Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP014173 Clostridium botulinum strain B609 plasmid pRSJ22_2, complete sequence 0 crisprs NA 0 0 3 0
NZ_CP014172 Clostridium botulinum strain B609 plasmid pRSJ22_1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP014174 Clostridium botulinum strain B609 chromosome, complete genome 7 crisprs DEDDh,csa3,DinG,WYL,cas3,csx1,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,casR 0 2 11 0

Results visualization

1. NZ_CP014173
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 11904 20 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_2 15269 : 36601 41 Aeribacillus_phage(16.67%) plate,protease,head,capsid,tail NA
DBSCAN-SWA_3 40483 : 54437 24 Clostridium_phage(30.77%) terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP014174
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014174_1 1036269-1036361 Orphan III-B
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014174_2 1103478-1103569 Orphan III-B
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014174_3 1884819-1885036 Unclear NA
3 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014174_4 2286356-2286715 TypeIII III-B
5 spacers
csx1,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014174_6 2287380-2287475 TypeIII III-B
1 spacers
csx1,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014174_5 2286968-2287127 TypeIII III-B
2 spacers
csx1,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP014174_7 2301817-2301911 TypeIII III-B
1 spacers
cas10,csm2gr11,csm3gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NZ_CP013700 Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence 84483-84517 2 0.943
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NZ_CP013710 Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence 28409-28443 2 0.943
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NZ_CP014152 Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence 9866-9900 2 0.943
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NZ_CP006909 Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence 5036-5070 3 0.914
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NC_010418 Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence 79434-79468 3 0.914
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NC_010379 Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence 102786-102820 3 0.914
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NC_025146 Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111 79772-79806 4 0.886
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NC_025146 Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111 200531-200565 4 0.886
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NC_010418 Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence 83392-83426 4 0.886
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NC_010418 Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence 205022-205056 5 0.857
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NZ_CP013710 Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence 29200-29234 6 0.829
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NZ_CP014152 Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence 9075-9109 6 0.829
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NC_010418 Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence 169943-169977 6 0.829
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NC_012654 Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence 146329-146363 6 0.829
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NZ_CP031095 Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence 235820-235854 6 0.829
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NC_010379 Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence 37038-37072 6 0.829
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NZ_CP013684 Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence 88444-88478 7 0.8
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NZ_CP013700 Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence 168896-168930 8 0.771
NZ_CP014174_5 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder 2286998-2287032 35 NC_025146 Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111 249579-249613 8 0.771
NZ_CP014174_3 3.2|1884908|40|NZ_CP014174|CRISPRCasFinder 1884908-1884947 40 NC_018689 Bacillus thuringiensis MC28 plasmid pMC429, complete sequence 417214-417253 11 0.725

1. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NZ_CP013700 (Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence) position: , mismatch: 2, identity: 0.943

taatacaaaaattagatccaggaatgaaattatta	CRISPR spacer
caatacaaaaattagatccaggaatgaaataatta	Protospacer
.***************************** ****

2. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NZ_CP013710 (Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence) position: , mismatch: 2, identity: 0.943

taatacaaaaattagatccaggaatgaaattatta	CRISPR spacer
taattcaaaaattatatccaggaatgaaattatta	Protospacer
**** ********* ********************

3. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NZ_CP014152 (Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence) position: , mismatch: 2, identity: 0.943

taatacaaaaattagatccaggaatgaaattatta	CRISPR spacer
taattcaaaaattatatccaggaatgaaattatta	Protospacer
**** ********* ********************

4. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NZ_CP006909 (Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence) position: , mismatch: 3, identity: 0.914

taatacaaaaattagatccaggaatgaaattatta	CRISPR spacer
caatacaaaaattagatccaggaatgaaattaatg	Protospacer
.******************************* *.

5. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NC_010418 (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence) position: , mismatch: 3, identity: 0.914

taatacaaaaattagatccaggaa-tgaaattatta	CRISPR spacer
taatacaagaataagatccaggaattgaaattatt-	Protospacer
********.*** *********** ********** 

6. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NC_010379 (Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence) position: , mismatch: 3, identity: 0.914

taatacaaaaattagatccaggaa-tgaaattatta	CRISPR spacer
taatacaagaataagatccaggaattgaaattatt-	Protospacer
********.*** *********** ********** 

7. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NC_025146 (Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111) position: , mismatch: 4, identity: 0.886

taatacaaaaattagatccaggaatgaaattatta	CRISPR spacer
caatccaaaaattagatccaggaataaaattattg	Protospacer
.*** ********************.********.

8. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NC_025146 (Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111) position: , mismatch: 4, identity: 0.886

taatacaaaaattagatccaggaatgaaattatta	CRISPR spacer
gacttcaaaaattatatccaggaatgaaattatta	Protospacer
 * * ********* ********************

9. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NC_010418 (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence) position: , mismatch: 4, identity: 0.886

taatacaaaaattagatccaggaatgaaattatta	CRISPR spacer
taatacaaatattagatccaggaatgaaataaatg	Protospacer
********* ******************** * *.

10. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NC_010418 (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence) position: , mismatch: 5, identity: 0.857

taatacaaaaattagatccaggaatgaaattatta	CRISPR spacer
cagtccaaagattatatccaggaatgaaattatta	Protospacer
.*.* ****.**** ********************

11. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NZ_CP013710 (Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence) position: , mismatch: 6, identity: 0.829

taatacaaaaattagatccaggaatgaaat-tatta	CRISPR spacer
tctttcaaatagtagatccaggaatgaaatatatt-	Protospacer
*  * **** * ****************** **** 

12. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NZ_CP014152 (Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence) position: , mismatch: 6, identity: 0.829

taatacaaaaattagatccaggaatgaaat-tatta	CRISPR spacer
tctttcaaatagtagatccaggaatgaaatatatt-	Protospacer
*  * **** * ****************** **** 

13. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NC_010418 (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence) position: , mismatch: 6, identity: 0.829

taatacaaaaattagatccaggaatgaaat-tatta	CRISPR spacer
tctttcaaatagtagatccaggaatgaaatatatt-	Protospacer
*  * **** * ****************** **** 

14. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NC_012654 (Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence) position: , mismatch: 6, identity: 0.829

taatacaaaaattagatccaggaatgaaat-tatta	CRISPR spacer
tctttcaaatagtagatccaggaatgaaatatatt-	Protospacer
*  * **** * ****************** **** 

15. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NZ_CP031095 (Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence) position: , mismatch: 6, identity: 0.829

taatacaaaaattagatccaggaatgaaat-tatta	CRISPR spacer
tctttcaaatagtagatccaggaatgaaatatatt-	Protospacer
*  * **** * ****************** **** 

16. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NC_010379 (Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence) position: , mismatch: 6, identity: 0.829

taatacaaaaattagatccaggaatgaaat-tatta	CRISPR spacer
tctttcaaatagtagatccaggaatgaaatatatt-	Protospacer
*  * **** * ****************** **** 

17. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NZ_CP013684 (Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence) position: , mismatch: 7, identity: 0.8

taatacaaaaattagatccaggaatgaaattatta	CRISPR spacer
caattcaaaaattagatccagaaatgaaatgaaag	Protospacer
.*** ****************.******** *  .

18. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NZ_CP013700 (Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence) position: , mismatch: 8, identity: 0.771

taatacaaaaattagatccaggaatgaaattatta	CRISPR spacer
tctttcaaaaattaaatccaggaatgaaatgaagg	Protospacer
*  * *********.*************** *  .

19. spacer 5.1|2286998|35|NZ_CP014174|CRISPRCasFinder matches to NC_025146 (Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111) position: , mismatch: 8, identity: 0.771

taatacaaaaattagatccaggaatgaaattatta	CRISPR spacer
tctttcaaaaattaaatccaggaatgaaatgaagg	Protospacer
*  * *********.*************** *  .

20. spacer 3.2|1884908|40|NZ_CP014174|CRISPRCasFinder matches to NC_018689 (Bacillus thuringiensis MC28 plasmid pMC429, complete sequence) position: , mismatch: 11, identity: 0.725

tatttaaaggatttaaactta---catcatttagatctaagag	CRISPR spacer
tatttaaaggatttaaacttagttcattacataggttatc---	Protospacer
*********************   ***.*. ***.*.      

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 574172 : 583588 7 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_2 919573 : 931274 6 Clostridium_botulinum_D_phage(33.33%) NA NA
DBSCAN-SWA_3 1715046 : 1722112 8 uncultured_phage(33.33%) NA NA
DBSCAN-SWA_4 2421418 : 2446357 32 Clostridium_phage(55.0%) tail,portal,capsid,terminase NA
DBSCAN-SWA_5 2451072 : 2464924 26 Clostridium_phage(20.0%) NA NA
DBSCAN-SWA_6 2510552 : 2520728 13 Clostridium_phage(25.0%) plate NA
DBSCAN-SWA_7 2539799 : 2557171 31 Clostridium_phage(50.0%) integrase attL 2535539:2535557|attR 2557903:2557921
DBSCAN-SWA_8 2788509 : 2806690 23 Clostridium_phage(89.47%) tail,capsid,head,protease,portal,terminase NA
DBSCAN-SWA_9 3152595 : 3162064 7 Synechococcus_phage(42.86%) NA NA
DBSCAN-SWA_10 3302646 : 3330739 35 Clostridium_phage(80.0%) NA NA
DBSCAN-SWA_11 3526719 : 3579151 69 Clostridium_phage(48.48%) integrase,tail,capsid,head,protease,portal,holin,terminase attL 3557743:3557762|attR 3560445:3560464
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage