Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP024053 Escherichia coli strain SMN197SH3 plasmid pO177C3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP024056 Escherichia coli strain SMN197SH3 chromosome, complete genome 8 crisprs csa3,cas3,cas8e,cas7,cas6e,cas2,DEDDh,DinG,c2c9_V-U4,PrimPol 0 6 20 0
NZ_CP024055 Escherichia coli strain SMN197SH3 plasmid pO177A3, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP024054 Escherichia coli strain SMN197SH3 plasmid pO177B3, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP024056
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024056_1 641028-641148 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024056_2 984095-984183 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024056_3 1011636-1011789 TypeI-E I-E
2 spacers
cas2,cas6e,cas7,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024056_4 2362274-2362397 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024056_5 3244753-3244844 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024056_6 3638461-3638605 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024056_7 4306207-4306322 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024056_8 4329234-4329366 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP024056_8 8.1|4329251|42|NZ_CP024056|PILER-CR 4329251-4329292 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
NZ_CP024056_8 8.2|4329310|40|NZ_CP024056|PILER-CR 4329310-4329349 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 0 1.0
NZ_CP024056_5 5.1|3244779|40|NZ_CP024056|CRISPRCasFinder 3244779-3244818 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
NZ_CP024056_7 7.1|4306238|54|NZ_CP024056|CRISPRCasFinder 4306238-4306291 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165411-165464 1 0.981
NZ_CP024056_4 4.1|2362317|38|NZ_CP024056|CRISPRCasFinder 2362317-2362354 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP024056_3 3.1|1011668|29|NZ_CP024056|PILER-CR 1011668-1011696 29 JN882286 Cronobacter phage vB_CsaP_GAP52, complete genome 19327-19355 6 0.793
NZ_CP024056_3 3.1|1011668|29|NZ_CP024056|PILER-CR 1011668-1011696 29 MK448454 Streptococcus satellite phage Javan361, complete genome 9192-9220 7 0.759
NZ_CP024056_7 7.1|4306238|54|NZ_CP024056|CRISPRCasFinder 4306238-4306291 54 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 72431-72484 12 0.778

1. spacer 8.1|4329251|42|NZ_CP024056|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

2. spacer 8.2|4329310|40|NZ_CP024056|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

catggcgtagaaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
****************************************

3. spacer 5.1|3244779|40|NZ_CP024056|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975

gcgctgcgggtcattcttgaaattccccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
************************ ***************

4. spacer 7.1|4306238|54|NZ_CP024056|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.981

tggcctacacgctgcgattttgtaggccggataagcaaagcgcatccggcattc	CRISPR spacer
tggcctacacgctgcgattttgtaggccggataagcaaagcgcatccggcattg	Protospacer
***************************************************** 

5. spacer 4.1|2362317|38|NZ_CP024056|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

6. spacer 3.1|1011668|29|NZ_CP024056|PILER-CR matches to JN882286 (Cronobacter phage vB_CsaP_GAP52, complete genome) position: , mismatch: 6, identity: 0.793

gtttggtc--caccaaatgtttgatgcttca	CRISPR spacer
--ttacccgacaccaaatgtttggtgcttca	Protospacer
  **. .*  *************.*******

7. spacer 3.1|1011668|29|NZ_CP024056|PILER-CR matches to MK448454 (Streptococcus satellite phage Javan361, complete genome) position: , mismatch: 7, identity: 0.759

gtttggtccaccaaatgtttgatgcttca	CRISPR spacer
tatcaatccaccaaatttttgattcttca	Protospacer
  *...********** ****** *****

8. spacer 7.1|4306238|54|NZ_CP024056|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 12, identity: 0.778

tggcctacacgct-----gcgattttgtaggccggataagcaaagcgcatccggcattc	CRISPR spacer
-----tacaaattaattcgcggtattgtaggccggataagcaaagcgcatccggcagta	Protospacer
     **** ..*     ***.* ******************************** * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 775675 : 805719 32 Stx2-converting_phage(50.0%) transposase,tRNA,integrase,protease attL 776262:776279|attR 812572:812589
DBSCAN-SWA_2 1121256 : 1175758 68 Salmonella_phage(67.92%) lysis,terminase,integrase,capsid,tail,tRNA,portal,plate,head attL 1129453:1129497|attR 1164487:1164531
DBSCAN-SWA_3 1387453 : 1564653 184 Escherichia_phage(40.8%) transposase,holin,integrase,protease,tail,capsid,bacteriocin,tRNA,portal,plate attL 1452744:1452768|attR 1516771:1516795
DBSCAN-SWA_4 1755388 : 1872803 115 Enterobacteria_phage(36.62%) transposase,lysis,terminase,integrase,holin,capsid,tail,tRNA attL 1753099:1753115|attR 1834477:1834493
DBSCAN-SWA_5 1889773 : 1900606 16 Escherichia_phage(36.36%) terminase,tail NA
DBSCAN-SWA_6 1978074 : 2067654 105 Escherichia_phage(40.3%) transposase,integrase,holin,protease,tail,plate,head attL 1992990:1993006|attR 2077103:2077119
DBSCAN-SWA_7 2457414 : 2538232 90 Enterobacteria_phage(31.15%) transposase,terminase,holin,integrase,protease,tail,portal attL 2463439:2463454|attR 2523332:2523347
DBSCAN-SWA_8 2583171 : 2664727 59 Escherichia_phage(20.0%) transposase NA
DBSCAN-SWA_9 2669187 : 2704658 35 Stx2-converting_phage(45.45%) transposase,head,capsid,tail NA
DBSCAN-SWA_10 2751060 : 2802406 63 Escherichia_phage(41.38%) terminase,holin,integrase,protease,tail,tRNA,portal attL 2751695:2751720|attR 2797044:2797069
DBSCAN-SWA_11 2973226 : 3137666 190 Stx2-converting_phage(26.19%) transposase,lysis,terminase,holin,integrase,protease,tail,capsid,tRNA,head attL 3123602:3123622|attR 3147750:3147770
DBSCAN-SWA_12 3233429 : 3309289 80 Escherichia_phage(28.12%) transposase,terminase,holin,integrase,protease,tail attL 3297511:3297526|attR 3315007:3315022
DBSCAN-SWA_13 3471575 : 3507364 32 Stx2-converting_phage(36.36%) transposase,protease NA
DBSCAN-SWA_14 3621582 : 3636977 23 Enterobacteria_phage(41.18%) transposase,holin,integrase,tail attL 3623498:3623512|attR 3637051:3637065
DBSCAN-SWA_15 4073332 : 4116014 36 Enterobacteria_phage(33.33%) transposase,integrase attL 4073275:4073334|attR 4102208:4102974
DBSCAN-SWA_16 4121453 : 4192546 56 Enterobacteria_phage(11.11%) transposase,plate,tRNA,protease NA
DBSCAN-SWA_17 4373522 : 4414709 40 Enterobacteria_phage(23.53%) tRNA,tail NA
DBSCAN-SWA_18 4417989 : 4594432 174 Stx2-converting_phage(32.98%) transposase,lysis,terminase,holin,integrase,capsid,tail,protease,tRNA,plate,head attL 4429011:4429041|attR 4595172:4595202
DBSCAN-SWA_19 4631850 : 4677299 45 Ralstonia_phage(12.5%) transposase,tRNA,protease NA
DBSCAN-SWA_20 4825223 : 4876840 54 Enterobacteria_phage(31.11%) transposase,terminase,holin,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP024055
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3623 : 68417 49 Stx2-converting_phage(40.0%) integrase,transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage