Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP028787 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020049 chromosome, complete genome 3 crisprs WYL,csa3,cas3,DEDDh,DinG,RT 0 1 9 0
NZ_CP028786 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020049 plasmid pNDM1_020049, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP028784 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence 0 crisprs csa3,cas3,RT 0 0 2 0
NZ_CP028785 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020049 plasmid p2_020049, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP028787
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028787_1 1880122-1880229 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028787_2 4153148-4153276 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP028787_3 4370115-4370209 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP028787_1 1.1|1880161|30|NZ_CP028787|CRISPRCasFinder 1880161-1880190 30 NZ_CP022925 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B 21741-21770 0 1.0

1. spacer 1.1|1880161|30|NZ_CP028787|CRISPRCasFinder matches to NZ_CP022925 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B) position: , mismatch: 0, identity: 1.0

gcattcggcataaacgccatatccaggatt	CRISPR spacer
gcattcggcataaacgccatatccaggatt	Protospacer
******************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1191359 : 1200806 10 Enterobacteria_phage(83.33%) NA NA
DBSCAN-SWA_2 1317111 : 1384055 73 Salmonella_phage(32.08%) protease,integrase,tail,transposase,holin,terminase attL 1318106:1318123|attR 1386802:1386819
DBSCAN-SWA_3 1702833 : 1709740 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_4 1751304 : 1761206 8 Escherichia_phage(37.5%) transposase NA
DBSCAN-SWA_5 1866442 : 1905728 57 Enterobacteria_phage(23.91%) protease,tail,tRNA,holin,capsid,terminase,head,portal NA
DBSCAN-SWA_6 2709328 : 2720216 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_7 3104613 : 3187326 96 Klebsiella_phage(43.48%) integrase,tail,tRNA,capsid,holin,terminase,head,portal attL 3131428:3131442|attR 3185137:3185151
DBSCAN-SWA_8 3424308 : 3433772 9 Brazilian_cedratvirus(16.67%) protease,tRNA NA
DBSCAN-SWA_9 4610646 : 4622678 11 Enterobacteria_phage(71.43%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP028786
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 49428 59 Escherichia_phage(42.86%) coat,transposase NA
DBSCAN-SWA_2 53075 : 53366 1 uncultured_virus(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP028784
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3654 : 61239 55 uncultured_Caudovirales_phage(31.25%) transposase,holin NA
DBSCAN-SWA_2 83636 : 117740 29 Bacillus_virus(16.67%) bacteriocin,integrase,transposase attL 79986:80003|attR 120772:120789
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage