594|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgggtccggcggcggcggtggcggttt Protospacer
***.***************.*** * .
318. spacer 6.10|927040|27|NZ_CP025594|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgactccggcggcgggggtagcgttcg Protospacer
**. *********** *********
319. spacer 6.10|927040|27|NZ_CP025594|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgccgccggcggcggcggtggcgttgg Protospacer
** **************.******
320. spacer 6.10|927040|27|NZ_CP025594|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
321. spacer 6.10|927040|27|NZ_CP025594|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
322. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgaggccggcctgctggtcgtctccgggct Protospacer
*** **************** ******
323. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agattccggcctgttcgtcggctccggcgg Protospacer
**. ********.* **************
324. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg Protospacer
** *..********** ***** *******
325. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg Protospacer
** ******************* * * **
326. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
cgacgccggcatgccggtcggcttcctgct- Protospacer
********** ***.******* *** **
327. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
328. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
329. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg Protospacer
*******.***** ********** ***
330. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctg--ttcggctccggcggcgctggcgg CRISPR spacer
--tactgattacggctccggcggtgctggcgg Protospacer
*.*** * ************.********
331. spacer 6.15|927277|30|NZ_CP025594|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833
--cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg Protospacer
***.* *************** *.*****
332. spacer 6.16|927325|24|NZ_CP025594|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792
aaccgacctcggcggcgctggcgg CRISPR spacer
gggcgacctcggcggcgctggcct Protospacer
.. *******************
333. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 5, identity: 0.853
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggcgacggcgggttcccc Protospacer
******************** ******** *.
334. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
gcgcggcggcctcggcgtagagccg Protospacer
***************** ***
335. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtggccgag Protospacer
******************.**
336. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
caccggcggcctcggcgtagcttgc Protospacer
..******************* . *
337. spacer 8.4|1212127|25|NZ_CP025594|CRISPRCasFinder matches to NC_009469 (Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtggccgag Protospacer
******************.**
338. spacer 9.1|1572152|28|NZ_CP025594|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gctgccgtgggtgccatcgttgccgagt Protospacer
*.***** *****************. .
339. spacer 9.1|1572152|28|NZ_CP025594|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
340. spacer 9.1|1572152|28|NZ_CP025594|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
341. spacer 9.1|1572152|28|NZ_CP025594|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gttgccgcgggtgccctcgttgcggacg Protospacer
******* ******* ******* *.*
342. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gccgccgaacacgccgaagccgttt Protospacer
..********************.
343. spacer 9.5|1572374|25|NZ_CP025594|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaacacgccgacgccgcgc Protospacer
**************** ****.
344. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
345. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
346. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
347. spacer 9.13|1573016|34|NZ_CP025594|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853
gtcgccgtgcagccagccaccaccgcca-ccggcg CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc- Protospacer
*************.********* *** ** **
348. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.839
aacgccc-acttcaccgccgttgccgccgtca CRISPR spacer
-acacccgacttcaccgccgctgccgccgaga Protospacer
**.*** ************.******** *
349. spacer 1.6|335742|30|NZ_CP025594|CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 6, identity: 0.8
ccgatcccactgctggcgaccccgccagcg CRISPR spacer
ccggcgccactgctggcgtccacgccagcc Protospacer
***.. ************ ** *******
350. spacer 1.6|335742|30|NZ_CP025594|CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 6, identity: 0.8
ccgatcccactgctggcgaccccgccagcg CRISPR spacer
ccggcgccactgctggcgtccacgccagcc Protospacer
***.. ************ ** *******
351. spacer 1.6|335742|30|NZ_CP025594|CRT matches to KC292025 (Halovirus HHTV-1, complete genome) position: , mismatch: 6, identity: 0.8
ccgatcccactgctggcgaccccgccagcg-- CRISPR spacer
tcgatcccactgctggccaccctg--aacggc Protospacer
.**************** ****.* *.**
352. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 6, identity: 0.818
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gcgatgccgccgttgccgccggccccgccgggt Protospacer
**..********** ******** ******.*
353. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.818
ccggcgccgccgttgacgccggccgcg--ccggat CRISPR spacer
tccgcgccgccgtcgacgcccgccgcgacccgg-- Protospacer
.* **********.****** ****** ****
354. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 6, identity: 0.818
-ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gcaggcg-tgccgttgacgccggtcgcgcaggaa Protospacer
* **** .**************.***** ***
355. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 6, identity: 0.818
-ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gcaggcg-tgccgttgacgccggtcgcgcaggaa Protospacer
* **** .**************.***** ***
356. spacer 3.1|366483|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
357. spacer 3.6|366813|33|NZ_CP025594|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
358. spacer 3.7|366879|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
359. spacer 3.9|367029|27|NZ_CP025594|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
360. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
361. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
362. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
363. spacer 3.10|367089|27|NZ_CP025594|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
364. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gcgccgccggtgactacgccgccagcgaca Protospacer
.* **********.*********.****.
365. spacer 4.2|631299|30|NZ_CP025594|CRT matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
366. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NC_041891 (Propionibacterium phage B22, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
367. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NC_041894 (Propionibacterium phage E6, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
368. spacer 4.2|631299|30|NZ_CP025594|CRT matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
369. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tccacgccggtgaccacgccgaccaccttg Protospacer
******************** * ** .*
370. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
aagaggccggcgagcacgccgccaacgaag Protospacer
* * *****.** ************** *
371. spacer 4.2|631299|30|NZ_CP025594|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
372. spacer 4.2|631299|30|NZ_CP025594|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
373. spacer 4.2|631299|30|NZ_CP025594|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
374. spacer 4.2|631299|30|NZ_CP025594|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
375. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
376. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
377. spacer 4.2|631299|30|NZ_CP025594|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
378. spacer 4.2|631299|30|NZ_CP025594|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
379. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
380. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_LN907829 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
tgtaagcggctgggctggcggggatat Protospacer
.** ****** ************* .
381. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
tgtcagcggcggggctggcgttcatcg Protospacer
.******************* * *
382. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010826 (Thermus aquaticus Y51MC23 plasmid pTA78, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
tagaagcggcggggctggtggagaggg Protospacer
.. **************.**.*****
383. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
gcgcaccggcggggctggcggggcggc Protospacer
** ***************** **
384. spacer 6.10|927040|27|NZ_CP025594|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggatcctgcggcggcggtagaaagcc Protospacer
******* ************* . *
385. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
386. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
387. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctggtggtcggctacctcga Protospacer
***** ******* ********* * **.
388. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
389. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
390. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
391. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
392. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
393. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac Protospacer
** ** ****************.****.
394. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
395. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
396. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
397. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcg----gctccggcgg CRISPR spacer
cgacgccggccggctggtcggagagctgcg---- Protospacer
*********** ******** *** **
398. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
399. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
400. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg Protospacer
** *************.******.* * *
401. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
402. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
403. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
404. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
405. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
406. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
407. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
408. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
409. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc Protospacer
** *..************** * ******
410. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccgacctgctggtcggggcggactg Protospacer
********.************ * *.* *
411. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
caagctggtcggccccggcggcgctggcaa Protospacer
* **** *****.**************..
412. spacer 6.15|927277|30|NZ_CP025594|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tcacctgtccggctccggcggcggtggcga Protospacer
.* ****.************** *****.
413. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
414. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
415. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg-- CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg Protospacer
.************* ******** .**.*
416. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
417. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
418. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
419. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
420. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg Protospacer
* * .*.******.***************
421. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
422. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
423. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
424. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
425. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
426. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
427. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
428. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
429. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
430. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt--cggctccggcggcgctggcgg CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg Protospacer
.**.*.* **** ****************
431. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt----cggctccggcggcgctggcgg CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg Protospacer
* *** *************** *****
432. spacer 6.15|927277|30|NZ_CP025594|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8
-cctgctgttcggctccggcggcgctggcgg CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg Protospacer
..** * ****** *.**************
433. spacer 6.17|927367|36|NZ_CP025594|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 6, identity: 0.833
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgttgtcggcaacggcggtaacggcgggggtggcgg Protospacer
* .************************ .*****
434. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ggccggcggcaagggcggcgacggcggcgccggc-- Protospacer
************ ******* ***** * .***
435. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
caccggcggcaacggcggcggcggcggcttcggc-- Protospacer
.****************** ****** * ***
436. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
caccggcggcagcggcggcgccggcggcacggct- Protospacer
.*********.*************** ..****
437. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cggcggcggcaacggcggcgctggt-ggtggcaac Protospacer
* ******************.**. ****** *
438. spacer 9.1|1572152|28|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
439. spacer 9.1|1572152|28|NZ_CP025594|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
440. spacer 9.1|1572152|28|NZ_CP025594|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccggcggtgccatcggtgccgagg Protospacer
* ****** ********** *****.
441. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
442. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
443. spacer 9.13|1573016|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824
--gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca Protospacer
****.* ***** ******************.
444. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to NC_009478 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence) position: , mismatch: 6, identity: 0.806
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgaccacttcaccgccgtcgccgccggcg Protospacer
. ** ***************.******* *.
445. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.788
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
cgggcgccgccgatgacgccggccgcgtggagc Protospacer
* ********** **************. *...
446. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttgacgccgccgttgccgccgcccgcgccgctt Protospacer
..*.*********** ***** ******** *
447. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.788
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttgacgccgccgttgccgccgcccgcgccgctt Protospacer
..*.*********** ***** ******** *
448. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 7, identity: 0.788
ccggc--gccgccgttgacgccggccgcgccggat CRISPR spacer
--ggttggccgccgctgccgccggccgcgccgcct Protospacer
**. *******.** ************** *
449. spacer 3.4|366678|27|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
450. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
taggcgccggtgaccccgccgccgacgatg Protospacer
.*********** *******.****.*
451. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tgcgtggcggtgaccacgccgccaatggcg Protospacer
*..* ******************.*.**
452. spacer 4.2|631299|30|NZ_CP025594|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atagcgccggtcaccgcgccgccaacgata Protospacer
*. .******* ***.************..
453. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
454. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
455. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
456. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
457. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ccggcgccggtgaccgcgccgccaaggcag Protospacer
* .***********.********* * *
458. spacer 4.2|631299|30|NZ_CP025594|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggcccgccgatggccacgccgccaacggca Protospacer
. * *****.**.**************.*.
459. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gtcgaggcggtgaccacgccgccgccgacg Protospacer
..*. * ****************. *****
460. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
461. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
462. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
463. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
464. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
465. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
466. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
467. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
468. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
469. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
470. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
471. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
472. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
473. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
474. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
475. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
476. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010614 (Phaeobacter inhibens strain P92 plasmid pP92_d, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
477. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010626 (Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
478. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010671 (Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
479. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggcgggggtggcggcacacc Protospacer
************** ****** . .
480. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010598 (Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
481. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NC_018288 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
482. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP031955 (Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
483. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP016368 (Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattggcggcggggctggcggggatct Protospacer
.*..*******************
484. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NC_018422 (Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
485. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggcgggggtggcggcacacc Protospacer
************** ****** . .
486. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggcgggggtggcggcacacc Protospacer
************** ****** . .
487. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010605 (Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
488. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010744 (Phaeobacter inhibens strain P59 plasmid pP59_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
489. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010622 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
490. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010732 (Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
491. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010655 (Phaeobacter inhibens strain P54 plasmid pP54_e, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
492. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010711 (Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
493. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010702 (Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
494. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010748 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
495. spacer 6.6|926884|27|NZ_CP025594|CRT matches to NZ_CP010739 (Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
496. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc Protospacer
* ****************** *.***
497. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
498. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
499. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
500. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
501. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
502. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
503. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
504. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
505. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
506. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
507. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
508. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
509. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggaccggcccgctggtcggccccggctt Protospacer
**. .******.**********.*****
510. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gctgggcggcctgctggtcggctggggcgg Protospacer
* ***************** *****
511. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
512. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
513. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
514. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
515. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
516. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
517. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt Protospacer
************* ********.*. *
518. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
519. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
520. spacer 6.13|927181|30|NZ_CP025594|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
521. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
522. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
523. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
524. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
525. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
526. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
527. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
528. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
529. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
530. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
531. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
532. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
533. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
534. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
535. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
536. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
537. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
538. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
539. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
540. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
541. spacer 6.13|927181|30|NZ_CP025594|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
542. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
543. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
544. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
545. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
546. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
547. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
548. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
549. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
550. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
551. spacer 6.13|927181|30|NZ_CP025594|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
552. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
553. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
554. spacer 6.13|927181|30|NZ_CP025594|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
555. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
556. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
557. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
558. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
559. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
560. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
561. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
562. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
563. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
564. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
565. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
566. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
567. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
568. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
569. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
570. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
571. spacer 6.13|927181|30|NZ_CP025594|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
572. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
573. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
574. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
575. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
576. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
577. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
578. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
579. spacer 6.13|927181|30|NZ_CP025594|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
acacgccgccctgctggtcggcttaggtcg Protospacer
****** **************. **. *
580. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc Protospacer
.****** **************. * **
581. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agacgccggcctgctgttcggcctcgaccc Protospacer
*************** *****..**.*
582. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggctcggcctgctgctcggcttcggcga Protospacer
**. .********** ******.*****.
583. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
gtcggccggcctgctggtcggcgcccggct- Protospacer
****************** .*****
584. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctgctggtcgacttcatccc Protospacer
***** **************.**.*. *
585. spacer 6.13|927181|30|NZ_CP025594|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
586. spacer 6.13|927181|30|NZ_CP025594|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac Protospacer
** **************** *.****.
587. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga Protospacer
.******* ************* * **.
588. spacer 6.13|927181|30|NZ_CP025594|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
589. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
590. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
591. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg Protospacer
*.. .*.*************** ******
592. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
593. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
594. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
595. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
596. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
597. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
598. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
599. spacer 6.15|927277|30|NZ_CP025594|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
600. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
601. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
602. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
603. spacer 6.15|927277|30|NZ_CP025594|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
actgctgtccggctccggcggca-tgatgtc Protospacer
*******.*************. **..*
604. spacer 6.15|927277|30|NZ_CP025594|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccggccttcgacttcggcggcgctggcgg Protospacer
*.* . ****.**.***************
605. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
606. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gttcctccacggttccggcggcgctggcgg Protospacer
.* ** . ***.*****************
607. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
608. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
609. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
610. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
611. spacer 6.17|927367|36|NZ_CP025594|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 7, identity: 0.806
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgtgatcggcaacggcggaaacggcgggagctgggg Protospacer
**************** *********. * * **
612. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
ggccggaggcaccggcggcgccggcggcacgggc- Protospacer
****** **** *************** ..** .
613. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
gaccggcggcagcggcggcgcgggcggagccggc-- Protospacer
*.*********.********* *****. .***
614. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
cgcaggcggcaacggcggccccggcggcgccgcc- Protospacer
** *************** ******* *. **.
615. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta---- CRISPR spacer
ggccgggggcaacggcggcgacggc----gtctacgac Protospacer
****** ************* **** * ***
616. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
617. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
618. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
tgtcggcggcagcggcggcggcggcggggccggc-- Protospacer
*.********.******** ******* .***
619. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
ggccggcggcatcggcgacgccggctgcttcagc-- Protospacer
*********** *****.******* * * .**
620. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
caccggcggccacggcggcaccggc-ggcggcgat Protospacer
.******** ********.***** **.*** *
621. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP039641 (Azospirillum sp. TSH100 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggcggcaccggcggcggcggcggtgaggcc- Protospacer
.* ******** ******** ****** * ***.
622. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
623. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
624. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
625. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
626. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
627. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
628. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
629. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
630. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
631. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
632. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggtggcagcggcggcgccggcggcggtgct- Protospacer
.* ***.****.*************** * ***
633. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg-tggcta CRISPR spacer
ggtcggcgccaacggcggcgccggtgaactgggt- Protospacer
**.***** ***************.*.. *** *
634. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
635. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
tggcggcggcaacggcggcggtggc-ggtggcggt Protospacer
* ***************** .*** ****** .
636. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
637. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
tgctggcggcaacggcggcgtcggcatcgctggc-- Protospacer
**.****************.****. * ****
638. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cgacggcggcaacggcggcggtggc-ggtggtcac Protospacer
* ***************** .*** *****..*
639. spacer 8.9|1212373|37|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.811
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
tgtcggcggtgccggcggtgccggcggtgccggcgac Protospacer
******************..******* . ***.**
640. spacer 9.1|1572152|28|NZ_CP025594|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75
gttgccgggggtgccatcgttgccggcc CRISPR spacer
agcacccggggtgccgtcgttgccggcg Protospacer
. ..** ********.***********
641. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc Protospacer
. * **** *********.**********
642. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg Protospacer
**. ***.************ ******. *.
643. spacer 10.3|2088355|30|NZ_CP025594|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
644. spacer 10.3|2088355|30|NZ_CP025594|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
645. spacer 10.3|2088355|30|NZ_CP025594|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
646. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
647. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
648. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atccgccatttcaccgccgttgccgacgccg Protospacer
* * ***.**************** **.*.
649. spacer 1.4|335607|36|NZ_CP025594|CRT matches to NZ_CP015744 (Shinella sp. HZN7 plasmid pShin-08, complete sequence) position: , mismatch: 8, identity: 0.778
gcggcg-ccgaagagcaggccggcgttgccgccagcc CRISPR spacer
-cgtcgcccgaagagcaggccggcatggccgcctcgg Protospacer
** ** *****************.* ******
650. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccgtcgccgccgttgccgccggccgcgatcacc Protospacer
*** *********** *********** . . .
651. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta Protospacer
********* ***** ******** * **
652. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
caggcgccgccgtcgacgccggccgccatcgcc Protospacer
* ***********.************ . * .
653. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta Protospacer
********* ***** ******** * **
654. spacer 1.8|335838|33|NZ_CP025594|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta Protospacer
********* ***** ******** * **
655. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
caggcgccgccgtcgacgccggccgccatcgcc Protospacer
* ***********.************ . * .
656. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
caggcgccgtcgttgacgccggacgcgttgccg Protospacer
* *******.************ ****..*
657. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
acgaagccgccgttgccgccggccgcaccgccg Protospacer
**. ********** **********.***
658. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ggggagccgccgttgccgccggccgccgccgac Protospacer
** ********** ********** * **.
659. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccacccccgccgttggcgccgcccgcgccgccg Protospacer
**. * *********.***** ********
660. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
acgaagccgccgtcgccgccggccgcgccgccg Protospacer
**. ********.* **************
661. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
tgatcgccgccgtcgacgccgcccgcgccatat Protospacer
. . *********.******* *******. **
662. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccactgccggcgttgacgccgcccgcgccgccc Protospacer
**. .**** *********** ******** .
663. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccactgccggcgttgacgccgcccgcgccgccc Protospacer
**. .**** *********** ******** .
664. spacer 1.8|335838|33|NZ_CP025594|CRT matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcaccgccgttgccgccggccgtataggcc Protospacer
*****.********* *********... ** .
665. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MK524485 (Mycobacterium phage MissDaisy, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ctcgcgccgccggtgacgcgggccgcgctgccg Protospacer
*. ********* ****** ********.*
666. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MH926058 (Mycobacterium phage Reptar3000, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ctcgcgccgccggtgacgcgggccgcgctgccg Protospacer
*. ********* ****** ********.*
667. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MK524488 (Mycobacterium phage Patt, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ctcgcgccgccggtgacgcgggccgcgctgccg Protospacer
*. ********* ****** ********.*
668. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcaccgccgttgccgccggccgtataggcc Protospacer
*****.********* *********... ** .
669. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccactgccggcgttgacgccgcccgcgccgccc Protospacer
**. .**** *********** ******** .
670. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat---- CRISPR spacer
ccggcgccgccgttggcgccgac----ccgaactaca Protospacer
***************.*****.* ***.*.
671. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gcggagccgccgttgccgccggccgaacctcgt Protospacer
*** ********** ********* .** .*
672. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta Protospacer
********* ***** ******** * **
673. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MH271296 (Gordonia phage Emperor, complete genome) position: , mismatch: 8, identity: 0.758
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
cccttgtcgcctttggcgccggccgcgccggtg Protospacer
** .*.**** ***.***************
674. spacer 3.6|366813|33|NZ_CP025594|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
675. spacer 3.6|366813|33|NZ_CP025594|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
676. spacer 3.6|366813|33|NZ_CP025594|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
677. spacer 3.6|366813|33|NZ_CP025594|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
678. spacer 3.6|366813|33|NZ_CP025594|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
679. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cagacctcggtgaccacgccggcaacgatc Protospacer
** .************** ******.
680. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggttggccggtgaccactccgccagcgatg Protospacer
. . ************ ******.***.*
681. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccggcctgctggtcgggctgacctc Protospacer
********************* .. . *
682. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
683. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
684. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
685. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc Protospacer
* . *** ******************
686. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
687. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct Protospacer
* ************* ********
688. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
689. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcaccgccctgctgatcggctccggcat Protospacer
*.*** *******.***********.
690. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
691. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
692. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt Protospacer
. ******************. *** *
693. spacer 6.13|927181|30|NZ_CP025594|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc Protospacer
* ..************** * ******
694. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
695. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
696. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
697. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
698. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
699. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
700. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgaccatctcggctccgacggcgctggcgc Protospacer
* * .*********.***********
701. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
702. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccaccccgcggctccggaggcgctggcgg Protospacer
*..*. . ********* ***********
703. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
704. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
705. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
706. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
707. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
708. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
709. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
710. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
711. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
712. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
713. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
714. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgatcggctccggcgccggcttctc Protospacer
******* ************ ** . *
715. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgtgcggctccggcggcaaccccga Protospacer
******* *************. . **.
716. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgatgttcgactccggcggcgacgcacc Protospacer
**** ******.*********** .*
717. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg Protospacer
* * .************** ******
718. spacer 6.17|927367|36|NZ_CP025594|CRT matches to MG770216 (Mycobacterium phage Rem711, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
attcggcggcaacggcggcaacggcgcggccggcgc Protospacer
..* . ************.******* ********
719. spacer 6.17|927367|36|NZ_CP025594|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
720. spacer 6.17|927367|36|NZ_CP025594|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
721. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcgacggcggtcgcggt-- Protospacer
. ***************** ****** *.**.
722. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ccccggcggcaacggcggcaacggcggcaatgcc-- Protospacer
*****************. ****** .** *
723. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
cgccggcggcagcgccggcgccggcagtatcggc-- Protospacer
**********.** **********.* .***
724. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
tgtcggcggtaacggcggcgtcggcgg--agccagc Protospacer
*.******.**********.****** .**.*
725. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
726. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_047958 (Burkholderia phage vB_BmuP_KL4, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggccgcaacgacggcgccggcggccggtgc Protospacer
****** ******.************ .**.
727. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
728. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
729. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcgggaagggcggcgccggcggcggtctg Protospacer
******* ** ************** * **.
730. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
731. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
732. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggaaacggtggcgccggcggcacggtg Protospacer
******** *****.*********** * *.
733. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
taccggcggcaatggaggcgccggcggcatcgcc- Protospacer
.**********.** *********** .* **.
734. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
735. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
736. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
737. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
738. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
739. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
740. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
741. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
742. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
743. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
744. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
745. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
746. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
747. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
748. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
749. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg----gtggcta CRISPR spacer
cggcggcggcaccggcggcaccggcggtgccgtg---- Protospacer
* ******** *******.******* ***
750. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ggccggcggcaacgggagcgccggc--ctcgccgcc Protospacer
*************** .******** * **..
751. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcg-gcaacggcggcgccggcgggtggcta CRISPR spacer
-ccgagcgcgccacggcggctccggcgggtggccc Protospacer
* .*** ** ******** ************.
752. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
753. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
754. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
755. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
756. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
757. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
758. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
759. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
760. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
761. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
762. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
763. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
764. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
765. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
766. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
767. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
768. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
769. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggccctggcggctcggtg Protospacer
.***************** *.***** * * *.
770. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
771. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
772. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caccggcggcagcggcggcgcaggcggaaacggc-- Protospacer
.*********.********* ***** ..***
773. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
774. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
775. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
tctcggcggcgacggcggcgacggcggtgttgat- Protospacer
.*******.********* ****** ** * *
776. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcaacggcggccgcggctgccagcca Protospacer
.****************** **** * ..**.*
777. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
gcgcggcggcaccggcggcaccggc-ggcggtcat Protospacer
* ******** *******.***** **.**..*
778. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggcagcggcggcggcggcggacgtcca Protospacer
*.********.******** ******..* *.*
779. spacer 8.9|1212373|37|NZ_CP025594|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.784
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
agtcggcggcggcggcggcaccggcgggaccggcggc Protospacer
********.* **************** . ***..*
780. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc Protospacer
. ********.******.*********
781. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
782. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
783. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
784. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
785. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
786. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
787. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc Protospacer
. **************** *.***** *
788. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
789. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgc--gccttgcccgccgttgccgccggca CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg Protospacer
..** ********** *********** .
790. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
attgccgccctggccgccgttgccgccgatc Protospacer
* * ****.** ***************..
791. spacer 10.3|2088355|30|NZ_CP025594|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
792. spacer 10.3|2088355|30|NZ_CP025594|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
793. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to CP033373 (Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ttagcccacttcacggccgttgccgacgcgg Protospacer
*********** ********** **. .
794. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
795. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
796. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
797. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
798. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
799. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
800. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
801. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
802. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
803. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct Protospacer
.*. *. ***********.**********
804. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
805. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
806. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
807. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca Protospacer
** . .****.*******.**********
808. spacer 14.7|3741111|31|NZ_CP025594|CRT matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atcgcccacttcaccggcgtttccgaccctt Protospacer
* ************** **** *** * ..
809. spacer 1.4|335607|36|NZ_CP025594|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.75
gcggcgccgaagagcaggccggcgttgccgccagcc CRISPR spacer
ccgttgccgatgagcagtccggcgttgccgccgttg Protospacer
** .***** ****** **************. .
810. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
agcgcgccgccgatgacgccggccacggtggcg Protospacer
********* ***********.** .**
811. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NC_010399 (Clavibacter michiganensis subsp. sepedonicus plasmid pCS1, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gctccgccgccgcagacgccggccgcgccatgc Protospacer
* ********. ***************. ..
812. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
agcgcgccgccgatgacgccggccacggtggcg Protospacer
********* ***********.** .**
813. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
agcgcgccgccgatgacgccggccacggtggcg Protospacer
********* ***********.** .**
814. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MN369761 (Mycobacterium phage Malthus, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
815. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MK224497 (Mycobacterium phage Henu3, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
816. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KJ944841 (Mycobacterium phage Cheetobro, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
817. spacer 1.8|335838|33|NZ_CP025594|CRT matches to AP018469 (Mycobacterium phage Y10 DNA, complete genome, note: sample1) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
818. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KY087992 (Mycobacterium phage Mitti, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
819. spacer 1.8|335838|33|NZ_CP025594|CRT matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccggcaccgccgttgccgccggccgtatagacc Protospacer
*****.********* *********... *. .
820. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MF140402 (Mycobacterium phage Chancellor, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
821. spacer 1.8|335838|33|NZ_CP025594|CRT matches to AP018470 (Mycobacterium phage Y2 DNA, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
822. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KT361920 (Mycobacterium phage Slarp, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
823. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MT310882 (Mycobacterium phage JF1, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
824. spacer 1.8|335838|33|NZ_CP025594|CRT matches to AP018471 (Mycobacterium phage Y10 DNA, complete genome, note: sample2) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
825. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KX621007 (Mycobacterium phage Taquito, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
826. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MH051258 (Mycobacterium phage SamScheppers, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg Protospacer
.. ********* ****** ********.*
827. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP036221 (Mycobacterium avium subsp. hominissuis strain mc2 2500 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg Protospacer
**. ****** ********** ******.
828. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP040251 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid unnamed1) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg Protospacer
**. ****** ********** ******.
829. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP040252 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid unnamed2) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg Protospacer
**. ****** ********** ******.
830. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
agggcgccgccgctgccgccggccgcctccggg Protospacer
**********.** ********** .* *.
831. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP029334 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109b, complete sequence) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg Protospacer
**. ****** ********** ******.
832. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccactaccggcgttgacgccgcccgcgccgccc Protospacer
**. ..*** *********** ******** .
833. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccactaccggcgttgacgccgcccgcgccgccc Protospacer
**. ..*** *********** ******** .
834. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
aggacgccgccggagacgccggccgcgcggtcc Protospacer
*.******** ************** * .
835. spacer 1.8|335838|33|NZ_CP025594|CRT matches to JX163858 (Caulobacter phage phiCbK, complete genome) position: , mismatch: 9, identity: 0.727
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
ccactaccggcgttgacgccgcccgcgccgccc Protospacer
**. ..*** *********** ******** .
836. spacer 3.6|366813|33|NZ_CP025594|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
837. spacer 3.6|366813|33|NZ_CP025594|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
838. spacer 3.6|366813|33|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
839. spacer 3.6|366813|33|NZ_CP025594|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
840. spacer 4.2|631299|30|NZ_CP025594|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cccacgccggtcaccacgccgctgcccggc Protospacer
********** **********.. * .
841. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
842. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
843. spacer 5.1|692011|31|NZ_CP025594|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
844. spacer 6.13|927181|30|NZ_CP025594|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggcgccggcctgctggtcggactgctcac Protospacer
**.****************** .. *.
845. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
846. spacer 6.15|927277|30|NZ_CP025594|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
847. spacer 6.17|927367|36|NZ_CP025594|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 9, identity: 0.75
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtacggc Protospacer
** ******** *************** * .. *
848. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcaacggc-- Protospacer
. ****************. ****** ..***
849. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcggcaacggcggccgcggcggcgacggc-- Protospacer
. **************** ***** *..***
850. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggcaactgcggcgccggcgcccaccgc Protospacer
************ ************ .. *
851. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcagcaatggcggcgccggcggcgccggc-- Protospacer
. ****.****.************* * .***
852. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcgggaccggcggcgccggcggcagtatc Protospacer
* ****** * *************** * *
853. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
854. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
855. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
856. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
857. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
858. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggccacggcggcgtcggcggtcaggaa Protospacer
*.******* *********.****** ..* *
859. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcggcggcgggggcacc Protospacer
.********* ******** ******* * .
860. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggcgccggcgtctaccag Protospacer
********** ************* *. * .
861. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
862. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaccggcggcgccgccggccatcat Protospacer
*.********* *********** *** .. *
863. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
864. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
865. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
866. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
867. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcggcaatggcggcaccggcggcacggtc Protospacer
* *********.******.******* * *
868. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
869. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
870. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcggcagcggtggtgga Protospacer
****************** *.**** * *
871. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
872. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
873. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
874. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
875. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
876. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
877. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
878. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
879. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
880. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
881. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
882. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
883. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
884. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
885. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
886. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
887. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaacggcggcggcggtggctcctcg Protospacer
*.****************** ***.** * ...
888. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
889. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
890. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
891. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
892. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
893. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
894. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
895. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggccccggcggcgccggccagctgcac Protospacer
********* ************* .*. **
896. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
897. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ctgcggcggcgacggcggcaccggcggaggcagc-- Protospacer
*******.********.****** **..**
898. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gttcggcggcgagggcggcgccggcggcaagcgt Protospacer
* .*******.* ************** .**
899. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
900. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggcggcaacggcggccgcggcggctccgtg Protospacer
* **************** ****** * *.
901. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
902. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcgccggcggcgccggcggcgaggga Protospacer
* *******. *************** .* *
903. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
904. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
905. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caccggcggcaacggcggcaccgccgacaacggc-- Protospacer
.*****************.*** ** ...***
906. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
907. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
908. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
909. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
910. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
911. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
912. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
913. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcggcagc-- Protospacer
. ****************. ***** **..**
914. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
915. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggcaacggcggcttcccc Protospacer
*. ****************. ****** * *.
916. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggccgcaacggcggctccggcggcgggaac Protospacer
* **** *********** ******* **
917. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
918. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
919. spacer 8.9|1212373|37|NZ_CP025594|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.757
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
ggtgggcggtgccggcggcagcggcggcatggccttc Protospacer
** **************** ****** *.* * *
920. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg Protospacer
.... ****.***************** .*.
921. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
tggcccgccttgccctccattgccgccggac Protospacer
. . ********** **.**********
922. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
atccttgccttgaccgccgttgccgccgctg Protospacer
* .. .****** *************** ..
923. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accccagccctgcccgccgttgccgccgctc Protospacer
* .. ***.****************** .
924. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc Protospacer
. ******** ********* **** .*
925. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accggcaccttgcccgccattgccgccatgt Protospacer
* . **.***********.********.
926. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc Protospacer
. *******.******* *******.*
927. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
agcgtggccttggccgccgttgccggcggtc Protospacer
*.. ****** ************ ***.
928. spacer 14.5|3740970|34|NZ_CP025594|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg Protospacer
.** .********.**** ***********.
929. spacer 14.5|3740970|34|NZ_CP025594|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg Protospacer
*. . *. *****.***** *************.
930. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
tgctcgccgccgatgacgccggccgtgcgcagt Protospacer
. ******** ************.** ..*
931. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP018080 (Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
agggcgccgccgatgacggcggccgcggtcagg Protospacer
********** ***** ******** . ..
932. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MH371116 (Mycobacterium phage DMoney, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
933. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MH045569 (Mycobacterium phage Schiebel, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
934. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MH371119 (Mycobacterium phage OctaviousRex, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
935. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MF919497 (Mycobacterium phage Chance64, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
936. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MH001456 (Mycobacterium phage CLED96, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
937. spacer 1.8|335838|33|NZ_CP025594|CRT matches to GQ303261 (Mycobacterium phage Hope, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
938. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MG099946 (Mycobacterium phage LouisV14, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
939. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KC787112 (Mycobacterium phage Clark, partial genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
940. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MH779513 (Mycobacterium phage Olga, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
941. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MK919475 (Mycobacterium phage Camri, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
942. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MK310146 (Mycobacterium phage Crespo, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
943. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MK524493 (Mycobacterium phage Darionha, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
944. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MH779505 (Mycobacterium phage Grizzly, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
945. spacer 1.8|335838|33|NZ_CP025594|CRT matches to EU568876 (Mycobacterium phage BPs, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
946. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KC787107 (Mycobacterium phage Bo4, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
947. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MF668268 (Mycobacterium phage Aroostook, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
948. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MK524494 (Mycobacterium phage Rabbs, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
949. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KX588251 (Mycobacterium phage Jane, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
950. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KC787103 (Mycobacterium phage Chy2, partial genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
951. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MH001455 (Mycobacterium phage Remy19, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
952. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KT355472 (Mycobacterium phage Cedasite, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
953. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KX664455 (Mycobacterium phage Zombie, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
954. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MH077584 (Mycobacterium phage Phish, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
955. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KC787108 (Mycobacterium phage DNAIII, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
956. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MN444875 (Mycobacterium phage Jonghyun, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
957. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MK433279 (Mycobacterium phage Kareem, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
958. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KJ725374 (Mycobacterium phage Guo1, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
959. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NC_031102 (Mycobacterium phage Sneeze, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
960. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MT818422 (Mycobacterium phage Periodt, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
961. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MK305884 (Mycobacterium phage BQuat, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
962. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MF668272 (Mycobacterium phage Gideon, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
963. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KC787111 (Mycobacterium phage Sedge, partial genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
964. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KC787104 (Mycobacterium phage Chy3, partial genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
965. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NC_012788 (Mycobacterium phage Angel, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
966. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KX443326 (Mycobacterium phage BruceB, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
967. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MK433277 (Mycobacterium phage Renaissance, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
968. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MH590605 (Mycobacterium phage Cherrybomb426, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
969. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MH779509 (Mycobacterium phage Kasen3, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
970. spacer 1.8|335838|33|NZ_CP025594|CRT matches to JN699002 (Mycobacterium phage Avrafan, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
971. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MH779507 (Mycobacterium phage Hotshotbaby7, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
972. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KT355474 (Mycobacterium phage Frosty24, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
973. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KC787109 (Mycobacterium phage Legendre, partial genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
974. spacer 1.8|335838|33|NZ_CP025594|CRT matches to JN412593 (Mycobacterium phage Liefie, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
975. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MH479920 (Mycobacterium phage Mowgli, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
976. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KM923970 (Mycobacterium phage Gomashi, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
977. spacer 1.8|335838|33|NZ_CP025594|CRT matches to MH450127 (Mycobacterium phage Plagueis, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
978. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KT347314 (Mycobacterium phage Phreak, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
979. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KT365399 (Mycobacterium phage Annihilator, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
980. spacer 1.8|335838|33|NZ_CP025594|CRT matches to KC787110 (Mycobacterium phage Leo, complete genome) position: , mismatch: 10, identity: 0.697
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg Protospacer
. ********** ************* .
981. spacer 3.6|366813|33|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
982. spacer 3.6|366813|33|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
983. spacer 3.6|366813|33|NZ_CP025594|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
984. spacer 6.2|926677|39|NZ_CP025594|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744
cggcgcgggcggggccgtcacgggaaccggcgccaccgg CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc Protospacer
*. * ** ********.**************** *
985. spacer 6.5|926830|36|NZ_CP025594|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
986. spacer 6.5|926830|36|NZ_CP025594|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
987. spacer 6.5|926830|36|NZ_CP025594|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
988. spacer 6.5|926830|36|NZ_CP025594|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
989. spacer 6.5|926830|36|NZ_CP025594|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
990. spacer 6.17|927367|36|NZ_CP025594|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
atctggaggcaacggcggtaacggcggggccagcac Protospacer
... . ************************.**.
991. spacer 6.17|927367|36|NZ_CP025594|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gaccggcggcaacggcggaaacggcggcgccgcagc Protospacer
* . . ************ ******** **** *
992. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcg-----ggtggcta CRISPR spacer
ccgcggcggcgacggcggcgcgggcggcaccggt----- Protospacer
*******.********** **** ***
993. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggtaccggcggtgacgtc Protospacer
*. ***************..******* . *
994. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acccggcggcaccggcggcgcgggcggtccggcc Protospacer
. ********* ********* ***** . * .
995. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggcatcggcgccgccggcgcggcatcg Protospacer
********** ***** ******** * ....
996. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaccggaggcgccggcggaggcacc Protospacer
********* *** ***********. * .
997. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
atccggcggcgccggcggcgccggcggcggaact Protospacer
. ********. *************** *. .
998. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
999. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcaccggcggcaccgga Protospacer
.********* *******.******* *
1000. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
1001. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
1002. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1003. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to AP018709 (Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1004. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta------- CRISPR spacer
ggccgacggcaagggcggcgcc-------ggttacgcctcc Protospacer
*****.****** ********* **.**
1005. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
1006. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1007. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgacggcggcaacagcggcaccggcggagcgaag Protospacer
* **********.*****.*******. * .
1008. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1009. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1010. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
1011. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1012. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1013. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_008385 (Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1014. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1015. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1016. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_MN366359 (Bacterium plasmid pALTS31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1017. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcaacaacggcggcgccggcgccttcttc Protospacer
.*****..***************** * .*
1018. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1019. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1020. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1021. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1022. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
1023. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
1024. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1025. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
1026. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
1027. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1028. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1029. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1030. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1031. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1032. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1033. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1034. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1035. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1036. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1037. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_001381 (Mycobacterium fortuitum plasmid pAL5000, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcagcggcggcgctggcggcggcacg Protospacer
* ********.*********.***** * ..
1038. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1039. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1040. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1041. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1042. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1043. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to KU356987 (Variovorax paradoxus plasmid pBS64, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1044. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to KU356988 (Variovorax paradoxus plasmid pHB44, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1045. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcgacggcggcgacggcgccccgcgc Protospacer
********.********* ***** . **
1046. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP009797 (Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1047. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_013176 (Pseudomonas putida plasmid pW2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1048. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1049. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP017455 (Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1050. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1051. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1052. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacgtcggcaccggcggcgccggcggcgcgaag Protospacer
* ** ***** *************** * .
1053. spacer 8.9|1212373|37|NZ_CP025594|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 10, identity: 0.73
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc Protospacer
. ***.**************.*******. * * *
1054. spacer 8.9|1212373|37|NZ_CP025594|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 10, identity: 0.73
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc Protospacer
. ***.**************.*******. * * *
1055. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
1056. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg Protospacer
.. ****** *******.******** .
1057. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggccagaacttccccgctgttgccgccggca Protospacer
..... . *** *****.*************
1058. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
1059. spacer 9.10|1572767|31|NZ_CP025594|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc Protospacer
... ****** ************ ***.
1060. spacer 9.13|1573016|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706
gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca Protospacer
. .. .*******.***************.**.
1061. spacer 12.9|3119764|35|NZ_CP025594|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
1062. spacer 13.20|3123236|34|NZ_CP025594|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
1063. spacer 14.5|3740970|34|NZ_CP025594|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc Protospacer
. * ***** **************** **
1064. spacer 14.5|3740970|34|NZ_CP025594|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
1065. spacer 14.5|3740970|34|NZ_CP025594|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
1066. spacer 14.5|3740970|34|NZ_CP025594|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
1067. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 11, identity: 0.667
ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
gacaggccgccgtcgacgccggccgcaccccgc Protospacer
. ********.************.** ..
1068. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcacgtcg Protospacer
. ****************. ****** *...
1069. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcagcggcggcggcggcggaaccccg Protospacer
.********.******** ******. *..
1070. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MH051334 (Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
1071. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to MG852086 (Escherichia phage vB_EcoS-Ro145clw, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
1072. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggccacggcggggccggcggcgacgcg Protospacer
.******** ******* ******** . ..
1073. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcaagggcggcgccgccggcgatcag Protospacer
.********* ********** *** . * .
1074. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caggggcggcaacggcggccccggcaggacggcg Protospacer
. *************** *****.** * ..
1075. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cataggcggcgatggcggcgccggcgggatggcg Protospacer
.. ******.*.*************** * ..
1076. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccgacggcaagggcggcgccggatacgccccc Protospacer
*****.****** *********** . *.
1077. spacer 14.5|3740970|34|NZ_CP025594|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc Protospacer
...*. **.********.************
1078. spacer 1.8|335838|33|NZ_CP025594|CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 12, identity: 0.636
--ccggcgccgccgttgacgccggccgcgccggat CRISPR spacer
acagcgcgccgccggcgtccacggcggcgccgt-- Protospacer
********* .* * **** ******
1079. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
aaccggcggcgacggcgtcgccggcgccaattcg Protospacer
..********.****** ******** . ...
1080. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_CP026703 (Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgc-----cggcgggtggcta CRISPR spacer
-gccggaaacgccggcgccgctgttgcggccggtg---- Protospacer
***** ..*. ***** *** **** ****
1081. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 14, identity: 0.588
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccggcgtttccgccgaga----- Protospacer
***** ****. ***** . *** **.*
1082. spacer 8.3|1212070|34|NZ_CP025594|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 15, identity: 0.559
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccgacgtttccgccgaga----- Protospacer
***** ****. **.** . *** **.*