Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP025492 Legionella sainthelensi strain LA01-117 plasmid pLA01-117_165k, complete sequence 0 crisprs WYL,DinG 0 0 0 0
NZ_CP025491 Legionella sainthelensi strain LA01-117 chromosome, complete genome 2 crisprs DEDDh,PrimPol,cas3,WYL,DinG,csa3 0 1 2 0
NZ_CP025493 Legionella sainthelensi strain LA01-117 plasmid pLA01-117_122k, complete sequence 0 crisprs DinG,DEDDh 0 0 1 0

Results visualization

1. NZ_CP025491
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025491_1 247992-248160 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025491_2 2948065-2948182 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP025491_1 1.2|248090|44|NZ_CP025491|CRISPRCasFinder 248090-248133 44 NZ_LR134418 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9 257659-257702 2 0.955

1. spacer 1.2|248090|44|NZ_CP025491|CRISPRCasFinder matches to NZ_LR134418 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9) position: , mismatch: 2, identity: 0.955

atggtgaattaatgcaaagaaatacaataataaatttattttta	CRISPR spacer
atggtgaattaatgcaaataaatgcaataataaatttattttta	Protospacer
****************** ****.********************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 45199 : 100581 50 Prochlorococcus_phage(33.33%) tRNA,protease NA
DBSCAN-SWA_2 3555568 : 3562370 9 Acinetobacter_phage(42.86%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP025493
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 93431 : 101960 11 Bacillus_phage(42.86%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage