Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017455 Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP017454 Dickeya solani strain PPO 9019 chromosome, complete genome 3 crisprs cas3,DEDDh,DinG,cas8e,csa3,WYL 0 4 377 0

Results visualization

1. NZ_CP017454
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017454_1 118780-118866 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017454_2 3139763-3139872 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017454_3 3719767-3719976 Orphan I-F
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP028352 Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence 90564-90595 0 1.0
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028352 Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence 90566-90594 0 1.0
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014126 Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence 28603-28631 2 0.931
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014126 Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence 33530-33558 2 0.931
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014126 Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence 35438-35466 2 0.931
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_013973 Erwinia amylovora ATCC 49946 plasmid 2, complete sequence 19789-19817 2 0.931
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_013973 Erwinia amylovora ATCC 49946 plasmid 2, complete sequence 21535-21563 2 0.931
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_013973 Erwinia amylovora ATCC 49946 plasmid 2, complete sequence 19788-19819 3 0.906
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_013973 Erwinia amylovora ATCC 49946 plasmid 2, complete sequence 21534-21565 3 0.906
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034472 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence 16878-16906 3 0.897
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034477 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence 164156-164184 3 0.897
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP014126 Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence 28602-28633 4 0.875
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP014126 Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence 33529-33560 4 0.875
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP014126 Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence 35437-35468 4 0.875
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP016891 Pantoea agglomerans strain C410P1 plasmid unnamed2, complete sequence 35952-35980 4 0.862
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031652 Pantoea agglomerans strain TH81 plasmid unnamed3, complete sequence 96907-96935 4 0.862
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP034472 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence 16877-16908 5 0.844
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP034472 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence 201438-201469 5 0.844
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP034477 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence 164154-164185 5 0.844
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP034477 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence 183306-183337 5 0.844
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014126 Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence 31535-31563 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034472 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence 201439-201467 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034477 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence 183308-183336 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MF918373 Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence 133476-133504 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_014312 Klebsiella pneumoniae plasmid pKP048, complete sequence 91482-91510 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026280 Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence 57672-57700 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026280 Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence 60376-60404 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018351 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence 160167-160195 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018351 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence 163552-163580 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP050860 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence 13438-13466 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052330 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence 39850-39878 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052330 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence 51538-51566 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052330 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence 54322-54350 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052169 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence 76043-76071 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052169 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence 79430-79458 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052169 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence 90004-90032 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052169 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence 92627-92655 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY093014 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence 52889-52917 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY093014 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence 56276-56304 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY093014 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence 71158-71186 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY093013 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence 78638-78666 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY093013 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence 82025-82053 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY093013 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence 96907-96935 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY689238 Klebsiella pneumoniae strain TP-P16 plasmid pKPC_P16, complete sequence 15376-15404 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY689238 Klebsiella pneumoniae strain TP-P16 plasmid pKPC_P16, complete sequence 18765-18793 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY689238 Klebsiella pneumoniae strain TP-P16 plasmid pKPC_P16, complete sequence 29012-29040 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY270849 Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence 47697-47725 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY270849 Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence 51084-51112 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY270849 Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence 61354-61382 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY174332 Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence 62325-62353 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY174332 Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence 72596-72624 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY174332 Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence 75982-76010 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028541 Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence 121352-121380 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028541 Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence 124739-124767 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028541 Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence 135009-135037 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP032197 Klebsiella pneumoniae strain AR_0097 plasmid unnamed3, complete sequence 61556-61584 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KX839208 Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence 21354-21382 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KX839208 Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence 24711-24739 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KX839208 Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence 49980-50008 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KU295133 Escherichia coli strain BK33689 plasmid pBK33689, complete sequence 60075-60103 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KU295133 Escherichia coli strain BK33689 plasmid pBK33689, complete sequence 63462-63490 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KU295133 Escherichia coli strain BK33689 plasmid pBK33689, complete sequence 69632-69660 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KU295133 Escherichia coli strain BK33689 plasmid pBK33689, complete sequence 72336-72364 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KU665642 Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence 58361-58389 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KU665642 Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence 61748-61776 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KU665642 Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence 67919-67947 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KU665642 Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence 70623-70651 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KX236178 Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence 13454-13482 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KX236178 Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence 16841-16869 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KX236178 Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence 27111-27139 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KJ721790 Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence 60076-60104 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KJ721790 Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence 63463-63491 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KJ721790 Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence 69634-69662 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KJ721790 Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence 72338-72366 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KP893385 Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence 15462-15490 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KP893385 Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence 18849-18877 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KP893385 Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence 29119-29147 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KP125893 Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence 70791-70819 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KP125893 Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence 76962-76990 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KP125893 Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence 79666-79694 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KT185451 Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence 122126-122154 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KT185451 Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence 125513-125541 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KT185451 Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence 133563-133591 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KU295132 Escherichia coli strain BK34397 plasmid pBK34397, complete sequence 50035-50063 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KU295132 Escherichia coli strain BK34397 plasmid pBK34397, complete sequence 61168-61196 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KP345882 Escherichia coli strain BK32533 plasmid pBK32533, complete sequence 15599-15627 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 31689-31717 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 35074-35102 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 45053-45081 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024917 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence 37914-37942 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024917 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence 41301-41329 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024917 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence 53198-53226 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 15007-15035 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 18393-18421 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 28984-29012 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031262 Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence 5142-5170 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031262 Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence 8529-8557 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031262 Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence 19103-19131 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026135 Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence 75901-75929 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018434 Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence 108869-108897 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018434 Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence 112254-112282 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 33611-33639 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 36997-37025 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 48677-48705 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 51300-51328 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052165 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence 38050-38078 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052165 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence 40916-40944 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052165 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence 48079-48107 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052165 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence 50185-50213 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052165 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence 52887-52915 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP043048 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-2, complete sequence 36303-36331 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP043049 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3 197488-197516 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP043049 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3 200873-200901 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 67488-67516 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 70873-70901 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 85662-85690 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 88446-88474 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 5714-5742 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 92783-92811 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 96170-96198 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 61029-61057 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 64416-64444 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 96826-96854 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP048351 Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence 95901-95929 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP048351 Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence 102072-102100 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP048351 Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence 104776-104804 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP048352 Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence 81910-81938 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP048352 Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence 85297-85325 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP048352 Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence 100435-100463 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP048352 Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence 103219-103247 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP037444 Klebsiella sp. PO552 plasmid p3, complete sequence 61614-61642 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP037444 Klebsiella sp. PO552 plasmid p3, complete sequence 64970-64998 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP019900 Raoultella planticola strain GODA plasmid unnamed1, complete sequence 30908-30936 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP019900 Raoultella planticola strain GODA plasmid unnamed1, complete sequence 39716-39744 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_020893 Klebsiella pneumoniae plasmid pKPC-LK30, complete sequence 15424-15452 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_020893 Klebsiella pneumoniae plasmid pKPC-LK30, complete sequence 18813-18841 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_020893 Klebsiella pneumoniae plasmid pKPC-LK30, complete sequence 29082-29110 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_009649 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence 123614-123642 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_009649 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence 126999-127027 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_009650 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence 57717-57745 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_009650 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence 61104-61132 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_009650 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence 67275-67303 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_009650 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence 69979-70007 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP045264 Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence 95083-95111 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP045264 Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence 98471-98499 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP049601 Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence 83244-83272 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP049601 Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence 86631-86659 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP049601 Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence 106467-106495 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP049601 Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence 109090-109118 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028805 Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence 30992-31020 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028805 Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence 34379-34407 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028805 Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence 45750-45778 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014650 Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence 63887-63915 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014650 Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence 67274-67302 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014650 Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence 73445-73473 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014650 Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence 76149-76177 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 161568-161596 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 164953-164981 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN200129 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence 16777-16805 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN200129 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence 20163-20191 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN200129 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence 31296-31324 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 194021-194049 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 197407-197435 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 208540-208568 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP033962 Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence 80011-80039 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP033962 Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence 83398-83426 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP033962 Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence 93668-93696 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041928 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence 117462-117490 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP010393 Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence 108187-108215 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP010393 Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence 111572-111600 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029448 Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence 184721-184749 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP033394 Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence 64288-64316 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KJ721789 Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence 86968-86996 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP033956 Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence 108905-108933 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP033956 Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence 112292-112320 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP033956 Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence 122562-122590 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020523 Escherichia coli strain 190 plasmid unnamed2, complete sequence 40691-40719 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020523 Escherichia coli strain 190 plasmid unnamed2, complete sequence 44077-44105 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020523 Escherichia coli strain 190 plasmid unnamed2, complete sequence 54668-54696 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 244053-244081 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 247438-247466 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052566 Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence 77338-77366 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052566 Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence 80724-80752 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052566 Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence 91315-91343 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052145 Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence 57250-57278 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052145 Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence 60118-60146 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052145 Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence 62820-62848 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 39850-39878 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 43235-43263 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 52693-52721 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 55477-55505 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028955 Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence 125226-125254 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028955 Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence 128613-128641 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008791 Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence 192784-192812 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008791 Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence 113600-113628 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008791 Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence 116304-116332 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027037 Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence 169276-169304 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027037 Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence 172661-172689 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036362 Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence 99174-99202 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036362 Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence 102561-102589 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036362 Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence 113932-113960 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_019389 Klebsiella pneumoniae plasmid pKDO1, complete sequence 22320-22348 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_019389 Klebsiella pneumoniae plasmid pKDO1, complete sequence 25706-25734 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_019389 Klebsiella pneumoniae plasmid pKDO1, complete sequence 36297-36325 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_023332 Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence 82815-82843 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_023333 Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence 82501-82529 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_023334 Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence 81685-81713 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 HG969997 Klebsiella pneumoniae plasmid pIT-01C22, complete sequence 63221-63249 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 HG969997 Klebsiella pneumoniae plasmid pIT-01C22, complete sequence 66608-66636 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 HG969997 Klebsiella pneumoniae plasmid pIT-01C22, complete sequence 72779-72807 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 HG969997 Klebsiella pneumoniae plasmid pIT-01C22, complete sequence 75483-75511 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 HG969998 Klebsiella pneumoniae plasmid pIT-11C07, complete sequence 50661-50689 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 HG969998 Klebsiella pneumoniae plasmid pIT-11C07, complete sequence 54048-54076 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 HG969999 Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence 56846-56874 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 HG969999 Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence 60233-60261 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 HG969999 Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence 66404-66432 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 HG969999 Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence 69108-69136 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020499 Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence 111677-111705 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020499 Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence 115062-115090 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 108314-108342 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 111700-111728 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025038 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence 166490-166518 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025038 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence 169875-169903 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025039 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence 1697-1725 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036372 Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence 116606-116634 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036372 Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence 119993-120021 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036372 Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence 130263-130291 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018693 Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence 166582-166610 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018693 Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence 169967-169995 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034777 Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence 47755-47783 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034777 Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence 63383-63411 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011986 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence 60076-60104 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011986 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence 63463-63491 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011986 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence 69634-69662 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011986 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence 72338-72366 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 2502-2530 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 5886-5914 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 214306-214334 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 217690-217718 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020851 Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence 85792-85820 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020851 Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence 102179-102207 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312244 Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence 80954-80982 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312244 Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence 84338-84366 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312244 Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence 94605-94633 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312245 Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence 81112-81140 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312245 Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence 84496-84524 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312245 Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence 94763-94791 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312246 Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence 81600-81628 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312246 Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence 84890-84918 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312246 Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence 85137-85165 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312246 Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence 95152-95180 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312247 Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence 79297-79325 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312247 Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence 79638-79666 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312247 Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence 82735-82763 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312247 Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence 93102-93130 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312248 Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence 81440-81468 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312248 Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence 84781-84809 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312248 Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence 95048-95076 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312249 Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence 84543-84571 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312249 Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence 94810-94838 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN891677 Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence 92882-92910 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN891677 Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence 96269-96297 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN891677 Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence 111407-111435 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN891677 Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence 114191-114219 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN891683 Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence 29101-29129 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN891683 Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence 32488-32516 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN891683 Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence 43859-43887 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN891684 Klebsiella pneumoniae strain BJ107 plasmid pBJ107-KPC, complete sequence 90022-90050 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN891684 Klebsiella pneumoniae strain BJ107 plasmid pBJ107-KPC, complete sequence 93409-93437 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN891685 Klebsiella pneumoniae strain BJ119 plasmid pBJ119-KPC, complete sequence 26530-26558 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN891686 Klebsiella pneumoniae strain ZZ58 plasmid pZZ58-KPC, complete sequence 92935-92963 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN891686 Klebsiella pneumoniae strain ZZ58 plasmid pZZ58-KPC, complete sequence 96322-96350 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052358 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence 37940-37968 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052358 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence 41325-41353 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052358 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence 49682-49710 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052358 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence 52466-52494 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_LR134255 Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence 16433-16461 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_LR134255 Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence 19817-19845 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_LR134255 Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence 35148-35176 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_LR134255 Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence 37858-37886 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011981 Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence 73284-73312 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011981 Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence 76671-76699 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011990 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence 150023-150051 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011990 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence 153408-153436 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011991 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence 15319-15347 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011991 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence 18706-18734 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011991 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence 24877-24905 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011991 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence 27581-27609 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027054 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII 124710-124738 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027054 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII 128095-128123 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027056 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB 58675-58703 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027056 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB 62062-62090 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027056 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB 68233-68261 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027056 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB 70937-70965 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036321 Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence 92097-92125 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036321 Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence 95484-95512 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036321 Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence 105756-105784 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MT129535 Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence 83244-83272 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MT129535 Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence 86631-86659 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MT129535 Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence 98305-98333 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MT129535 Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence 100928-100956 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312241 Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence 89054-89082 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312241 Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence 89395-89423 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312241 Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence 92508-92536 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312241 Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence 102875-102903 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312242 Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence 81850-81878 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312242 Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence 85237-85265 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK312242 Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence 95513-95541 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MG700548 Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence 77005-77033 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MG700548 Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence 83079-83107 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MG700549 Klebsiella pneumoniae strain st015256/1 plasmid pUJ-83KPC, complete sequence 4949-4977 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052219 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence 87327-87355 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052219 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence 90713-90741 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052219 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence 101304-101332 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018424 Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence 108869-108897 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018424 Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence 112254-112282 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_015154 Klebsiella pneumoniae plasmid pc15-k, complete sequence 42760-42788 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_015154 Klebsiella pneumoniae plasmid pc15-k, complete sequence 46059-46087 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_025187 Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence 60902-60930 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_025187 Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence 64289-64317 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_025187 Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence 70460-70488 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_025187 Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence 73164-73192 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029591 Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence 168985-169013 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP023840 Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence 13167-13195 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP037964 Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence 22905-22933 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP037964 Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence 26292-26320 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_014016 Klebsiella pneumoniae plasmid pKpQIL, complete sequence 63887-63915 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_014016 Klebsiella pneumoniae plasmid pKpQIL, complete sequence 67274-67302 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_014016 Klebsiella pneumoniae plasmid pKpQIL, complete sequence 73446-73474 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_014016 Klebsiella pneumoniae plasmid pKpQIL, complete sequence 76147-76175 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_021654 Klebsiella pneumoniae plasmid pKN-LS6, complete sequence 225122-225150 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_021654 Klebsiella pneumoniae plasmid pKN-LS6, complete sequence 228509-228537 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_021655 Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence 60512-60540 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_021655 Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence 63897-63925 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_021655 Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence 70068-70096 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_021655 Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence 72769-72797 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018992 Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence 3229-3257 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018992 Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence 9401-9429 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018992 Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence 12105-12133 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_016966 Klebsiella pneumoniae plasmid pUUH239.2, complete sequence 82096-82124 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_025166 Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence 60076-60104 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_025166 Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence 63463-63491 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_025166 Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence 69634-69662 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_025166 Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence 72338-72366 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028796 Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence 93202-93230 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028796 Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence 96589-96617 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028796 Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence 106859-106887 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041375 Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence 110105-110133 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041375 Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence 113492-113520 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041375 Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence 123762-123790 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027614 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence 29728-29756 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP009275 Klebsiella variicola strain DX120E plasmid pKV1, complete sequence 63188-63216 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP009275 Klebsiella variicola strain DX120E plasmid pKV1, complete sequence 80736-80764 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022698 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence 13704-13732 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022698 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence 17091-17119 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022698 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence 23262-23290 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022698 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence 25966-25994 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021959 Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence 9606-9634 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021959 Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence 12993-13021 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021959 Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence 22304-22332 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_025131 Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence 83593-83621 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP012571 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence 13397-13425 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP012571 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence 16784-16812 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP012571 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence 25079-25107 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP012572 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence 10749-10777 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP012572 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence 14136-14164 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP032242 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence 66037-66065 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP032242 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence 69423-69451 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP032242 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence 79693-79721 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP039820 Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence 116583-116611 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP039820 Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence 119970-119998 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP039820 Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence 130240-130268 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029136 Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence 138339-138367 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029136 Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence 141724-141752 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 32783-32811 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 36168-36196 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 47851-47879 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 50474-50502 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014121 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence 74887-74915 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041640 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence 74661-74689 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 4339-4367 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 111694-111722 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP044259 Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence 42042-42070 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP044259 Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence 45429-45457 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP044259 Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence 55699-55727 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP045217 Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence 9732-9760 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026752 Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence 119533-119561 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026752 Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence 122918-122946 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036193 Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence 88828-88856 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036193 Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence 92214-92242 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036193 Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence 102484-102512 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026173 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence 2431-2459 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026173 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence 5135-5163 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 18916-18944 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 22303-22331 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 54405-54433 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029000 Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence 49274-49302 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029000 Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence 52661-52689 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029000 Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence 58832-58860 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029000 Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence 61536-61564 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP039525 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence 32777-32805 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP039525 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence 36164-36192 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP039525 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence 46754-46782 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 137-165 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 6309-6337 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 9013-9041 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 114653-114681 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 KY798506 Escherichia coli plasmid pKpQIL-D2, complete sequence 59418-59446 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 KY798506 Escherichia coli plasmid pKpQIL-D2, complete sequence 62805-62833 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 KY798506 Escherichia coli plasmid pKpQIL-D2, complete sequence 68977-69005 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 KY798506 Escherichia coli plasmid pKpQIL-D2, complete sequence 71682-71710 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 KY798507 Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence 63887-63915 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 KY798507 Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence 67274-67302 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 KY798507 Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence 73445-73473 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 KY798507 Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence 76149-76177 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP010363 Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence 29762-29790 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018355 Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence 47603-47631 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018355 Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence 50988-51016 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027044 Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence 151211-151239 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027044 Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence 154596-154624 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021166 Klebsiella pneumoniae strain 203 plasmid p203, complete sequence 100614-100642 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031614 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence 4993-5021 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031614 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence 8378-8406 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031614 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence 18125-18153 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 115096-115124 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 198906-198934 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 202291-202319 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 9593-9621 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 12979-13007 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052564 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence 31613-31641 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052564 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence 35000-35028 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052564 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence 41171-41199 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052564 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence 43875-43903 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 20252-20280 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 23639-23667 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 32951-32979 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 199229-199257 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 202616-202644 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 214290-214318 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 216913-216941 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052526 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence 69387-69415 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052526 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence 72774-72802 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP017851 Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence 43401-43429 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_AP019690 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence 33964-33992 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_AP019690 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence 37351-37379 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_AP019690 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence 46662-46690 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP017286 Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence 57819-57847 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 LT009688 Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence 86254-86282 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 LT009688 Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence 89639-89667 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP008701 Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence 123270-123298 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP008701 Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence 130976-131004 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP030067 Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence 41738-41766 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP030067 Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence 53764-53792 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP030067 Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence 56388-56416 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP009773 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pKPC-63d, complete sequence 15601-15629 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP009776 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPC-def, complete sequence 15593-15621 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP009777 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence 103320-103348 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP009777 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence 106705-106733 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008833 Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence 63887-63915 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008833 Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence 67274-67302 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008833 Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence 73445-73473 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008833 Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence 76149-76177 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008800 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence 137608-137636 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008800 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence 140993-141021 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP044038 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence 996-1024 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP044038 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence 4382-4410 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP044038 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence 11638-11666 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP046947 Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed8 825-853 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP006926 Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N2, complete sequence 15601-15629 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008930 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence 148207-148235 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008930 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence 151592-151620 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008932 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence 28327-28355 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP007729 Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence 189837-189865 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP007729 Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence 193224-193252 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP006663 Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence 1985-2013 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP006663 Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence 5370-5398 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_025167 Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence 45580-45608 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_025167 Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence 48967-48995 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_025167 Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence 55138-55166 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_025167 Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence 57842-57870 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_022609 Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence 46208-46236 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_022609 Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence 52380-52408 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_022609 Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence 55083-55111 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP048380 Klebsiella variicola strain 118 plasmid p118_A, complete sequence 199130-199158 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP048380 Klebsiella variicola strain 118 plasmid p118_A, complete sequence 202517-202545 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP048380 Klebsiella variicola strain 118 plasmid p118_A, complete sequence 208689-208717 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP048380 Klebsiella variicola strain 118 plasmid p118_A, complete sequence 211393-211421 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052287 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence 148252-148280 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052287 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence 150956-150984 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008843 Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence 115930-115958 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP017281 Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence 40251-40279 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018999 Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence 41996-42024 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018999 Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence 45383-45411 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018999 Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence 55653-55681 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022825 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence 45090-45118 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022825 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence 54348-54376 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020065 Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence 18364-18392 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020109 Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence 63877-63905 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020109 Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence 67262-67290 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047194 Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence 139381-139409 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047194 Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence 11262-11290 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047194 Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence 14649-14677 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029435 Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence 52006-52034 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029435 Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence 55334-55362 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029435 Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence 77152-77180 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029430 Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence 33397-33425 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029430 Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence 36725-36753 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029430 Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence 58543-58571 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP015387 Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence 83585-83613 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020069 Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence 56329-56357 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020069 Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence 59714-59742 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP038279 Raoultella ornithinolytica strain WLK218 plasmid pWLK-KPC, complete sequence 30361-30389 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP038279 Raoultella ornithinolytica strain WLK218 plasmid pWLK-KPC, complete sequence 33741-33769 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP032166 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence 5176-5204 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP032166 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence 8563-8591 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP032166 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence 46421-46449 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP012566 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence 13397-13425 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP012566 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence 16784-16812 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP012566 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence 25079-25107 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP012567 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence 10749-10777 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP012567 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence 14136-14164 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034322 Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence 74796-74824 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034322 Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence 78183-78211 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034322 Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence 88453-88481 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 142622-142650 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 146007-146035 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP050379 Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence 123252-123280 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP035907 Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence 88835-88863 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP035907 Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence 92221-92249 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP035907 Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence 102490-102518 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_032103 Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence 51033-51061 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_032103 Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence 54419-54447 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_032103 Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence 65552-65580 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025458 Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence 21561-21589 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025458 Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence 24948-24976 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025458 Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence 35218-35246 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034417 Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence 103828-103856 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034417 Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence 107215-107243 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034417 Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence 117485-117513 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034131 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence 81045-81073 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034131 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence 84431-84459 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034131 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence 95022-95050 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP050155 Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence 74769-74797 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP050155 Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence 78156-78184 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP050155 Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence 88746-88774 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_021199 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence 15076-15104 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022613 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence 33623-33651 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022613 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence 37008-37036 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP050373 Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence 42976-43004 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP050373 Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence 46360-46388 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP050374 Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence 146079-146107 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP050374 Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence 149466-149494 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029381 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence 118912-118940 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029381 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence 122299-122327 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029381 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence 133670-133698 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP017935 Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence 34665-34693 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP017935 Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence 38051-38079 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP028804 Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence 195636-195664 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP028804 Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence 199021-199049 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP030343 Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence 113822-113850 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP030343 Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence 117209-117237 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 65885-65913 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 69271-69299 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 98626-98654 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026148 Klebsiella pneumoniae strain F132 plasmid pF132_3, complete sequence 22790-22818 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026152 Klebsiella pneumoniae strain F138 plasmid pF138_3, complete sequence 39522-39550 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 112453-112481 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP023916 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence 35241-35269 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP023916 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence 45510-45538 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018460 Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence 130661-130689 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018460 Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence 134046-134074 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040541 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence 118442-118470 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040541 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence 121829-121857 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040541 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence 133182-133210 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020903 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence 108406-108434 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020904 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence 113070-113098 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020904 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence 116457-116485 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 91333-91361 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 99688-99716 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 102469-102497 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052535 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence 105389-105417 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052535 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence 108744-108772 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP042547 Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence 44693-44721 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP013339 Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence 64503-64531 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047161 Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence 95280-95308 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047161 Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence 98667-98695 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029723 Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence 45892-45920 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029723 Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence 49279-49307 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034137 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence 95510-95538 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034137 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence 98896-98924 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034137 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence 109487-109515 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027049 Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence 103443-103471 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027049 Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence 106828-106856 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN823996 Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence 14606-14634 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN823996 Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence 17993-18021 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN823996 Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence 28567-28595 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN823998 Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence 11311-11339 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN823998 Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence 14696-14724 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 93104-93132 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 96489-96517 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN824002 Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence 170353-170381 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN615880 Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence 50521-50549 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN615880 Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence 53907-53935 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN615880 Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence 65040-65068 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028582 Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence 78719-78747 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028582 Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence 110216-110244 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028582 Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence 113603-113631 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 64100-64128 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 67487-67515 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 73658-73686 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 76362-76390 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024510 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence 46476-46504 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024510 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence 55314-55342 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP032186 Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence 164437-164465 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027152 Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence 51264-51292 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027152 Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence 54649-54677 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036366 Klebsiella pneumoniae strain WCHKP115068 plasmid pCTXM65_115068, complete sequence 52692-52720 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN842295 Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence 13638-13666 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN842295 Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence 17023-17051 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN842295 Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence 27292-27320 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN823984 Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence 1351-1379 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN823984 Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence 94645-94673 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN823984 Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence 98031-98059 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN823986 Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence 1823-1851 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN823986 Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence 95122-95150 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN823986 Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence 98508-98536 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP015824 Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence 84112-84140 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP015824 Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence 87499-87527 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP044391 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence 32149-32177 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP044391 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence 47314-47342 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP044391 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence 49940-49968 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP023489 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence 13831-13859 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP023489 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence 17216-17244 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052205 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence 40167-40195 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052205 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence 43035-43063 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052205 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence 50196-50224 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052205 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence 52302-52330 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052205 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence 55004-55032 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 39850-39878 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 43235-43263 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 51592-51620 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 54376-54404 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP053365 Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence 275997-276025 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP053365 Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence 279382-279410 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 149333-149361 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 152718-152746 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_AP018673 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence 78353-78381 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_AP018673 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence 81739-81767 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_AP018673 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence 92330-92358 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_020132 Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence 108044-108072 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_020132 Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence 111429-111457 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_024992 Klebsiella pneumoniae plasmid pKp848CTX, complete sequence 107319-107347 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_024992 Klebsiella pneumoniae plasmid pKp848CTX, complete sequence 110704-110732 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 53481-53509 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 56868-56896 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 89278-89306 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021946 Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence 7052-7080 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 2301-2329 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 12878-12906 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 129303-129331 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027067 Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence 81042-81070 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027067 Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence 84429-84457 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027067 Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence 94699-94727 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 87335-87363 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 90722-90750 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 102396-102424 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 105019-105047 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034125 Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence 84311-84339 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034125 Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence 87698-87726 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034125 Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence 97969-97997 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP023948 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence 117185-117213 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP023948 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence 129212-129240 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP023948 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence 131836-131864 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031369 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence 68864-68892 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031369 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence 72248-72276 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041937 Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence 26347-26375 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052436 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence 52420-52448 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 HG969995 Klebsiella pneumoniae plasmid pIT-01C03, complete sequence 63887-63915 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 HG969995 Klebsiella pneumoniae plasmid pIT-01C03, complete sequence 67274-67302 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 HG969995 Klebsiella pneumoniae plasmid pIT-01C03, complete sequence 73448-73476 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 HG969995 Klebsiella pneumoniae plasmid pIT-01C03, complete sequence 76152-76180 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024543 Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence 56635-56663 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024543 Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence 65897-65925 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031883 Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence 84026-84054 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031883 Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence 87413-87441 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 18628-18656 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 22013-22041 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 33693-33721 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054782 Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence 108904-108932 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054782 Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence 112291-112319 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054782 Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence 122561-122589 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_013950 Klebsiella pneumoniae plasmid pKF3-94, complete sequence 33085-33113 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_013950 Klebsiella pneumoniae plasmid pKF3-94, complete sequence 36472-36500 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_013950 Klebsiella pneumoniae plasmid pKF3-94, complete sequence 47046-47074 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018340 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence 64063-64091 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018340 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence 67448-67476 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018340 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence 79131-79159 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018340 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence 81755-81783 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP045691 Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence 67356-67384 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024484 Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence 40561-40589 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_LR025089 Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence 204262-204290 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054265 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence 2441-2469 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054266 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence 14334-14362 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054266 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence 17721-17749 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054266 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence 23893-23921 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054266 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence 26597-26625 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054764 Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence 108905-108933 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054764 Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence 112292-112320 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054764 Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence 122562-122590 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_023904 Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence 63869-63897 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_023904 Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence 67256-67284 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_023904 Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence 73428-73456 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_023904 Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence 76132-76160 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_023905 Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence 63887-63915 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_023905 Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence 67273-67301 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_023906 Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence 63887-63915 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_023906 Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence 67274-67302 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_023906 Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence 73446-73474 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_023906 Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence 76150-76178 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 15007-15035 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 18393-18421 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 28984-29012 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021951 Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence 154524-154552 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021951 Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence 157909-157937 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021951 Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence 164423-164451 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 104832-104860 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 108219-108247 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 120116-120144 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054728 Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence 108905-108933 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054728 Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence 112292-112320 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054728 Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence 122562-122590 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_023903 Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence 63887-63915 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_023903 Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence 67274-67302 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_023903 Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence 73446-73474 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_023903 Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence 76150-76178 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026016 Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence 7423-7451 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP044369 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence 119201-119229 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP044369 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence 122585-122613 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP044369 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence 134256-134284 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP044369 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence 136878-136906 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025145 Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence 28617-28645 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025145 Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence 32002-32030 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025145 Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence 41981-42009 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025148 Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence 31689-31717 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025148 Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence 35074-35102 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025148 Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence 45053-45081 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054734 Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence 98310-98338 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054734 Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence 101697-101725 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054734 Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence 111967-111995 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054722 Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence 108905-108933 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054722 Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence 112292-112320 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP054722 Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence 122562-122590 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036188 Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence 94879-94907 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK649823 Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence 26674-26702 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK649823 Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence 30061-30089 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK649823 Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence 40331-40359 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK649824 Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence 69394-69422 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK649824 Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence 72781-72809 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK649824 Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence 83051-83079 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP023943 Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence 128430-128458 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP023943 Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence 131815-131843 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014765 Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence 63201-63229 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014765 Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence 66557-66585 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP019904 Escherichia coli strain MDR_56 plasmid unnamed1, complete sequence 90255-90283 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP019904 Escherichia coli strain MDR_56 plasmid unnamed1, complete sequence 93642-93670 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026588 Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence 13438-13466 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026588 Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence 16825-16853 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026588 Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence 29823-29851 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 37939-37967 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 41324-41352 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 49681-49709 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 52465-52493 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP015396 Klebsiella pneumoniae strain CR14 plasmid pCR14_4, complete sequence 42596-42624 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027696 Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence 119704-119732 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027696 Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence 123088-123116 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_LT882698 Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence 258129-258157 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_LT882698 Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence 265608-265636 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052496 Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence 49970-49998 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052496 Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence 52838-52866 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052496 Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence 60001-60029 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052496 Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence 62107-62135 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052496 Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence 64809-64837 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK262711 Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence 71074-71102 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK262711 Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence 77245-77273 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK262711 Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence 79948-79976 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK104259 Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence 62320-62348 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK104259 Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence 65707-65735 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK104259 Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence 81252-81280 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK433206 Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence 15462-15490 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK433206 Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence 18849-18877 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK433206 Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence 29119-29147 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK167989 Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence 88240-88268 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK167989 Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence 91626-91654 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK167989 Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence 110635-110663 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK773536 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence 32830-32858 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK773536 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence 36216-36244 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK773536 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence 48113-48141 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MH569712 Serratia marcescens strain S120 plasmid pPM120-2, complete sequence 28764-28792 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MH255827 Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-KPC, complete sequence 15414-15442 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MH255827 Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-KPC, complete sequence 18797-18825 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MH255827 Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-KPC, complete sequence 29059-29087 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MH917122 Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence 50935-50963 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MH917122 Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence 54321-54349 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MH917122 Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence 65454-65482 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MG878868 Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence 10740-10768 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MG878868 Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence 14127-14155 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MG878868 Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence 26024-26052 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MH263653 Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence 102214-102242 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MH263653 Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence 105601-105629 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MH263653 Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence 115871-115899 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK036887 Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence 44017-44045 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK036887 Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence 47403-47431 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK036887 Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence 57671-57699 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK036888 Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence 114966-114994 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK036888 Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence 118353-118381 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK036888 Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence 128623-128651 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK036886 Klebsiella pneumoniae strain 283149 plasmid p283149-KPC, complete sequence 69017-69045 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MK036886 Klebsiella pneumoniae strain 283149 plasmid p283149-KPC, complete sequence 72404-72432 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN657248 Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence 70815-70843 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN657248 Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence 82843-82871 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN657248 Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence 85467-85495 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014777 Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence 63921-63949 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 4054-4082 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 7439-7467 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 19447-19475 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MF133495 Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence 110600-110628 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MF133495 Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence 113987-114015 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MF133495 Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence 124257-124285 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MF168404 Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence 127742-127770 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MF168404 Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence 131129-131157 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MF168404 Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence 141399-141427 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MF156708 Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence 69952-69980 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MF156708 Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence 76121-76149 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MF156708 Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence 78823-78851 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MF168402 Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence 116654-116682 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MF168402 Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence 120041-120069 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MF168402 Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence 128091-128119 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MF156695 Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence 12657-12685 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MF156695 Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence 26045-26073 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018455 Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence 48283-48311 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018455 Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence 51670-51698 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018455 Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence 63041-63069 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021741 Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence 38429-38457 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021741 Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence 41815-41843 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP030134 Klebsiella pneumoniae strain 160111 plasmid pKPC2_L111, complete sequence 230-258 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP030134 Klebsiella pneumoniae strain 160111 plasmid pKPC2_L111, complete sequence 46882-46910 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP030134 Klebsiella pneumoniae strain 160111 plasmid pKPC2_L111, complete sequence 50267-50295 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN823997 Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence 144979-145007 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MT109193 Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence 110399-110427 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MT109193 Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence 113786-113814 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP035536 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence 34916-34944 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP035536 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence 38301-38329 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP035536 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence 44815-44843 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MG764553 Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence 105510-105538 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MG764553 Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence 108897-108925 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MG288683 Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence 57069-57097 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MG288683 Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence 60457-60485 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MG288683 Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence 70727-70755 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP033755 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence 33905-33933 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029441 Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence 47293-47321 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029441 Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence 119955-119983 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029441 Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence 123283-123311 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP032169 Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence 32397-32425 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP032169 Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence 35784-35812 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 105835-105863 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 109222-109250 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 120896-120924 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 123519-123547 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034407 Klebsiella pneumoniae strain NH34 plasmid pNH34.2, complete sequence 20771-20799 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034407 Klebsiella pneumoniae strain NH34 plasmid pNH34.2, complete sequence 24157-24185 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031720 Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence 135038-135066 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031720 Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence 138425-138453 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031720 Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence 148694-148722 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN661404 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence 31388-31416 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN661404 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence 34775-34803 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN661404 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence 45365-45393 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MT090958 Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence 157459-157487 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MT090958 Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence 160846-160874 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MT090958 Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence 171116-171144 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MT108209 Klebsiella pneumoniae strain BJ108 plasmid pBJ108-KPC, complete sequence 42548-42576 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MT108209 Klebsiella pneumoniae strain BJ108 plasmid pBJ108-KPC, complete sequence 45935-45963 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MT108209 Klebsiella pneumoniae strain BJ108 plasmid pBJ108-KPC, complete sequence 56205-56233 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040535 Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence 7967-7995 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040535 Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence 11354-11382 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040535 Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence 22724-22752 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 LK391770 Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67 74043-74071 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 LK391770 Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67 84762-84790 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026048 Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence 1698-1726 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026048 Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence 5085-5113 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026048 Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence 114130-114158 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026283 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence 17670-17698 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026283 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence 32479-32507 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 26603-26631 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 29988-30016 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052168 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence 202440-202468 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052168 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence 205825-205853 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY270850 Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence 54688-54716 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY270850 Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence 58075-58103 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY270850 Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence 68344-68372 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY271403 Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence 62997-63025 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY271403 Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence 65701-65729 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY271403 Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence 71871-71899 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY271403 Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence 78126-78154 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014073 Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence 122003-122031 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029740 Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence 24574-24602 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029740 Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence 29985-30013 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029740 Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence 36156-36184 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029740 Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence 39541-39569 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 41-69 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 3427-3455 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 119136-119164 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 121840-121868 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KT203286 Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence 117678-117706 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KT203286 Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence 121063-121091 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_020087 Klebsiella pneumoniae plasmid pK1HV, complete sequence 108551-108579 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_020087 Klebsiella pneumoniae plasmid pK1HV, complete sequence 120448-120476 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_020087 Klebsiella pneumoniae plasmid pK1HV, complete sequence 123835-123863 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021752 Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence 73170-73198 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021752 Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence 76555-76583 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026133 Klebsiella pneumoniae strain F5 plasmid pF5_1, complete sequence 17438-17466 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026133 Klebsiella pneumoniae strain F5 plasmid pF5_1, complete sequence 27707-27735 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040994 Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence 65500-65528 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040994 Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence 72729-72757 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040994 Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence 76024-76052 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP044529 Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence 87621-87649 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP044529 Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence 91006-91034 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022125 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence 6580-6608 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022125 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence 9965-9993 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022125 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence 184898-184926 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 64892-64920 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 76025-76053 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 79411-79439 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018441 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence 146373-146401 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018441 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence 149758-149786 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029588 Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence 203091-203119 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP037744 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence 111400-111428 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052408 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence 133454-133482 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052408 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence 136839-136867 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_009651 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN5, complete sequence 4810-4838 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026131 Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence 30783-30811 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026131 Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence 41053-41081 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026131 Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence 44440-44468 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 71682-71710 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 80141-80169 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 83478-83506 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_AP018754 Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence 87578-87606 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_AP018754 Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence 90963-90991 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014649 Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence 12724-12752 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP014649 Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence 16111-16139 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024193 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence 132606-132634 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024193 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence 135991-136019 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052401 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence 194486-194514 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052401 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence 197871-197899 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN543580 Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence 96307-96335 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN543580 Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence 109553-109581 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN543580 Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence 114290-114318 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 125801-125829 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 128505-128533 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 134676-134704 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 138063-138091 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026276 Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence 31888-31916 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 77494-77522 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 80880-80908 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP033395 Klebsiella pneumoniae strain WCHKP015625 plasmid pKPC12_015625, complete sequence 14-42 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP033395 Klebsiella pneumoniae strain WCHKP015625 plasmid pKPC12_015625, complete sequence 52000-52028 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN543573 Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence 200820-200848 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN543573 Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence 204205-204233 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025468 Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence 70979-71007 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025468 Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence 81249-81277 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025468 Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence 84636-84664 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_AP023150 Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03M, complete sequence 75256-75284 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036301 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence 105408-105436 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036301 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence 115677-115705 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036301 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence 119064-119092 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036302 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence 193825-193853 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036328 Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence 107272-107300 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036328 Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence 117543-117571 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036328 Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence 120930-120958 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MT066418 Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence 76721-76749 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MT066418 Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence 80108-80136 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN586817 Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence 66165-66193 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN586817 Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence 78185-78213 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN586817 Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence 81572-81600 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_LR130542 Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2 187040-187068 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_LR130542 Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2 190425-190453 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025952 Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence 57016-57044 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025952 Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence 130049-130077 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025952 Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence 133435-133463 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052405 Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence 223759-223787 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020842 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence 166771-166799 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020842 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence 170156-170184 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020843 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence 14738-14766 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020843 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence 24049-24077 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020843 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence 27436-27464 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031811 Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence 154509-154537 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031811 Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence 160326-160354 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP032832 Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence 377011-377039 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP032832 Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence 387579-387607 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020852 Klebsiella variicola strain KPN1481 plasmid pKPN1481-3, complete sequence 5402-5430 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN891679 Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence 111738-111766 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN891679 Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence 114522-114550 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN891679 Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence 129660-129688 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN891679 Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence 133047-133075 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN891681 Klebsiella pneumoniae strain 14899 plasmid p14899-KPC, complete sequence 71184-71212 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN891681 Klebsiella pneumoniae strain 14899 plasmid p14899-KPC, complete sequence 74571-74599 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 193665-193693 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 197052-197080 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041949 Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence 164806-164834 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020838 Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence 135516-135544 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020838 Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence 138901-138929 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028784 Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence 167188-167216 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028784 Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence 170573-170601 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP035776 Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence 16131-16159 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 153136-153164 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 193303-193331 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_FO834905 Klebsiella pneumoniae strain Kp52.145 plasmid II, complete sequence 111-139 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_019155 Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence 62802-62830 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_019155 Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence 65506-65534 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_019155 Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence 71679-71707 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_019155 Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence 75064-75092 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 171013-171041 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 180807-180835 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN310380 Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence 153938-153966 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP049605 Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence 47646-47674 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 192511-192539 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 195896-195924 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028177 Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence 3623-3651 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028177 Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence 7010-7038 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028177 Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence 110121-110149 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047686 Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence 78873-78901 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047686 Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence 90006-90034 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047686 Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence 93392-93420 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018818 Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence 92040-92068 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018818 Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence 95425-95453 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018815 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence 96567-96595 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP037966 Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence 164907-164935 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP037966 Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence 168292-168320 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 134976-135004 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 137682-137710 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 139792-139820 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 146959-146987 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 149827-149855 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 163393-163421 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041084 Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence 143272-143300 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041084 Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence 146657-146685 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 56532-56560 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 67106-67134 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 70493-70521 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036337 Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence 109105-109133 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052415 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence 172152-172180 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052415 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence 175537-175565 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041514 Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence 143768-143796 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041514 Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence 175070-175098 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041514 Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence 178457-178485 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041094 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence 159150-159178 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041100 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence 179701-179729 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041100 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence 183086-183114 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP042483 Klebsiella pneumoniae strain C51 plasmid pC51_002, complete sequence 198356-198384 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021834 Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence 40038-40066 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021834 Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence 43423-43451 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027616 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence 96753-96781 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024876 Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence 54944-54972 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024876 Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence 66841-66869 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024876 Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence 70228-70256 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022692 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence 192012-192040 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022692 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence 195397-195425 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022693 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence 91122-91150 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022693 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence 93826-93854 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022693 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence 99998-100026 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022693 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence 103383-103411 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047683 Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence 78881-78909 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047683 Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence 90014-90042 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047683 Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence 93400-93428 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP010881 Escherichia coli strain MNCRE44 plasmid pMNCRE44_5, complete sequence 110748-110776 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 62989-63017 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 65612-65640 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 77286-77314 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 80673-80701 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034324 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence 36169-36197 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034324 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence 39556-39584 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034325 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence 79211-79239 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 96837-96865 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 100222-100250 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP035181 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence 26247-26275 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040547 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence 148697-148725 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040547 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence 160067-160095 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040547 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence 163454-163482 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP042513 Serratia marcescens strain E28 plasmid pE28_001, complete sequence 135304-135332 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP042513 Serratia marcescens strain E28 plasmid pE28_001, complete sequence 170148-170176 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028991 Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence 72229-72257 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028991 Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence 75616-75644 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047680 Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence 80875-80903 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047680 Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence 84261-84289 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029583 Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence 98737-98765 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018886 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence 194115-194143 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018886 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence 197500-197528 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP039809 Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence 193825-193853 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP039810 Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence 104247-104275 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP039810 Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence 114516-114544 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP039810 Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence 117903-117931 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029101 Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence 11607-11635 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029101 Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence 14994-15022 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029102 Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence 4412-4440 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029102 Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence 7116-7144 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029102 Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence 13287-13315 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029102 Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence 16674-16702 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 144158-144186 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 147548-147576 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 89378-89406 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 127821-127849 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 131208-131236 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040025 Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence 134986-135014 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP040025 Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence 138371-138399 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP038003 Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence 136394-136422 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP038003 Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence 139781-139809 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 14105-14133 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 17492-17520 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 320954-320982 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP007736 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence 22629-22657 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026179 Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence 177009-177037 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026180 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence 89191-89219 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026180 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence 92578-92606 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028995 Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence 137476-137504 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028995 Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence 140861-140889 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031851 Klebsiella pneumoniae strain 121 plasmid pKP121-2, complete sequence 111797-111825 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031851 Klebsiella pneumoniae strain 121 plasmid pKP121-2, complete sequence 125186-125214 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP033402 Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence 196461-196489 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP033404 Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence 104574-104602 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP033404 Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence 115944-115972 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP033404 Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence 119331-119359 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK191023 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence 80792-80820 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK191023 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence 91925-91953 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK191023 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence 95311-95339 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041648 Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence 126875-126903 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031583 Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence 67984-68012 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP031583 Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence 71368-71396 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029598 Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence 151153-151181 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021544 Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence 160638-160666 5 0.828
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021544 Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence 164023-164051 5 0.828
NZ_CP017454_3 3.5|3719917|29|NZ_CP017454|PILER-CR 3719917-3719945 29 NZ_CP040097 Pantoea sp. SO10 plasmid unnamed2, complete sequence 91238-91266 5 0.828
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 LK391770 Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67 74041-74072 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 LK391770 Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67 84760-84791 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026048 Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence 1696-1727 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026048 Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence 114128-114159 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026280 Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence 57671-57702 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026280 Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence 60375-60406 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026283 Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence 17668-17699 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052330 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence 39849-39880 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052330 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence 51537-51568 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052169 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence 79429-79460 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052169 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence 90003-90034 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052169 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence 92626-92657 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KY093014 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence 56275-56306 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KY093014 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence 71157-71188 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KY093013 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence 82024-82055 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KY093013 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence 96906-96937 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KY689238 Klebsiella pneumoniae strain TP-P16 plasmid pKPC_P16, complete sequence 29011-29042 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KY271403 Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence 62995-63026 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KY271403 Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence 65699-65730 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KY271403 Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence 71869-71900 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KY270849 Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence 61353-61384 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP028541 Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence 135008-135039 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KX839208 Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence 24710-24741 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KX839208 Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence 49979-50010 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KU295133 Escherichia coli strain BK33689 plasmid pBK33689, complete sequence 63461-63492 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KU295133 Escherichia coli strain BK33689 plasmid pBK33689, complete sequence 69631-69662 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KU295133 Escherichia coli strain BK33689 plasmid pBK33689, complete sequence 72335-72366 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KU665642 Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence 61747-61778 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KU665642 Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence 67918-67949 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KU665642 Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence 70622-70653 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KX236178 Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence 27110-27141 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP029740 Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence 24572-24603 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP029740 Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence 29983-30014 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP029740 Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence 36154-36185 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KJ721790 Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence 63462-63493 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KJ721790 Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence 69633-69664 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KJ721790 Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence 72337-72368 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 39-70 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 3425-3456 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 119134-119165 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 121838-121869 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KP893385 Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence 29118-29149 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KP125893 Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence 76961-76992 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KP125893 Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence 79665-79696 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KT185451 Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence 133561-133592 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KU295132 Escherichia coli strain BK34397 plasmid pBK34397, complete sequence 50034-50065 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KU295132 Escherichia coli strain BK34397 plasmid pBK34397, complete sequence 61167-61198 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_020087 Klebsiella pneumoniae plasmid pK1HV, complete sequence 120446-120477 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP024917 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence 41300-41331 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 18392-18423 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 28983-29014 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP031262 Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence 8528-8559 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026133 Klebsiella pneumoniae strain F5 plasmid pF5_1, complete sequence 17436-17467 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP040994 Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence 65498-65529 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP040994 Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence 72727-72758 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP040994 Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence 76022-76053 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP044529 Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence 87619-87650 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP044529 Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence 91004-91035 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 33610-33641 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 36996-37027 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 48676-48707 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 51299-51330 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052165 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence 40915-40946 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052165 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence 48078-48109 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052165 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence 50184-50215 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052165 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence 52886-52917 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022125 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence 184896-184927 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 64890-64921 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 76023-76054 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 79409-79440 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 85661-85692 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 88445-88476 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 96169-96200 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 64415-64446 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 96825-96856 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP048351 Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence 102071-102102 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP048351 Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence 104775-104806 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP048352 Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence 85296-85327 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP048352 Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence 100434-100465 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP048352 Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence 103218-103249 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP037444 Klebsiella sp. PO552 plasmid p3, complete sequence 64969-65000 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_009650 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence 61103-61134 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_009650 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence 67274-67305 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_009650 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence 69978-70009 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026131 Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence 30781-30812 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 71680-71711 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 80139-80170 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 83476-83507 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP049601 Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence 86630-86661 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP049601 Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence 106466-106497 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP049601 Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence 109089-109120 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP028805 Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence 45749-45780 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP014650 Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence 67273-67304 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP014650 Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence 73444-73475 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP014650 Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence 76148-76179 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN200129 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence 16776-16807 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN200129 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence 20162-20193 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN200129 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence 31295-31326 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 194020-194051 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 197406-197437 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 208539-208570 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN543580 Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence 109551-109582 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP033962 Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence 93667-93698 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 125799-125830 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 128503-128534 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 134674-134705 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP020508 Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence 77492-77523 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP033394 Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence 64287-64318 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP033956 Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence 122561-122592 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP025468 Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence 70977-71008 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP020523 Escherichia coli strain 190 plasmid unnamed2, complete sequence 44076-44107 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP020523 Escherichia coli strain 190 plasmid unnamed2, complete sequence 54667-54698 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052566 Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence 80723-80754 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052566 Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence 91314-91345 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052145 Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence 60117-60148 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052145 Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence 62819-62850 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 39849-39880 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 52692-52723 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP028955 Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence 128612-128643 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP008791 Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence 113598-113629 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP008791 Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence 116302-116333 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP036301 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence 105406-105437 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP036362 Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence 113931-113962 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP036328 Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence 107270-107301 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN586817 Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence 78183-78214 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_019389 Klebsiella pneumoniae plasmid pKDO1, complete sequence 25705-25736 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_019389 Klebsiella pneumoniae plasmid pKDO1, complete sequence 36296-36327 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 HG969997 Klebsiella pneumoniae plasmid pIT-01C22, complete sequence 66607-66638 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 HG969997 Klebsiella pneumoniae plasmid pIT-01C22, complete sequence 72778-72809 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 HG969997 Klebsiella pneumoniae plasmid pIT-01C22, complete sequence 75482-75513 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 HG969999 Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence 60232-60263 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 HG969999 Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence 66403-66434 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 HG969999 Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence 69107-69138 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP025952 Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence 57014-57045 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP020506 Serratia marcescens strain 95 plasmid unnamed1, complete sequence 111699-111730 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP036372 Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence 130262-130293 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP034777 Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence 63382-63413 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP011986 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence 63462-63493 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP011986 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence 69633-69664 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP011986 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence 72337-72368 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP020843 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence 14736-14767 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP020843 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence 24047-24078 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP032832 Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence 377009-377040 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP032832 Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence 387577-387608 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK312244 Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence 84337-84368 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK312244 Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence 94604-94635 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK312245 Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence 84495-84526 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK312245 Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence 94762-94793 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK312246 Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence 84889-84920 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK312246 Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence 95151-95182 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK312247 Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence 79637-79668 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK312247 Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence 82734-82765 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK312247 Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence 93101-93132 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK312248 Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence 84780-84811 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK312248 Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence 95047-95078 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK312249 Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence 84542-84573 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK312249 Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence 94809-94840 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN891677 Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence 96268-96299 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN891677 Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence 111406-111437 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN891677 Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence 114190-114221 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN891679 Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence 111736-111767 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN891679 Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence 114520-114551 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN891679 Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence 129658-129689 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN891683 Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence 43858-43889 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052358 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence 37939-37970 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052358 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence 49681-49712 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 193663-193694 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP011981 Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence 76670-76701 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP011991 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence 18705-18736 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP011991 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence 24876-24907 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP011991 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence 27580-27611 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP027056 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB 62061-62092 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP027056 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB 68232-68263 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP027056 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB 70936-70967 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP036321 Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence 105755-105786 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MT129535 Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence 86630-86661 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MT129535 Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence 98304-98335 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MT129535 Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence 100927-100958 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK312241 Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence 89394-89425 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK312241 Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence 92507-92538 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK312241 Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence 102874-102905 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK312242 Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence 85236-85267 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK312242 Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence 95512-95543 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MG700548 Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence 77004-77035 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MG700548 Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence 83078-83109 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MG700549 Klebsiella pneumoniae strain st015256/1 plasmid pUJ-83KPC, complete sequence 4948-4979 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 153134-153165 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052219 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence 90712-90743 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052219 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence 101303-101334 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_019155 Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence 62800-62831 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_019155 Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence 65504-65535 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_019155 Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence 71677-71708 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_015154 Klebsiella pneumoniae plasmid pc15-k, complete sequence 46058-46089 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_025187 Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence 64288-64319 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_025187 Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence 70459-70490 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_025187 Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence 73163-73194 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP028177 Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence 110119-110150 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP047686 Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence 78871-78902 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP047686 Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence 90004-90035 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP047686 Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence 93390-93421 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 134974-135005 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 146957-146988 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_014016 Klebsiella pneumoniae plasmid pKpQIL, complete sequence 67273-67304 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_014016 Klebsiella pneumoniae plasmid pKpQIL, complete sequence 73445-73476 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_014016 Klebsiella pneumoniae plasmid pKpQIL, complete sequence 76146-76177 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_021655 Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence 63896-63927 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_021655 Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence 70067-70098 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_021655 Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence 72768-72799 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP018992 Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence 9400-9431 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP018992 Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence 12104-12135 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 67104-67135 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_025166 Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence 63462-63493 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_025166 Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence 69633-69664 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_025166 Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence 72337-72368 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP028796 Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence 106858-106889 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP041514 Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence 143766-143797 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP041514 Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence 175068-175099 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP041375 Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence 123761-123792 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP024876 Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence 66839-66870 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022693 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence 91120-91151 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022693 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence 93824-93855 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022693 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence 99996-100027 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP047683 Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence 78879-78910 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP047683 Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence 90012-90043 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP047683 Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence 93398-93429 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 62987-63018 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 65610-65641 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 77284-77315 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP035181 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence 26245-26276 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022698 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence 17090-17121 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022698 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence 23261-23292 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022698 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence 25965-25996 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP021959 Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence 12992-13023 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP021959 Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence 22303-22334 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP012571 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence 16783-16814 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP012571 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence 25078-25109 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP012572 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence 14135-14166 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP042513 Serratia marcescens strain E28 plasmid pE28_001, complete sequence 135302-135333 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP028991 Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence 72227-72258 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP032242 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence 79692-79723 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP047680 Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence 80873-80904 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP047680 Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence 84259-84290 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP039820 Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence 130239-130270 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 32782-32813 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 36167-36198 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 47850-47881 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 50473-50504 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 4338-4369 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 111693-111724 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP044259 Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence 55698-55729 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP045217 Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence 9731-9762 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP039810 Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence 104245-104276 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP029102 Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence 4410-4441 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP029102 Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence 7114-7145 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP029102 Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence 13285-13316 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 144156-144187 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 127819-127850 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP036193 Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence 102483-102514 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 14103-14134 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 320952-320983 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026173 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence 2430-2461 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026173 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence 5134-5165 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 22302-22333 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 54404-54435 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP029000 Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence 52660-52691 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP029000 Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence 58831-58862 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP029000 Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence 61535-61566 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP033404 Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence 104572-104603 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP039525 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence 36163-36194 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP039525 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence 46753-46784 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 136-167 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 6308-6339 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 9012-9043 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 KY798506 Escherichia coli plasmid pKpQIL-D2, complete sequence 62804-62835 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 KY798506 Escherichia coli plasmid pKpQIL-D2, complete sequence 68976-69007 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 KY798506 Escherichia coli plasmid pKpQIL-D2, complete sequence 71681-71712 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 KY798507 Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence 67273-67304 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 KY798507 Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence 73444-73475 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 KY798507 Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence 76148-76179 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK191023 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence 80790-80821 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK191023 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence 91923-91954 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK191023 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence 95309-95340 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP041648 Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence 126873-126904 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP031614 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence 18124-18155 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 9591-9622 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 115095-115126 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 198905-198936 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 202290-202321 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052564 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence 34999-35030 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052564 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence 41170-41201 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052564 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence 43874-43905 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 23638-23669 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 32950-32981 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP021686 Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence 21657-21688 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP024040 Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence 91683-91714 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP024040 Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence 94387-94418 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP024040 Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence 100558-100589 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 202615-202646 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 214289-214320 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 216912-216943 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP033947 Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence 119266-119297 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052525 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence 129317-129348 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052525 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence 131940-131971 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_AP019690 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence 37350-37381 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_AP019690 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence 46661-46692 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP030067 Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence 56387-56418 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP028553 Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence 102209-102240 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP008833 Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence 67273-67304 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP008833 Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence 73444-73475 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP008833 Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence 76148-76179 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP044038 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence 11637-11668 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP046952 Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence 91001-91032 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP046952 Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence 93705-93736 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP046952 Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence 99876-99907 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP046942 Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697 5317-5348 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP046947 Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed8 824-855 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP009115 Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence 78751-78782 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_025167 Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence 48966-48997 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_025167 Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence 55137-55168 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_025167 Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence 57841-57872 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_022609 Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence 52379-52410 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_022609 Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence 55082-55113 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP048380 Klebsiella variicola strain 118 plasmid p118_A, complete sequence 199129-199160 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP048380 Klebsiella variicola strain 118 plasmid p118_A, complete sequence 202516-202547 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP048380 Klebsiella variicola strain 118 plasmid p118_A, complete sequence 208688-208719 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP048380 Klebsiella variicola strain 118 plasmid p118_A, complete sequence 211392-211423 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026396 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence 107643-107674 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026396 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence 116045-116076 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026397 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence 57210-57241 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026397 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence 91787-91818 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026397 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence 95172-95203 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP041250 Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence 68838-68869 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052287 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence 148251-148282 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052287 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence 150955-150986 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP018999 Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence 55652-55683 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 194538-194569 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 218750-218781 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP025966 Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence 115656-115687 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP020065 Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence 18363-18394 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP047194 Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence 139380-139411 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP029435 Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence 55333-55364 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP029435 Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence 77151-77182 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP029430 Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence 36724-36755 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP029430 Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence 58542-58573 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP038279 Raoultella ornithinolytica strain WLK218 plasmid pWLK-KPC, complete sequence 33740-33771 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP032166 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence 46419-46450 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP012566 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence 16783-16814 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP012566 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence 25078-25109 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP012567 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence 14135-14166 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP034322 Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence 88452-88483 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP050170 Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence 138900-138931 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP035907 Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence 102489-102520 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP025516 Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence 136836-136867 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP025516 Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence 147985-148016 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_032103 Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence 51032-51063 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_032103 Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence 54418-54449 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_032103 Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence 65551-65582 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP025458 Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence 35217-35248 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP034417 Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence 117484-117515 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP034131 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence 84430-84461 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP034131 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence 95021-95052 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP050155 Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence 78155-78186 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP050155 Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence 88745-88776 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP016891 Pantoea agglomerans strain C410P1 plasmid unnamed2, complete sequence 35950-35981 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP046384 Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence 91001-91032 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP046384 Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence 93705-93736 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP046384 Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence 99876-99907 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP024459 Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence 157105-157136 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP024459 Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence 167695-167726 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052540 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence 73351-73382 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052540 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence 81705-81736 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP029381 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence 133669-133700 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP017935 Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence 34664-34695 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP017935 Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence 38050-38081 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP018670 Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence 19255-19286 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP030342 Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence 11091-11122 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP030342 Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence 13795-13826 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP030342 Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence 19966-19997 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 69270-69301 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 98625-98656 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026141 Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence 96330-96361 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 112452-112483 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP023916 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence 45509-45540 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP023725 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence 15631-15662 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026584 Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence 106786-106817 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 91332-91363 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 99687-99718 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 102468-102499 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP045678 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence 69526-69557 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP045678 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence 72307-72338 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP045678 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence 81762-81793 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052535 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence 108743-108774 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026212 Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence 34742-34773 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026212 Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence 37446-37477 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP029723 Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence 49278-49309 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP034137 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence 98895-98926 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP034137 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence 109486-109517 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN823996 Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence 17992-18023 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN824001 Klebsiella pneumoniae strain N201205880 plasmid p205880-1FIIK, complete sequence 45097-45128 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN615880 Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence 50520-50551 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN615880 Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence 53906-53937 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN615880 Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence 65039-65070 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP028582 Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence 78718-78749 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP011630 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-49, complete sequence 22127-22158 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 67486-67517 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 73657-73688 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 76361-76392 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP024510 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence 55313-55344 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP032189 Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence 89199-89230 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP032189 Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence 97494-97525 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP036366 Klebsiella pneumoniae strain WCHKP115068 plasmid pCTXM65_115068, complete sequence 52691-52722 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN842291 Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence 114786-114817 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN842292 Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence 57461-57492 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN842295 Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence 27291-27322 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN823984 Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence 1350-1381 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN823984 Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence 94644-94675 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN823984 Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence 98030-98061 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN823985 Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence 9928-9959 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN823985 Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence 13314-13345 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN823985 Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence 107497-107528 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN823986 Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence 1822-1853 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN823986 Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence 95121-95152 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN823986 Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence 98507-98538 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP016403 Klebsiella pneumoniae subsp. pneumoniae strain F5 plasmid pF5, complete sequence 55750-55781 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP015823 Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence 171733-171764 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP015823 Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence 174437-174468 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP015823 Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence 180608-180639 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP044391 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence 32148-32179 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP044391 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence 49939-49970 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP044395 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence 329-360 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP044395 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence 14625-14656 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP044395 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence 18012-18043 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 16792-16823 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 35828-35859 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052205 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence 43034-43065 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052205 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence 50195-50226 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052205 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence 52301-52332 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052205 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence 55003-55034 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 39849-39880 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 51591-51622 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_AP018673 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence 81738-81769 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_AP018673 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence 92329-92360 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_AP018674 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-3, complete sequence 57221-57252 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_AP018674 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-3, complete sequence 57983-58014 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 56867-56898 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 89277-89308 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP021946 Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence 7051-7082 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP031652 Pantoea agglomerans strain TH81 plasmid unnamed3, complete sequence 96905-96936 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 2300-2331 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP028479 Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence 12877-12908 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP027158 Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence 93641-93672 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP027158 Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence 96345-96376 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP027158 Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence 102516-102547 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP027067 Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence 94698-94729 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP025010 Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence 96150-96181 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP025010 Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence 98854-98885 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP025010 Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence 105025-105056 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 90721-90752 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 102395-102426 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 105018-105049 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP034125 Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence 97968-97999 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP023948 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence 131835-131866 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP041937 Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence 26346-26377 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 HG969995 Klebsiella pneumoniae plasmid pIT-01C03, complete sequence 73447-73478 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 HG969995 Klebsiella pneumoniae plasmid pIT-01C03, complete sequence 76151-76182 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 AP022358 Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence 172518-172549 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP035124 Escherichia coli strain EC25 plasmid pEC25-1, complete sequence 51831-51862 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 18627-18658 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 22012-22043 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 33692-33723 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP054782 Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence 122560-122591 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_013950 Klebsiella pneumoniae plasmid pKF3-94, complete sequence 36471-36502 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_016846 Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence 82191-82222 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP018340 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence 64062-64093 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP018340 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence 67447-67478 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP018340 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence 81754-81785 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP024484 Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence 40560-40591 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP034085 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence 100443-100474 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP050282 Klebsiella pneumoniae strain 9949 plasmid unnamed2, complete sequence 88871-88902 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP054266 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence 23892-23923 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP054266 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence 26596-26627 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP054764 Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence 122561-122592 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_023904 Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence 67255-67286 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_023904 Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence 73427-73458 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_023904 Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence 76131-76162 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_023906 Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence 67273-67304 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_023906 Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence 73445-73476 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_023906 Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence 76149-76180 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 18392-18423 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 28983-29014 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP021951 Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence 164422-164453 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP028717 Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence 59538-59569 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 108218-108249 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_AP019401 Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence 98027-98058 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_AP019401 Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence 116466-116497 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 166472-166503 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 184915-184946 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP054728 Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence 122561-122592 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_023903 Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence 67273-67304 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_023903 Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence 73445-73476 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_023903 Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence 76149-76180 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP044369 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence 119200-119231 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP044369 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence 122584-122615 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP044369 Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence 136877-136908 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP054734 Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence 111966-111997 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP054722 Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence 122561-122592 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP028389 Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence 150999-151030 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP050278 Klebsiella pneumoniae strain 10553 plasmid unnamed3, complete sequence 49685-49716 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK649823 Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence 40330-40361 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK649824 Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence 83050-83081 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052316 Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence 76372-76403 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052316 Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence 79074-79105 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052316 Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence 81180-81211 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052316 Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence 88343-88374 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP023942 Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2 35735-35766 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP014765 Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence 66556-66587 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP037930 Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid p8788-IT, complete sequence 80748-80779 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP037930 Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid p8788-IT, complete sequence 83452-83483 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP037930 Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid p8788-IT, complete sequence 89623-89654 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP019904 Escherichia coli strain MDR_56 plasmid unnamed1, complete sequence 93641-93672 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026588 Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence 16824-16855 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 37938-37969 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 49680-49711 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP015395 Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence 94316-94347 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP015395 Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence 97020-97051 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP015395 Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence 103191-103222 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_LT882698 Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence 265607-265638 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP018955 Escherichia coli strain Ecol_316 plasmid pEC316_2, complete sequence 23068-23099 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP018955 Escherichia coli strain Ecol_316 plasmid pEC316_2, complete sequence 49144-49175 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP047634 Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence 161521-161552 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN891678 Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-KPC, complete sequence 72085-72116 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052496 Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence 52837-52868 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052496 Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence 60000-60031 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052496 Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence 62106-62137 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP052496 Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence 64808-64839 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MK262711 Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence 77244-77275 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MK262711 Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence 79947-79978 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MK104259 Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence 65706-65737 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MK104259 Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence 81251-81282 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MK167987 Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence 134935-134966 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MK167987 Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence 137725-137756 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MK167987 Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence 146572-146603 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MK433206 Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence 29118-29149 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MK167989 Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence 88239-88270 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MK167989 Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence 91625-91656 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MK773536 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence 36215-36246 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MN543570 Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence 125531-125562 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP044045 Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence 54635-54666 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN657251 Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence 78956-78987 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN657251 Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence 81660-81691 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN657251 Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence 87831-87862 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP050286 Klebsiella pneumoniae strain 9630 plasmid unnamed1, complete sequence 10463-10494 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 CP050286 Klebsiella pneumoniae strain 9630 plasmid unnamed1, complete sequence 101064-101095 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MH909340 Klebsiella pneumoniae strain A1763 plasmid pA1763-KPC, complete sequence 85939-85970 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MH917122 Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence 50934-50965 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MH917122 Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence 54320-54351 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MH917122 Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence 65453-65484 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MK413718 Klebsiella pneumoniae strain 427113 plasmid p427113-2, complete sequence 52418-52449 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MG878868 Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence 14126-14157 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MH263653 Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence 115870-115901 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MH464586 Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence 99167-99198 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MK036887 Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence 47402-47433 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MK036888 Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence 128622-128653 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN657248 Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence 85466-85497 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 121065-121096 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP014777 Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence 63920-63951 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 4053-4084 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 7438-7469 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 19446-19477 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MF133495 Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence 124256-124287 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MF168404 Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence 141398-141429 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MF156708 Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence 76120-76151 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MF156708 Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence 78822-78853 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MF168402 Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence 128089-128120 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP018455 Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence 63040-63071 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP021741 Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence 38428-38459 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP021741 Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence 41814-41845 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP030134 Klebsiella pneumoniae strain 160111 plasmid pKPC2_L111, complete sequence 229-260 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP035536 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence 44814-44845 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MG252894 Klebsiella pneumoniae strain Kpn-35963cz plasmid pKpn-35963cz, complete sequence 141641-141672 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MG736312 Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence 13084-13115 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MG736312 Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence 16470-16501 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MG288683 Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence 70726-70757 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP026370 Klebsiella quasipneumoniae strain A708 plasmid pA708-2, complete sequence 52144-52175 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP035204 Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence 80126-80157 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP035204 Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence 90716-90747 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP035204 Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence 94102-94133 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP025463 Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence 6216-6247 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP029441 Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence 47292-47323 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP029441 Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence 119953-119984 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP032169 Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence 35783-35814 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 109221-109252 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 120895-120926 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 123518-123549 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP031720 Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence 148693-148724 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN661404 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence 34774-34805 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN661404 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence 45364-45395 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MT090958 Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence 171115-171146 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MT108207 Klebsiella pneumoniae strain A1750 plasmid pA1750-KPC, complete sequence 31015-31046 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MT108209 Klebsiella pneumoniae strain BJ108 plasmid pBJ108-KPC, complete sequence 56204-56235 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MT108210 Klebsiella pneumoniae strain W09308 plasmid pW09308-KPC, complete sequence 97628-97659 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MT108212 Klebsiella pneumoniae strain 12478 plasmid p12478-KPC, complete sequence 13784-13815 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MT108213 Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence 109411-109442 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MT108213 Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence 112195-112226 6 0.812
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MT108213 Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence 127337-127368 6 0.812
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034472 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence 464-492 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034472 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence 5803-5831 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034477 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence 175231-175259 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034477 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence 180570-180598 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028554 Klebsiella variicola strain WCHKP19 plasmid pKPC2_020019, complete sequence 24563-24591 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028554 Klebsiella variicola strain WCHKP19 plasmid pKPC2_020019, complete sequence 29786-29814 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP028554 Klebsiella variicola strain WCHKP19 plasmid pKPC2_020019, complete sequence 32061-32089 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026280 Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence 51556-51584 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY399973 Enterobacter cloacae strain EClY2403 plasmid pKPC2_EClY2403, complete sequence 41091-41119 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY399973 Enterobacter cloacae strain EClY2403 plasmid pKPC2_EClY2403, complete sequence 46314-46342 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY399973 Enterobacter cloacae strain EClY2403 plasmid pKPC2_EClY2403, complete sequence 48589-48617 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY399972 Enterobacter cloacae strain EClY2402 plasmid pKPC2_EClY2402, complete sequence 41091-41119 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY399972 Enterobacter cloacae strain EClY2402 plasmid pKPC2_EClY2402, complete sequence 46314-46342 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KY399972 Enterobacter cloacae strain EClY2402 plasmid pKPC2_EClY2402, complete sequence 48589-48617 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP032198 Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence 12929-12957 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP050837 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence 22223-22251 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP050837 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence 27468-27496 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KP868646 Enterobacter cloacae strain WCHECl-14653 plasmid pKPC2-EC14653, complete sequence 41093-41121 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KP868646 Enterobacter cloacae strain WCHECl-14653 plasmid pKPC2-EC14653, complete sequence 46316-46344 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KP868646 Enterobacter cloacae strain WCHECl-14653 plasmid pKPC2-EC14653, complete sequence 48591-48619 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KU295132 Escherichia coli strain BK34397 plasmid pBK34397, complete sequence 58384-58412 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021753 Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence 4902-4930 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021753 Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence 10147-10175 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021753 Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence 12421-12449 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 42269-42297 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP023418 Klebsiella pneumoniae strain 1050 plasmid pKp1050-2, complete sequence 88102-88130 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP023418 Klebsiella pneumoniae strain 1050 plasmid pKp1050-2, complete sequence 93346-93374 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP023418 Klebsiella pneumoniae strain 1050 plasmid pKp1050-2, complete sequence 95615-95643 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN200129 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence 28512-28540 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 205756-205784 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP029448 Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence 201987-202015 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KJ721789 Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence 15697-15725 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KJ721789 Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence 20953-20981 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_KJ721789 Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence 23231-23259 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008791 Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence 185229-185257 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008791 Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence 190510-190538 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008791 Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence 122420-122448 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025039 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence 73736-73764 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025039 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence 79014-79042 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025039 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence 81286-81314 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025040 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence 6084-6112 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025040 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence 11327-11355 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025040 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence 13600-13628 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027614 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence 22173-22201 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027614 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence 27454-27482 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_025131 Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence 15697-15725 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_025131 Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence 20953-20981 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_025131 Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence 23231-23259 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022349 Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence 81333-81361 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022349 Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence 86556-86584 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022349 Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence 88831-88859 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_LT991960 Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3 16143-16171 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_LT991960 Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3 21419-21447 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_LT991960 Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3 23696-23724 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 1555-1583 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026173 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence 60586-60614 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026181 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence 8340-8368 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026181 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence 13604-13632 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026181 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence 15878-15906 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP010363 Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence 101807-101835 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP010363 Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence 107063-107091 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP010363 Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence 109341-109369 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 KY940546 Klebsiella pneumoniae plasmid pUCLA3, complete sequence 38219-38247 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 KY940546 Klebsiella pneumoniae plasmid pUCLA3, complete sequence 43464-43492 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 KY940546 Klebsiella pneumoniae plasmid pUCLA3, complete sequence 45738-45766 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021545 Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence 88291-88319 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021545 Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence 93536-93564 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021545 Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence 95810-95838 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 28820-28848 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008932 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence 31683-31711 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP006922 Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence 16647-16675 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP006922 Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence 21892-21920 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP006922 Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence 24166-24194 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041249 Raoultella electrica strain DSM 102253 plasmid unnamed2, complete sequence 12065-12093 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041249 Raoultella electrica strain DSM 102253 plasmid unnamed2, complete sequence 23949-23977 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041249 Raoultella electrica strain DSM 102253 plasmid unnamed2, complete sequence 26238-26266 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052287 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence 142136-142164 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008843 Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence 14794-14822 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP008843 Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence 20039-20067 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP015387 Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence 15697-15725 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP015387 Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence 20953-20981 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP015387 Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence 23231-23259 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 149964-149992 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024642 Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence 27033-27061 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024642 Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence 32278-32306 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NC_032103 Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence 62768-62796 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP017935 Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence 46339-46367 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 290738-290766 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 88003-88031 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP042547 Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence 126783-126811 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP042547 Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence 132028-132056 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021857 Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence 76710-76738 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021857 Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence 81955-81983 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021857 Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence 84229-84257 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN615880 Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence 62256-62284 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011634 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence 41746-41774 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011634 Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence 47024-47052 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024509 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed3, complete sequence 87744-87772 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024509 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed3, complete sequence 93033-93061 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024509 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed3, complete sequence 95302-95330 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN823984 Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence 106380-106408 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN823986 Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence 107121-107149 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP044391 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence 35534-35562 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP036439 Klebsiella pneumoniae strain ABFQB plasmid unnamed1, complete sequence 97365-97393 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011621 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence 7187-7215 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011621 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence 12468-12496 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP011621 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence 14741-14769 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 175136-175164 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041937 Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence 16149-16177 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041937 Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence 21425-21453 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP041937 Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence 23702-23730 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052438 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence 16123-16151 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052438 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence 21399-21427 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052438 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence 23676-23704 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024544 Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence 19559-19587 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024544 Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence 24840-24868 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP024544 Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence 27113-27141 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_AP014954 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence 21718-21746 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_AP014954 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence 34825-34853 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_AP014954 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence 37114-37142 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025145 Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence 39197-39225 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP025148 Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence 42269-42297 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MH917122 Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence 62670-62698 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MH192342 Klebsiella grimontii strain WCHKG020121 plasmid pKPC2_020121, complete sequence 42375-42403 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MH192342 Klebsiella grimontii strain WCHKG020121 plasmid pKPC2_020121, complete sequence 47598-47626 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_MH192342 Klebsiella grimontii strain WCHKG020121 plasmid pKPC2_020121, complete sequence 49873-49901 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP021741 Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence 50103-50131 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 53703-53731 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 58904-58932 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 61179-61207 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 193636-193664 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN661403 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence 68762-68790 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN661403 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence 74274-74302 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN661403 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence 76543-76571 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 67676-67704 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020359 Klebsiella oxytoca strain AR_0147 plasmid unitig_2, complete sequence 6146-6174 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020359 Klebsiella oxytoca strain AR_0147 plasmid unitig_2, complete sequence 8415-8443 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP020359 Klebsiella oxytoca strain AR_0147 plasmid unitig_2, complete sequence 13659-13687 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026276 Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence 144267-144295 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP048110 Klebsiella michiganensis strain BD177 plasmid unnamed2 95034-95062 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP048110 Klebsiella michiganensis strain BD177 plasmid unnamed2 105060-105088 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP048111 Klebsiella michiganensis strain BD177 plasmid unnamed3 139446-139474 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022275 Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence 4879-4907 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022275 Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence 142272-142300 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022275 Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence 144547-144575 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MN310380 Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence 148419-148447 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047686 Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence 81657-81685 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018815 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence 16988-17016 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018815 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence 19266-19294 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP018815 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence 24522-24550 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 CP052321 Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence 166724-166752 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026271 Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence 15798-15826 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026271 Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence 18071-18099 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026271 Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence 23352-23380 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP027616 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence 24708-24736 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP047683 Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence 81665-81693 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 239449-239477 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP035181 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence 28520-28548 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026174 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence 29125-29153 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026174 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence 31399-31427 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP026174 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence 36663-36691 6 0.793
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 MK191023 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence 83576-83604 6 0.793
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_KU295132 Escherichia coli strain BK34397 plasmid pBK34397, complete sequence 58383-58414 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 67674-67705 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN200129 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence 28511-28542 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 205755-205786 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP047686 Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence 81655-81686 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP047683 Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence 81663-81694 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 1554-1585 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 147546-147577 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MK191023 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence 83574-83605 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NC_032103 Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence 62767-62798 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP017935 Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence 46337-46368 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN615880 Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence 62255-62286 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN823984 Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence 106379-106410 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN823985 Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence 1579-1610 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MN823986 Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence 107120-107151 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP044391 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence 35533-35564 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_MH917122 Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence 62669-62700 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP021741 Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence 50101-50132 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 MF918373 Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence 133475-133506 7 0.781
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 42268-42299 7 0.781
NZ_CP017454_3 3.3|3719915|32|NZ_CP017454|CRT 3719915-3719946 32 NZ_CP040097 Pantoea sp. SO10 plasmid unnamed2, complete sequence 91236-91267 7 0.781
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034472 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence 2312-2340 7 0.759
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034472 Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence 19692-19720 7 0.759
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034477 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence 161342-161370 7 0.759
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP034477 Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence 178722-178750 7 0.759
NZ_CP017454_3 3.4|3719857|29|NZ_CP017454|PILER-CR 3719857-3719885 29 NZ_CP045691 Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence 87494-87522 7 0.759
NZ_CP017454_3 3.5|3719917|29|NZ_CP017454|PILER-CR 3719917-3719945 29 MN693242 Marine virus AFVG_25M170, complete genome 2990-3018 7 0.759
NZ_CP017454_3 3.2|3719855|32|NZ_CP017454|CRT 3719855-3719886 32 NZ_CP014126 Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence 31534-31565 8 0.75
NZ_CP017454_3 3.3|3719915|32|NZ_CP017454|CRT 3719915-3719946 32 MN693242 Marine virus AFVG_25M170, complete genome 2988-3019 8 0.75
NZ_CP017454_3 3.5|3719917|29|NZ_CP017454|PILER-CR 3719917-3719945 29 NC_019401 Cronobacter phage vB_CsaM_GAP32, complete genome 284596-284624 8 0.724
NZ_CP017454_3 3.3|3719915|32|NZ_CP017454|CRT 3719915-3719946 32 NC_019401 Cronobacter phage vB_CsaM_GAP32, complete genome 284594-284625 11 0.656

1. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP028352 (Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence) position: , mismatch: 0, identity: 1.0

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccggctttgcc	Protospacer
********************************

2. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028352 (Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence) position: , mismatch: 0, identity: 1.0

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccggctttgc	Protospacer
*****************************

3. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014126 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.931

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
aggggttcggcggagcttaccggctttgc	Protospacer
. ***************************

4. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014126 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.931

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
aggggttcggcggagcttaccggctttgc	Protospacer
. ***************************

5. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014126 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.931

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
aggggttcggcggagcttaccggctttgc	Protospacer
. ***************************

6. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_013973 (Erwinia amylovora ATCC 49946 plasmid 2, complete sequence) position: , mismatch: 2, identity: 0.931

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttggcggctttgc	Protospacer
******************. *********

7. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_013973 (Erwinia amylovora ATCC 49946 plasmid 2, complete sequence) position: , mismatch: 2, identity: 0.931

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttggcggctttgc	Protospacer
******************. *********

8. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_013973 (Erwinia amylovora ATCC 49946 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.906

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ctgcgggttcggcggagcttggcggctttgcc	Protospacer
.*******************. **********

9. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_013973 (Erwinia amylovora ATCC 49946 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.906

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ctgcgggttcggcggagcttggcggctttgcc	Protospacer
.*******************. **********

10. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 3, identity: 0.897

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
agggattcggcggagcttaccggctttgc	Protospacer
. **.************************

11. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 3, identity: 0.897

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
agggattcggcggagcttaccggctttgc	Protospacer
. **.************************

12. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP014126 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
gaaggggttcggcggagcttaccggctttgcc	Protospacer
  . ****************************

13. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP014126 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ggaggggttcggcggagcttaccggctttgcc	Protospacer
  . ****************************

14. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP014126 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
gaaggggttcggcggagcttaccggctttgcc	Protospacer
  . ****************************

15. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP016891 (Pantoea agglomerans strain C410P1 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.862

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
agggattcagcggagcttaccggctttgc	Protospacer
. **.***.********************

16. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031652 (Pantoea agglomerans strain TH81 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.862

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
aggggttcggcggagcttaccggcaatgc	Protospacer
. **********************  ***

17. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 5, identity: 0.844

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ggagggattcggcggagcttaccggctttgcc	Protospacer
  . **.*************************

18. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 5, identity: 0.844

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttcgcggtccggcggagcttaccggctctgcc	Protospacer
**   ***.******************.****

19. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 5, identity: 0.844

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ggagggattcggcggagcttaccggctttgcc	Protospacer
  . **.*************************

20. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 5, identity: 0.844

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttcgcggtccggcggagcttaccggctctgcc	Protospacer
**   ***.******************.****

21. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014126 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
aggggttcggcggagcttagcggcttgcc	Protospacer
. ***************** ******  *

22. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
cgcggtccggcggagcttaccggctctgc	Protospacer
   ***.******************.***

23. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
cgcggtccggcggagcttaccggctctgc	Protospacer
   ***.******************.***

24. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgggtgcta	Protospacer
*********************** * .  

25. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_014312 (Klebsiella pneumoniae plasmid pKP048, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

26. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026280 (Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

27. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026280 (Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

28. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

29. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

30. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

31. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

32. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

33. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

34. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

35. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

36. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

37. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

38. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

39. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

40. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

41. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

42. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

43. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

44. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY689238 (Klebsiella pneumoniae strain TP-P16 plasmid pKPC_P16, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

45. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY689238 (Klebsiella pneumoniae strain TP-P16 plasmid pKPC_P16, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

46. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY689238 (Klebsiella pneumoniae strain TP-P16 plasmid pKPC_P16, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

47. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

48. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

49. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

50. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY174332 (Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

51. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY174332 (Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

52. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY174332 (Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

53. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

54. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

55. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

56. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP032197 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

57. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

58. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

59. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

60. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

61. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

62. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

63. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

64. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

65. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

66. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

67. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

68. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

69. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

70. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

71. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

72. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

73. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

74. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

75. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

76. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

77. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

78. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

79. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

80. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

81. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

82. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

83. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

84. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

85. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

86. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KP345882 (Escherichia coli strain BK32533 plasmid pBK32533, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

87. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

88. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

89. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

90. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

91. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

92. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

93. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

94. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

95. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

96. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

97. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

98. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

99. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

100. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

101. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

102. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

103. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

104. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

105. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

106. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

107. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

108. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

109. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

110. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

111. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP043048 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

112. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

113. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

114. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

115. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

116. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

117. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

118. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

119. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

120. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

121. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

122. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

123. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

124. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

125. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

126. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

127. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

128. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

129. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

130. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

131. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP037444 (Klebsiella sp. PO552 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

132. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP037444 (Klebsiella sp. PO552 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

133. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP019900 (Raoultella planticola strain GODA plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

134. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP019900 (Raoultella planticola strain GODA plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

135. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_020893 (Klebsiella pneumoniae plasmid pKPC-LK30, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

136. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_020893 (Klebsiella pneumoniae plasmid pKPC-LK30, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

137. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_020893 (Klebsiella pneumoniae plasmid pKPC-LK30, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

138. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

139. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

140. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

141. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

142. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

143. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

144. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP045264 (Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

145. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP045264 (Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

146. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

147. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

148. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

149. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

150. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

151. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

152. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

153. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

154. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

155. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

156. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

157. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

158. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

159. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

160. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

161. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

162. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

163. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

164. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

165. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

166. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

167. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

168. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

169. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

170. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

171. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

172. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP033394 (Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

173. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

174. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

175. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

176. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

177. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

178. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

179. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

180. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

181. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

182. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

183. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

184. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

185. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052145 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

186. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052145 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

187. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052145 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

188. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

189. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

190. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

191. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

192. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028955 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

193. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028955 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

194. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

195. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

196. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

197. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

198. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

199. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036362 (Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

200. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036362 (Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

201. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036362 (Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

202. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

203. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

204. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

205. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

206. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

207. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

208. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

209. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

210. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

211. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

212. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to HG969998 (Klebsiella pneumoniae plasmid pIT-11C07, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

213. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to HG969998 (Klebsiella pneumoniae plasmid pIT-11C07, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

214. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

215. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

216. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

217. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

218. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

219. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

220. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

221. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

222. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

223. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

224. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

225. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

226. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

227. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

228. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

229. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

230. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034777 (Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

231. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034777 (Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

232. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

233. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

234. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

235. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

236. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

237. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

238. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

239. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

240. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

241. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

242. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

243. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

244. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

245. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

246. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

247. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

248. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

249. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

250. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

251. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

252. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

253. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

254. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

255. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

256. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

257. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

258. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

259. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

260. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

261. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

262. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

263. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

264. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

265. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

266. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

267. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

268. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN891684 (Klebsiella pneumoniae strain BJ107 plasmid pBJ107-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

269. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN891684 (Klebsiella pneumoniae strain BJ107 plasmid pBJ107-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

270. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN891685 (Klebsiella pneumoniae strain BJ119 plasmid pBJ119-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

271. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN891686 (Klebsiella pneumoniae strain ZZ58 plasmid pZZ58-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

272. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN891686 (Klebsiella pneumoniae strain ZZ58 plasmid pZZ58-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

273. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

274. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

275. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

276. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

277. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_LR134255 (Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

278. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_LR134255 (Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

279. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_LR134255 (Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

280. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_LR134255 (Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

281. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

282. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

283. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

284. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

285. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

286. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

287. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

288. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

289. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

290. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

291. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

292. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

293. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

294. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

295. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

296. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

297. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

298. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

299. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

300. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

301. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

302. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

303. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

304. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

305. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

306. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

307. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

308. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

309. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

310. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

311. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MG700549 (Klebsiella pneumoniae strain st015256/1 plasmid pUJ-83KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

312. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052219 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

313. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052219 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

314. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052219 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

315. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

316. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

317. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

318. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

319. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

320. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

321. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

322. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

323. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

324. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP023840 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

325. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP037964 (Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

326. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP037964 (Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

327. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

328. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

329. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

330. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

331. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

332. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

333. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

334. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

335. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

336. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

337. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018992 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

338. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018992 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

339. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018992 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

340. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

341. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

342. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

343. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

344. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

345. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

346. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

347. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

348. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

349. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

350. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

351. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027614 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

352. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP009275 (Klebsiella variicola strain DX120E plasmid pKV1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

353. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP009275 (Klebsiella variicola strain DX120E plasmid pKV1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

354. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

355. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

356. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

357. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

358. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

359. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

360. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

361. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

362. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

363. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

364. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

365. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

366. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

367. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

368. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

369. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

370. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

371. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

372. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

373. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

374. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

375. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

376. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

377. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

378. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

379. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

380. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

381. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

382. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

383. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

384. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

385. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

386. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP045217 (Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

387. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

388. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

389. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

390. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

391. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

392. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026173 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

393. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026173 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

394. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

395. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

396. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

397. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

398. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

399. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

400. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

401. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

402. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

403. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

404. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

405. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

406. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

407. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

408. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

409. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

410. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

411. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

412. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

413. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

414. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

415. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

416. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

417. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

418. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

419. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027044 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

420. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027044 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

421. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021166 (Klebsiella pneumoniae strain 203 plasmid p203, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

422. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

423. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

424. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

425. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

426. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

427. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

428. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

429. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

430. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

431. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

432. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

433. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

434. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

435. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

436. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

437. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

438. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

439. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

440. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

441. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052526 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

442. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052526 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

443. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP017851 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

444. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

445. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

446. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

447. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP017286 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

448. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

449. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

450. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

451. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

452. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

453. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

454. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

455. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP009773 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pKPC-63d, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

456. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP009776 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPC-def, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

457. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

458. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

459. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

460. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

461. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

462. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

463. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

464. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

465. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

466. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

467. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

468. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP046947 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed8) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

469. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP006926 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

470. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

471. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

472. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008932 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

473. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

474. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

475. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP006663 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

476. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP006663 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

477. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

478. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

479. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

480. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

481. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

482. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

483. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

484. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

485. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

486. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

487. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

488. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

489. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

490. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008843 (Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

491. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP017281 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

492. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

493. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

494. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

495. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022825 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

496. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022825 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

497. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020065 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

498. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

499. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

500. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

501. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

502. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

503. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

504. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

505. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

506. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

507. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

508. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

509. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

510. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

511. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

512. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP038279 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

513. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP038279 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

514. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

515. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

516. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

517. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

518. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

519. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

520. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

521. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

522. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

523. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

524. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

525. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

526. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

527. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

528. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

529. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

530. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

531. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

532. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

533. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

534. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

535. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

536. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

537. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

538. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

539. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

540. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

541. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

542. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

543. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

544. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

545. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

546. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_021199 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

547. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022613 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

548. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022613 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

549. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP050373 (Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

550. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP050373 (Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

551. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

552. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

553. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

554. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

555. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

556. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

557. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

558. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

559. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

560. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

561. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

562. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

563. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

564. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

565. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026148 (Klebsiella pneumoniae strain F132 plasmid pF132_3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

566. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026152 (Klebsiella pneumoniae strain F138 plasmid pF138_3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

567. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

568. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP023916 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

569. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP023916 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

570. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

571. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

572. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

573. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

574. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

575. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

576. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020904 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

577. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020904 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

578. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

579. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

580. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

581. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

582. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

583. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP042547 (Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

584. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP013339 (Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

585. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047161 (Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

586. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047161 (Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

587. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029723 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

588. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029723 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

589. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

590. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

591. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

592. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

593. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

594. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN823996 (Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

595. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN823996 (Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

596. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN823996 (Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

597. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

598. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

599. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

600. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

601. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

602. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

603. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

604. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

605. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

606. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

607. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

608. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

609. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

610. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

611. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

612. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024510 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

613. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024510 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

614. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

615. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

616. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

617. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036366 (Klebsiella pneumoniae strain WCHKP115068 plasmid pCTXM65_115068, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

618. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

619. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

620. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

621. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

622. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

623. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

624. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

625. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

626. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

627. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP015824 (Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

628. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP015824 (Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

629. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

630. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

631. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

632. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

633. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

634. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

635. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

636. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

637. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

638. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

639. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

640. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

641. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

642. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

643. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

644. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

645. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

646. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

647. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

648. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

649. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

650. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

651. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

652. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

653. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

654. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

655. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

656. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

657. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021946 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

658. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

659. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

660. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

661. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027067 (Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

662. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027067 (Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

663. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027067 (Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

664. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

665. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

666. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

667. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

668. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034125 (Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

669. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034125 (Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

670. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034125 (Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

671. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

672. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

673. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

674. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

675. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

676. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041937 (Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

677. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052436 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

678. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

679. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

680. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

681. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

682. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

683. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

684. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

685. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

686. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

687. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

688. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

689. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

690. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

691. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

692. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

693. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

694. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

695. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

696. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

697. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

698. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

699. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

700. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024484 (Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

701. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

702. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054265 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

703. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

704. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

705. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

706. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

707. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

708. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

709. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

710. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

711. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

712. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

713. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

714. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_023905 (Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

715. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_023905 (Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

716. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

717. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

718. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

719. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

720. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

721. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

722. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

723. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

724. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

725. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

726. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

727. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

728. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

729. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

730. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

731. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

732. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

733. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

734. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

735. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

736. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026016 (Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

737. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

738. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

739. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

740. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

741. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

742. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

743. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

744. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

745. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

746. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

747. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054734 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

748. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054734 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

749. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054734 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

750. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

751. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

752. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

753. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

754. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK649823 (Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

755. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK649823 (Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

756. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK649823 (Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

757. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

758. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

759. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

760. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP023943 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

761. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP023943 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

762. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

763. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

764. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP019904 (Escherichia coli strain MDR_56 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

765. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP019904 (Escherichia coli strain MDR_56 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

766. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

767. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

768. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

769. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

770. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

771. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

772. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

773. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP015396 (Klebsiella pneumoniae strain CR14 plasmid pCR14_4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

774. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027696 (Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

775. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027696 (Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

776. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

777. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

778. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

779. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

780. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

781. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

782. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

783. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

784. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

785. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

786. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

787. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

788. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

789. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK433206 (Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

790. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK433206 (Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

791. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK433206 (Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

792. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

793. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

794. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

795. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

796. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

797. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

798. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MH569712 (Serratia marcescens strain S120 plasmid pPM120-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

799. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MH255827 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

800. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MH255827 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

801. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MH255827 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

802. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

803. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

804. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

805. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

806. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

807. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

808. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MH263653 (Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

809. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MH263653 (Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

810. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MH263653 (Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

811. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK036887 (Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

812. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK036887 (Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

813. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK036887 (Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

814. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK036888 (Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

815. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK036888 (Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

816. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK036888 (Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

817. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK036886 (Klebsiella pneumoniae strain 283149 plasmid p283149-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

818. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MK036886 (Klebsiella pneumoniae strain 283149 plasmid p283149-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

819. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN657248 (Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

820. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN657248 (Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

821. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN657248 (Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

822. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014777 (Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

823. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

824. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

825. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

826. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MF133495 (Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

827. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MF133495 (Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

828. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MF133495 (Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

829. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MF168404 (Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

830. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MF168404 (Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

831. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MF168404 (Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

832. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

833. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

834. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

835. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MF168402 (Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

836. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MF168402 (Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

837. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MF168402 (Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

838. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MF156695 (Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

839. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MF156695 (Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

840. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018455 (Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

841. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018455 (Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

842. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018455 (Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

843. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

844. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

845. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP030134 (Klebsiella pneumoniae strain 160111 plasmid pKPC2_L111, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

846. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP030134 (Klebsiella pneumoniae strain 160111 plasmid pKPC2_L111, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

847. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP030134 (Klebsiella pneumoniae strain 160111 plasmid pKPC2_L111, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

848. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN823997 (Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

849. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MT109193 (Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

850. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MT109193 (Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

851. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP035536 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

852. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP035536 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

853. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP035536 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

854. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MG764553 (Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

855. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MG764553 (Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

856. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MG288683 (Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

857. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MG288683 (Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

858. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MG288683 (Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

859. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP033755 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

860. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029441 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

861. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029441 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

862. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029441 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

863. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP032169 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

864. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP032169 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

865. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

866. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

867. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

868. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

869. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034407 (Klebsiella pneumoniae strain NH34 plasmid pNH34.2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

870. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034407 (Klebsiella pneumoniae strain NH34 plasmid pNH34.2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

871. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031720 (Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

872. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031720 (Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

873. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031720 (Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

874. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN661404 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

875. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN661404 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

876. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN661404 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

877. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MT090958 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

878. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MT090958 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

879. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MT090958 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

880. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MT108209 (Klebsiella pneumoniae strain BJ108 plasmid pBJ108-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

881. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MT108209 (Klebsiella pneumoniae strain BJ108 plasmid pBJ108-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

882. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MT108209 (Klebsiella pneumoniae strain BJ108 plasmid pBJ108-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

883. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040535 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

884. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040535 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

885. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040535 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

886. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to LK391770 (Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

887. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to LK391770 (Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

888. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

889. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

890. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

891. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

892. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

893. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

894. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

895. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

896. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

897. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY270850 (Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

898. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY270850 (Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

899. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY270850 (Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

900. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

901. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

902. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

903. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

904. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

905. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

906. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

907. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

908. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

909. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

910. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

911. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

912. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

913. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

914. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

915. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

916. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

917. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

918. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

919. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

920. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026133 (Klebsiella pneumoniae strain F5 plasmid pF5_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

921. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026133 (Klebsiella pneumoniae strain F5 plasmid pF5_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

922. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040994 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

923. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040994 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

924. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040994 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

925. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

926. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

927. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

928. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

929. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

930. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

931. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

932. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

933. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

934. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

935. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

936. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP037744 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

937. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

938. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

939. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_009651 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN5, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

940. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

941. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

942. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

943. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

944. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

945. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

946. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_AP018754 (Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

947. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_AP018754 (Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

948. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

949. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

950. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

951. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

952. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

953. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

954. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

955. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

956. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

957. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

958. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

959. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

960. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

961. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

962. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

963. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

964. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP033395 (Klebsiella pneumoniae strain WCHKP015625 plasmid pKPC12_015625, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

965. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP033395 (Klebsiella pneumoniae strain WCHKP015625 plasmid pKPC12_015625, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

966. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

967. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

968. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

969. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

970. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

971. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_AP023150 (Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03M, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

972. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

973. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

974. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

975. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

976. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

977. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

978. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

979. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MT066418 (Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

980. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MT066418 (Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

981. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

982. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

983. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

984. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

985. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

986. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

987. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

988. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

989. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

990. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

991. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

992. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

993. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

994. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

995. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

996. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

997. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

998. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

999. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020852 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1000. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1001. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1002. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1003. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1004. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN891681 (Klebsiella pneumoniae strain 14899 plasmid p14899-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1005. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN891681 (Klebsiella pneumoniae strain 14899 plasmid p14899-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1006. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1007. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1008. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1009. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1010. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1011. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1012. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1013. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1014. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1015. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1016. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_FO834905 (Klebsiella pneumoniae strain Kp52.145 plasmid II, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1017. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1018. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1019. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1020. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1021. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1022. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1023. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN310380 (Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1024. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1025. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1026. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1027. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1028. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1029. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1030. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1031. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1032. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1033. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018818 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1034. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018818 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1035. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1036. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1037. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1038. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1039. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1040. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1041. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1042. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1043. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1044. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1045. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1046. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1047. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1048. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1049. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1050. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1051. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1052. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1053. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1054. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1055. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1056. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1057. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1058. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP042483 (Klebsiella pneumoniae strain C51 plasmid pC51_002, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1059. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1060. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1061. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027616 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1062. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1063. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1064. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1065. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1066. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1067. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1068. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1069. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1070. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1071. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1072. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1073. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1074. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP010881 (Escherichia coli strain MNCRE44 plasmid pMNCRE44_5, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1075. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1076. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1077. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1078. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1079. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1080. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1081. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034325 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1082. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1083. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1084. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1085. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1086. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1087. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1088. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1089. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1090. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028991 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1091. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028991 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1092. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1093. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1094. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029583 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1095. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1096. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1097. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1098. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1099. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1100. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1101. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1102. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1103. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1104. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1105. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1106. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1107. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1108. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1109. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1110. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1111. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1112. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1113. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1114. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP038003 (Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1115. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP038003 (Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1116. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1117. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1118. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1119. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP007736 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1120. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1121. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026180 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1122. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026180 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1123. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1124. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1125. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031851 (Klebsiella pneumoniae strain 121 plasmid pKP121-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1126. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031851 (Klebsiella pneumoniae strain 121 plasmid pKP121-2, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1127. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1128. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1129. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1130. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1131. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1132. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1133. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1134. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041648 (Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1135. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1136. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1137. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1138. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1139. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 5, identity: 0.828

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt	Protospacer
**********************  *.* .

1140. spacer 3.5|3719917|29|NZ_CP017454|PILER-CR matches to NZ_CP040097 (Pantoea sp. SO10 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

cagataataccttctttacctgtctttct	CRISPR spacer
cagataatatcttctttaactgttctttt	Protospacer
*********.******** ****..**.*

1141. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to LK391770 (Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1142. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to LK391770 (Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1143. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1144. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1145. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026280 (Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1146. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026280 (Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1147. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1148. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1149. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1150. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1151. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1152. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1153. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1154. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1155. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1156. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1157. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KY689238 (Klebsiella pneumoniae strain TP-P16 plasmid pKPC_P16, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1158. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1159. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1160. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1161. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1162. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1163. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1164. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1165. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1166. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1167. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1168. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1169. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1170. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1171. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1172. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1173. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1174. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1175. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1176. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1177. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1178. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1179. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1180. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1181. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1182. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1183. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1184. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1185. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1186. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1187. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1188. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1189. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1190. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1191. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1192. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1193. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026133 (Klebsiella pneumoniae strain F5 plasmid pF5_1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1194. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP040994 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1195. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP040994 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1196. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP040994 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1197. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1198. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1199. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1200. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1201. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1202. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1203. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1204. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1205. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1206. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1207. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1208. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1209. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1210. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1211. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1212. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1213. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1214. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1215. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1216. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1217. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1218. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1219. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1220. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1221. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP037444 (Klebsiella sp. PO552 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1222. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1223. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1224. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1225. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1226. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1227. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1228. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1229. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1230. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1231. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1232. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1233. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1234. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1235. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1236. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1237. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1238. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1239. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1240. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1241. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1242. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1243. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1244. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1245. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1246. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1247. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1248. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP033394 (Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1249. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1250. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1251. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1252. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1253. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1254. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1255. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052145 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1256. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052145 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1257. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1258. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1259. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP028955 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1260. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1261. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1262. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1263. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP036362 (Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1264. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1265. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1266. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1267. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1268. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1269. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1270. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1271. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1272. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1273. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1274. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1275. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1276. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1277. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP034777 (Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1278. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1279. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1280. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1281. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1282. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1283. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1284. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1285. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1286. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1287. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1288. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1289. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1290. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1291. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1292. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1293. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1294. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1295. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1296. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1297. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1298. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1299. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1300. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1301. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1302. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1303. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1304. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1305. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1306. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1307. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1308. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1309. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1310. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1311. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1312. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1313. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1314. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1315. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1316. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1317. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1318. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1319. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1320. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1321. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1322. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1323. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1324. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1325. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1326. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MG700549 (Klebsiella pneumoniae strain st015256/1 plasmid pUJ-83KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1327. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1328. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052219 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1329. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052219 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1330. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1331. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1332. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1333. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1334. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1335. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1336. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1337. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1338. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1339. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1340. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1341. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1342. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1343. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1344. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1345. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1346. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1347. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1348. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1349. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP018992 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1350. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP018992 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1351. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1352. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1353. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1354. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1355. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1356. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1357. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1358. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1359. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1360. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1361. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1362. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1363. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1364. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1365. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1366. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1367. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1368. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1369. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1370. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1371. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1372. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1373. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1374. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1375. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1376. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1377. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1378. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1379. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP028991 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1380. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1381. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1382. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1383. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1384. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1385. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1386. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1387. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1388. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1389. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1390. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1391. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP045217 (Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1392. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1393. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1394. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1395. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1396. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1397. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1398. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1399. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1400. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1401. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026173 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1402. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026173 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1403. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1404. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1405. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1406. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1407. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1408. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1409. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1410. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1411. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1412. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1413. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1414. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1415. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1416. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1417. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1418. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1419. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1420. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1421. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1422. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1423. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP041648 (Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1424. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1425. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1426. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1427. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1428. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1429. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1430. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1431. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1432. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1433. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1434. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1435. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1436. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1437. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1438. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1439. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1440. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1441. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP033947 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1442. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1443. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1444. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1445. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1446. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1447. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP028553 (Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1448. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1449. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1450. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1451. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1452. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP046952 (Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1453. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP046952 (Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1454. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP046952 (Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1455. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP046942 (Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1456. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP046947 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed8) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1457. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP009115 (Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1458. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1459. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1460. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1461. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1462. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1463. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1464. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1465. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1466. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1467. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026396 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1468. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026396 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1469. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1470. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1471. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1472. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP041250 (Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1473. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1474. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1475. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1476. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1477. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1478. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP025966 (Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1479. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP020065 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1480. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1481. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1482. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1483. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1484. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1485. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP038279 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1486. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1487. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1488. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1489. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1490. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1491. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP050170 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1492. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1493. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1494. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1495. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1496. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1497. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1498. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1499. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1500. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1501. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1502. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1503. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1504. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP016891 (Pantoea agglomerans strain C410P1 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ggagggattcagcggagcttaccggctttgcc	Protospacer
  . **.***.*********************

1505. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP046384 (Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1506. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP046384 (Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1507. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP046384 (Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1508. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1509. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1510. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1511. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1512. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1513. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1514. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1515. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1516. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP030342 (Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1517. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP030342 (Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1518. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP030342 (Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1519. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1520. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1521. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026141 (Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1522. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1523. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP023916 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1524. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP023725 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1525. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026584 (Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1526. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1527. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1528. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1529. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP045678 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1530. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP045678 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1531. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP045678 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1532. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1533. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026212 (Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1534. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026212 (Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1535. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP029723 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1536. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1537. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1538. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN823996 (Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1539. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN824001 (Klebsiella pneumoniae strain N201205880 plasmid p205880-1FIIK, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1540. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1541. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1542. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1543. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1544. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP011630 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-49, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1545. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1546. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1547. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1548. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP024510 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1549. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP032189 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1550. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP032189 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1551. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP036366 (Klebsiella pneumoniae strain WCHKP115068 plasmid pCTXM65_115068, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1552. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN842291 (Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1553. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN842292 (Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1554. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1555. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1556. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1557. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1558. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1559. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1560. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1561. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1562. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1563. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1564. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP016403 (Klebsiella pneumoniae subsp. pneumoniae strain F5 plasmid pF5, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1565. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1566. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1567. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1568. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1569. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1570. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP044395 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1571. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP044395 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1572. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP044395 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1573. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1574. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1575. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1576. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1577. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1578. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1579. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1580. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1581. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1582. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1583. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_AP018674 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1584. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_AP018674 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1585. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1586. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1587. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP021946 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1588. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP031652 (Pantoea agglomerans strain TH81 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
gaaggggttcggcggagcttaccggcaatgcc	Protospacer
  . **********************  ****

1589. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1590. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1591. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP027158 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1592. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP027158 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1593. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP027158 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1594. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP027067 (Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1595. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP025010 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1596. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP025010 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1597. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP025010 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1598. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1599. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1600. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1601. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP034125 (Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1602. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1603. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP041937 (Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1604. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1605. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1606. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1607. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP035124 (Escherichia coli strain EC25 plasmid pEC25-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1608. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1609. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1610. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1611. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1612. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1613. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_016846 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1614. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1615. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1616. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1617. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP024484 (Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1618. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP034085 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1619. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP050282 (Klebsiella pneumoniae strain 9949 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1620. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1621. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1622. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1623. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1624. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1625. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1626. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1627. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1628. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1629. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1630. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1631. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1632. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP028717 (Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1633. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1634. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1635. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1636. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1637. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1638. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1639. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1640. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1641. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1642. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1643. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1644. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1645. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP054734 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1646. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1647. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP028389 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1648. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP050278 (Klebsiella pneumoniae strain 10553 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1649. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK649823 (Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1650. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1651. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052316 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1652. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052316 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1653. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052316 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1654. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052316 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1655. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP023942 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1656. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1657. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP037930 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid p8788-IT, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1658. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP037930 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid p8788-IT, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1659. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP037930 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid p8788-IT, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1660. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP019904 (Escherichia coli strain MDR_56 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1661. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1662. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1663. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1664. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP015395 (Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1665. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP015395 (Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1666. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP015395 (Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1667. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1668. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP018955 (Escherichia coli strain Ecol_316 plasmid pEC316_2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1669. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP018955 (Escherichia coli strain Ecol_316 plasmid pEC316_2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1670. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP047634 (Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1671. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN891678 (Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1672. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1673. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1674. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1675. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1676. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1677. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1678. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1679. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1680. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MK167987 (Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1681. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MK167987 (Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1682. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MK167987 (Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1683. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MK433206 (Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1684. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1685. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1686. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1687. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MN543570 (Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1688. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP044045 (Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1689. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN657251 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1690. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN657251 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1691. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN657251 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1692. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP050286 (Klebsiella pneumoniae strain 9630 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1693. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to CP050286 (Klebsiella pneumoniae strain 9630 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1694. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MH909340 (Klebsiella pneumoniae strain A1763 plasmid pA1763-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1695. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1696. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1697. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1698. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MK413718 (Klebsiella pneumoniae strain 427113 plasmid p427113-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1699. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1700. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MH263653 (Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1701. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MH464586 (Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1702. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MK036887 (Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1703. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MK036888 (Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1704. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN657248 (Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1705. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1706. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP014777 (Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1707. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1708. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1709. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1710. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MF133495 (Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1711. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MF168404 (Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1712. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1713. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1714. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MF168402 (Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1715. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP018455 (Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1716. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1717. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1718. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP030134 (Klebsiella pneumoniae strain 160111 plasmid pKPC2_L111, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1719. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP035536 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1720. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MG252894 (Klebsiella pneumoniae strain Kpn-35963cz plasmid pKpn-35963cz, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1721. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MG736312 (Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1722. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MG736312 (Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1723. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MG288683 (Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1724. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP026370 (Klebsiella quasipneumoniae strain A708 plasmid pA708-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1725. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP035204 (Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1726. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP035204 (Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1727. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP035204 (Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1728. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP025463 (Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1729. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP029441 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1730. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP029441 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1731. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP032169 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1732. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1733. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1734. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1735. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP031720 (Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1736. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN661404 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1737. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN661404 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1738. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MT090958 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1739. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MT108207 (Klebsiella pneumoniae strain A1750 plasmid pA1750-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1740. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MT108209 (Klebsiella pneumoniae strain BJ108 plasmid pBJ108-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1741. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MT108210 (Klebsiella pneumoniae strain W09308 plasmid pW09308-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1742. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MT108212 (Klebsiella pneumoniae strain 12478 plasmid p12478-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1743. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MT108213 (Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1744. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MT108213 (Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1745. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MT108213 (Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence) position: , mismatch: 6, identity: 0.812

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt	Protospacer
************************  *.* ..

1746. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
agggattcggcggagcttaccggcacagc	Protospacer
. **.******************* . **

1747. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
agggattcggcggagcttaccggcgcagc	Protospacer
. **.******************* . **

1748. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
agggattcggcggagcttaccggcgcagc	Protospacer
. **.******************* . **

1749. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
agggattcggcggagcttaccggcacagc	Protospacer
. **.******************* . **

1750. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028554 (Klebsiella variicola strain WCHKP19 plasmid pKPC2_020019, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1751. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028554 (Klebsiella variicola strain WCHKP19 plasmid pKPC2_020019, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1752. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP028554 (Klebsiella variicola strain WCHKP19 plasmid pKPC2_020019, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1753. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026280 (Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagtttaccgcatcttt	Protospacer
***************.******  *.* .

1754. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY399973 (Enterobacter cloacae strain EClY2403 plasmid pKPC2_EClY2403, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1755. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY399973 (Enterobacter cloacae strain EClY2403 plasmid pKPC2_EClY2403, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1756. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY399973 (Enterobacter cloacae strain EClY2403 plasmid pKPC2_EClY2403, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1757. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY399972 (Enterobacter cloacae strain EClY2402 plasmid pKPC2_EClY2402, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1758. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY399972 (Enterobacter cloacae strain EClY2402 plasmid pKPC2_EClY2402, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1759. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KY399972 (Enterobacter cloacae strain EClY2402 plasmid pKPC2_EClY2402, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1760. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP032198 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1761. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP050837 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1762. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP050837 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1763. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KP868646 (Enterobacter cloacae strain WCHECl-14653 plasmid pKPC2-EC14653, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1764. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KP868646 (Enterobacter cloacae strain WCHECl-14653 plasmid pKPC2-EC14653, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1765. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KP868646 (Enterobacter cloacae strain WCHECl-14653 plasmid pKPC2-EC14653, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1766. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1767. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1768. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1769. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1770. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1771. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP023418 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1772. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP023418 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1773. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP023418 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1774. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1775. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1776. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcatt	Protospacer
**********************  *.  .

1777. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1778. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1779. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1780. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1781. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1782. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagtttaccgcatcttt	Protospacer
***************.******  *.* .

1783. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1784. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1785. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1786. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025040 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1787. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025040 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1788. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025040 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1789. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027614 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1790. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027614 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1791. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1792. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1793. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1794. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022349 (Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1795. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022349 (Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1796. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022349 (Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1797. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_LT991960 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1798. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_LT991960 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1799. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_LT991960 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1800. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1801. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026173 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagtttaccgcatcttt	Protospacer
***************.******  *.* .

1802. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026181 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1803. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026181 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1804. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026181 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1805. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1806. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1807. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1808. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to KY940546 (Klebsiella pneumoniae plasmid pUCLA3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1809. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to KY940546 (Klebsiella pneumoniae plasmid pUCLA3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1810. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to KY940546 (Klebsiella pneumoniae plasmid pUCLA3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1811. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1812. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1813. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1814. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagtttaccgcgtcttt	Protospacer
***************.******  *.* .

1815. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008932 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagctaaccgcgtcttt	Protospacer
***************** ****  *.* .

1816. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP006922 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1817. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP006922 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1818. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP006922 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1819. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041249 (Raoultella electrica strain DSM 102253 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1820. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041249 (Raoultella electrica strain DSM 102253 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1821. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041249 (Raoultella electrica strain DSM 102253 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1822. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagtttaccgcatcttt	Protospacer
***************.******  *.* .

1823. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008843 (Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1824. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP008843 (Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1825. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1826. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1827. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1828. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1829. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024642 (Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1830. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024642 (Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1831. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1832. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1833. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagtttaccgcgtcttt	Protospacer
***************.******  *.* .

1834. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagtttaccgcgtcttt	Protospacer
***************.******  *.* .

1835. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP042547 (Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1836. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP042547 (Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1837. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1838. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1839. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1840. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1841. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011634 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1842. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011634 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1843. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024509 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1844. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024509 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1845. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024509 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1846. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1847. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1848. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcagagcttaccgcgtcttt	Protospacer
***********.**********  *.* .

1849. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP036439 (Klebsiella pneumoniae strain ABFQB plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcatt	Protospacer
**********************  *.  .

1850. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011621 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1851. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011621 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1852. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP011621 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1853. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagtttaccgcgtcttt	Protospacer
***************.******  *.* .

1854. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041937 (Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1855. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041937 (Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1856. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP041937 (Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1857. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052438 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1858. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052438 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1859. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052438 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1860. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024544 (Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1861. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024544 (Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1862. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP024544 (Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1863. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_AP014954 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1864. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_AP014954 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1865. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_AP014954 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1866. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1867. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1868. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1869. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MH192342 (Klebsiella grimontii strain WCHKG020121 plasmid pKPC2_020121, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1870. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MH192342 (Klebsiella grimontii strain WCHKG020121 plasmid pKPC2_020121, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1871. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_MH192342 (Klebsiella grimontii strain WCHKG020121 plasmid pKPC2_020121, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1872. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1873. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1874. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1875. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1876. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagtttaccgcgtcttt	Protospacer
***************.******  *.* .

1877. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN661403 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1878. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN661403 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1879. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN661403 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1880. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1881. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020359 (Klebsiella oxytoca strain AR_0147 plasmid unitig_2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1882. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020359 (Klebsiella oxytoca strain AR_0147 plasmid unitig_2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1883. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP020359 (Klebsiella oxytoca strain AR_0147 plasmid unitig_2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1884. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcatt	Protospacer
**********************  *.  .

1885. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP048110 (Klebsiella michiganensis strain BD177 plasmid unnamed2) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1886. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP048110 (Klebsiella michiganensis strain BD177 plasmid unnamed2) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1887. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP048111 (Klebsiella michiganensis strain BD177 plasmid unnamed3) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1888. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022275 (Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1889. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022275 (Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1890. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022275 (Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1891. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MN310380 (Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcatt	Protospacer
**********************  *.  .

1892. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1893. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1894. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt	Protospacer
**********************  *.  .

1895. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1896. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagtttaccgcgtcttt	Protospacer
***************.******  *.* .

1897. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026271 (Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1898. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026271 (Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1899. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026271 (Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1900. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP027616 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1901. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1902. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagtttaccgcgtcttt	Protospacer
***************.******  *.* .

1903. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1904. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026174 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1905. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026174 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt	Protospacer
**********************  *.. .

1906. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP026174 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcggagcttaccgcatcctt	Protospacer
**********************  *.. .

1907. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 6, identity: 0.793

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt	Protospacer
************ *********  *.* .

1908. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt	Protospacer
************** *********  *.* ..

1909. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt	Protospacer
************** *********  *.* ..

1910. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt	Protospacer
************** *********  *.* ..

1911. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt	Protospacer
************** *********  *.* ..

1912. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt	Protospacer
************** *********  *.* ..

1913. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt	Protospacer
************** *********  *.* ..

1914. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt	Protospacer
************** *********  *.* ..

1915. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ctgcgggttcggcggagcttaccgcgtctttt	Protospacer
.***********************  *.* ..

1916. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt	Protospacer
************** *********  *.* ..

1917. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt	Protospacer
************** *********  *.* ..

1918. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt	Protospacer
************** *********  *.* ..

1919. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt	Protospacer
************** *********  *.* ..

1920. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt	Protospacer
************** *********  *.* ..

1921. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt	Protospacer
************** *********  *.* ..

1922. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt	Protospacer
************** *********  *.* ..

1923. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcagagcttaccgcgtctttt	Protospacer
*************.**********  *.* ..

1924. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt	Protospacer
************** *********  *.* ..

1925. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt	Protospacer
************** *********  *.* ..

1926. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
tagcgggttcggcggagcttaccgggtgctaa	Protospacer
* *********************** * .   

1927. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 7, identity: 0.781

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt	Protospacer
************** *********  *.* ..

1928. spacer 3.3|3719915|32|NZ_CP017454|CRT matches to NZ_CP040097 (Pantoea sp. SO10 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

gccagataataccttctttacctgtctttctt	CRISPR spacer
cccagataatatcttctttaactgttctttta	Protospacer
 **********.******** ****..**.* 

1929. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 7, identity: 0.759

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
cgcggtccggcggagcttaccggcgcagc	Protospacer
   ***.***************** . **

1930. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 7, identity: 0.759

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
cgcggtccggcggagcttaccggcacagc	Protospacer
   ***.***************** . **

1931. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 7, identity: 0.759

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
cgcggtccggcggagcttaccggcacagc	Protospacer
   ***.***************** . **

1932. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 7, identity: 0.759

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
cgcggtccggcggagcttaccggcgcagc	Protospacer
   ***.***************** . **

1933. spacer 3.4|3719857|29|NZ_CP017454|PILER-CR matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 7, identity: 0.759

gcgggttcggcggagcttaccggctttgc	CRISPR spacer
gcgggttcggcgaagcttaccgcgtcctt	Protospacer
************.*********  *.. .

1934. spacer 3.5|3719917|29|NZ_CP017454|PILER-CR matches to MN693242 (Marine virus AFVG_25M170, complete genome) position: , mismatch: 7, identity: 0.759

cagataataccttctttacctgtctttct	CRISPR spacer
gaacgtatcccatctttacctgtctttct	Protospacer
 *.   ** ** *****************

1935. spacer 3.2|3719855|32|NZ_CP017454|CRT matches to NZ_CP014126 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcgggttcggcggagcttaccggctttgcc	CRISPR spacer
ggaggggttcggcggagcttagcggcttgccg	Protospacer
  . ***************** ******  * 

1936. spacer 3.3|3719915|32|NZ_CP017454|CRT matches to MN693242 (Marine virus AFVG_25M170, complete genome) position: , mismatch: 8, identity: 0.75

gccagataatacct--tctttacctgtctttctt	CRISPR spacer
--tagaacgtatcccatctttacctgtctttctt	Protospacer
  .***  .**.*.  ******************

1937. spacer 3.5|3719917|29|NZ_CP017454|PILER-CR matches to NC_019401 (Cronobacter phage vB_CsaM_GAP32, complete genome) position: , mismatch: 8, identity: 0.724

cagataataccttctttacctgtctttct	CRISPR spacer
aagataatactttctatacctgtcaagac	Protospacer
 *********.**** ********    .

1938. spacer 3.3|3719915|32|NZ_CP017454|CRT matches to NC_019401 (Cronobacter phage vB_CsaM_GAP32, complete genome) position: , mismatch: 11, identity: 0.656

gccagataataccttctttacctgtctttctt	CRISPR spacer
agaagataatactttctatacctgtcaagacg	Protospacer
.  *********.**** ********    . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 2414 4 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_2 12526 : 14548 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_3 27994 : 29557 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_4 33370 : 33748 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_5 43149 : 47526 3 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_6 56395 : 57172 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_7 61288 : 66295 5 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_8 108324 : 122115 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_9 131409 : 132777 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_10 136512 : 137766 1 Phage_21(100.0%) NA NA
DBSCAN-SWA_11 145334 : 157656 14 Tupanvirus(28.57%) tRNA NA
DBSCAN-SWA_12 161241 : 162369 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_13 166105 : 166867 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_14 171461 : 171671 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_15 177396 : 178950 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_16 183257 : 190865 7 Pandoravirus(33.33%) tRNA NA
DBSCAN-SWA_17 236745 : 248351 8 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_18 259087 : 335451 57 Paramecium_bursaria_Chlorella_virus(16.67%) protease,tRNA,transposase NA
DBSCAN-SWA_19 346075 : 347080 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_20 358497 : 359748 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_21 371794 : 373318 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_22 386600 : 393282 5 Burkholderia_phage(50.0%) protease NA
DBSCAN-SWA_23 399605 : 402596 3 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_24 414922 : 416913 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_25 425875 : 436595 11 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_26 440546 : 441188 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_27 444563 : 445415 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_28 448701 : 451827 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_29 460414 : 466589 7 Phage_NCTB(33.33%) NA NA
DBSCAN-SWA_30 471621 : 473097 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_31 478663 : 490777 12 Bacillus_virus(33.33%) tRNA NA
DBSCAN-SWA_32 496086 : 497817 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_33 516992 : 518609 1 Mamastrovirus(100.0%) NA NA
DBSCAN-SWA_34 536386 : 538135 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_35 560641 : 561541 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_36 567090 : 567705 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_37 571054 : 571339 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_38 575502 : 576588 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_39 580025 : 583355 2 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_40 589872 : 608137 14 uncultured_Mediterranean_phage(20.0%) protease,tRNA NA
DBSCAN-SWA_41 614630 : 616915 3 Agrobacterium_phage(33.33%) NA NA
DBSCAN-SWA_42 621484 : 630753 10 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_43 634671 : 638967 4 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_44 645941 : 646628 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_45 659125 : 664637 5 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_46 676694 : 677552 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_47 687070 : 687646 1 Clostridioides_phage(100.0%) NA NA
DBSCAN-SWA_48 691833 : 704125 11 Vibrio_phage(40.0%) NA NA
DBSCAN-SWA_49 707502 : 707934 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_50 718522 : 720554 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_51 730954 : 731632 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_52 742259 : 742775 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_53 746927 : 747650 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_54 757192 : 759298 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_55 764054 : 764831 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_56 771820 : 786833 13 Brevibacillus_phage(14.29%) NA NA
DBSCAN-SWA_57 792393 : 793428 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_58 802719 : 803640 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_59 810653 : 811937 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_60 822435 : 827080 6 Xanthomonas_phage(25.0%) NA NA
DBSCAN-SWA_61 838958 : 845399 9 Ralstonia_phage(25.0%) NA NA
DBSCAN-SWA_62 868619 : 869564 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_63 872724 : 876751 2 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_64 882075 : 890395 8 Mollivirus(33.33%) NA NA
DBSCAN-SWA_65 902305 : 903202 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_66 907487 : 908447 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_67 913550 : 914528 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_68 919441 : 921235 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_69 938812 : 939616 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_70 945371 : 946163 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_71 962462 : 963875 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_72 969247 : 970054 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_73 982458 : 984586 4 Acinetobacter_phage(66.67%) NA NA
DBSCAN-SWA_74 1004129 : 1004990 1 Pithovirus(100.0%) NA NA
DBSCAN-SWA_75 1010177 : 1010966 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_76 1018960 : 1024271 6 Catovirus(50.0%) NA NA
DBSCAN-SWA_77 1032738 : 1035979 4 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_78 1041232 : 1042282 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_79 1076039 : 1080406 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_80 1085009 : 1086695 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_81 1101010 : 1101910 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_82 1105426 : 1106188 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_83 1118696 : 1120022 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_84 1124557 : 1125706 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_85 1131905 : 1133630 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_86 1140710 : 1149595 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_87 1155672 : 1180682 6 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_88 1185145 : 1195790 4 Paenibacillus_phage(50.0%) NA NA
DBSCAN-SWA_89 1201396 : 1202956 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_90 1217714 : 1220315 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_91 1235762 : 1240745 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_92 1244952 : 1246989 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_93 1252181 : 1253159 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_94 1257965 : 1258451 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_95 1262833 : 1263628 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_96 1268844 : 1272565 4 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_97 1280626 : 1289666 7 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_98 1293236 : 1300056 7 Enterobacteria_phage(60.0%) NA NA
DBSCAN-SWA_99 1308257 : 1316825 6 Moraxella_phage(25.0%) tRNA NA
DBSCAN-SWA_100 1324530 : 1331183 7 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_101 1342472 : 1345504 3 Edwardsiella_phage(33.33%) NA NA
DBSCAN-SWA_102 1365303 : 1370644 5 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_103 1373811 : 1375242 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_104 1378933 : 1384373 3 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_105 1392989 : 1394648 1 Escherichia_phage(100.0%) tRNA NA
DBSCAN-SWA_106 1400144 : 1401809 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_107 1406301 : 1407354 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_108 1413200 : 1417315 3 Planktothrix_phage(50.0%) tRNA NA
DBSCAN-SWA_109 1423599 : 1426156 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_110 1430014 : 1430669 2 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_111 1437933 : 1438647 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_112 1443746 : 1453297 9 Prochlorococcus_phage(40.0%) NA NA
DBSCAN-SWA_113 1480611 : 1496677 10 Hokovirus(20.0%) NA NA
DBSCAN-SWA_114 1509749 : 1515416 5 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_115 1532760 : 1546659 11 Bacillus_phage(28.57%) protease NA
DBSCAN-SWA_116 1558014 : 1558929 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_117 1571403 : 1582156 9 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_118 1588142 : 1599889 8 Bacillus_phage(40.0%) NA NA
DBSCAN-SWA_119 1606782 : 1607883 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_120 1612802 : 1615850 3 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_121 1620262 : 1620988 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_122 1635966 : 1638984 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_123 1653143 : 1655699 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_124 1660571 : 1664726 2 Saccharomonospora_phage(50.0%) NA NA
DBSCAN-SWA_125 1673647 : 1674409 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_126 1689170 : 1689932 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_127 1692933 : 1714267 20 environmental_halophage(12.5%) tRNA NA
DBSCAN-SWA_128 1753233 : 1753956 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_129 1783369 : 1785231 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_130 1789919 : 1790375 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_131 1794901 : 1797240 3 uncultured_Caudovirales_phage(66.67%) NA NA
DBSCAN-SWA_132 1804372 : 1806218 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_133 1813517 : 1815080 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_134 1825611 : 1826265 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_135 1830548 : 1833959 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_136 1839242 : 1850150 10 Dickeya_phage(28.57%) NA NA
DBSCAN-SWA_137 1854441 : 1857234 1 Acanthamoeba_polyphaga_moumouvirus(100.0%) NA NA
DBSCAN-SWA_138 1865917 : 1866868 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_139 1874072 : 1884379 8 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_140 1891392 : 1892928 1 Mannheimia_phage(100.0%) transposase NA
DBSCAN-SWA_141 1896070 : 1896673 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_142 1913887 : 1915435 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_143 1919786 : 1928248 8 Synechococcus_phage(25.0%) NA NA
DBSCAN-SWA_144 1937069 : 1937309 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_145 1958604 : 1960086 1 Ostreococcus_tauri_virus(100.0%) NA NA
DBSCAN-SWA_146 1965779 : 1967420 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_147 1977681 : 1979643 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_148 1983642 : 1986768 2 Moraxella_phage(50.0%) NA NA
DBSCAN-SWA_149 1990264 : 1991350 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_150 1994406 : 2000144 6 Moumouvirus(50.0%) NA NA
DBSCAN-SWA_151 2007092 : 2013342 5 Tupanvirus(25.0%) tRNA NA
DBSCAN-SWA_152 2020076 : 2022950 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_153 2041934 : 2050948 8 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_154 2055394 : 2057290 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_155 2062664 : 2065382 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_156 2070791 : 2072744 1 Ostreococcus_lucimarinus_virus(100.0%) protease NA
DBSCAN-SWA_157 2079605 : 2090379 11 Vibrio_phage(33.33%) tRNA NA
DBSCAN-SWA_158 2099411 : 2102189 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_159 2116825 : 2117779 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_160 2133307 : 2133919 1 Shigella_phage(100.0%) NA NA
DBSCAN-SWA_161 2138798 : 2140789 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_162 2148097 : 2149357 1 Enterobacteria_phage(100.0%) integrase attL 2145190:2145202|attR 2153644:2153656
DBSCAN-SWA_163 2165201 : 2169913 5 Streptococcus_virus(50.0%) NA NA
DBSCAN-SWA_164 2182408 : 2184766 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_165 2192140 : 2200027 8 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_166 2206650 : 2209481 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_167 2214642 : 2215899 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_168 2226616 : 2228317 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_169 2238006 : 2238717 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_170 2246270 : 2248156 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_171 2258583 : 2260137 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_172 2278224 : 2279265 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_173 2282566 : 2295217 10 Cronobacter_phage(33.33%) NA NA
DBSCAN-SWA_174 2300037 : 2301294 1 Stenotrophomonas_phage(100.0%) integrase attL 2291699:2291712|attR 2313508:2313521
DBSCAN-SWA_175 2304376 : 2309321 3 Mycoplasma_phage(50.0%) tRNA NA
DBSCAN-SWA_176 2320669 : 2321605 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_177 2328557 : 2330153 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_178 2334902 : 2337604 2 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_179 2345052 : 2346471 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_180 2354224 : 2363645 7 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_181 2368511 : 2377111 8 Klebsiella_phage(25.0%) NA NA
DBSCAN-SWA_182 2380821 : 2384184 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_183 2391403 : 2391901 1 Pseudomonas_phage(100.0%) protease NA
DBSCAN-SWA_184 2397101 : 2399622 2 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_185 2403753 : 2412683 11 Bacillus_virus(20.0%) NA NA
DBSCAN-SWA_186 2431111 : 2432155 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_187 2444515 : 2445568 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_188 2452069 : 2457212 5 Moraxella_phage(33.33%) NA NA
DBSCAN-SWA_189 2463310 : 2468823 6 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_190 2478582 : 2479254 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_191 2485562 : 2502008 11 Vibrio_phage(20.0%) NA NA
DBSCAN-SWA_192 2511691 : 2512306 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_193 2525317 : 2531678 7 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_194 2553000 : 2558697 5 Bacillus_virus(25.0%) NA NA
DBSCAN-SWA_195 2569077 : 2574740 8 uncultured_Mediterranean_phage(20.0%) NA NA
DBSCAN-SWA_196 2580140 : 2582039 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_197 2591926 : 2592667 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_198 2600818 : 2601076 1 Shigella_phage(100.0%) NA NA
DBSCAN-SWA_199 2617677 : 2621116 3 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_200 2630528 : 2631848 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_201 2635840 : 2636548 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_202 2642400 : 2647772 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_203 2650937 : 2652287 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_204 2657229 : 2658771 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_205 2666151 : 2669054 2 Bacillus_thuringiensis_phage(50.0%) NA NA
DBSCAN-SWA_206 2676814 : 2677594 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_207 2690530 : 2691640 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_208 2696921 : 2697884 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_209 2705032 : 2706712 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_210 2715082 : 2716828 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_211 2730222 : 2731626 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_212 2744411 : 2751969 7 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_213 2765485 : 2769599 3 Tupanvirus(66.67%) NA NA
DBSCAN-SWA_214 2774644 : 2789340 13 Moraxella_phage(16.67%) NA NA
DBSCAN-SWA_215 2802992 : 2806433 2 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_216 2824021 : 2828222 3 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_217 2841427 : 2844262 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_218 2849577 : 2854438 3 Ectocarpus_siliculosus_virus(50.0%) NA NA
DBSCAN-SWA_219 2858651 : 2868074 7 environmental_Halophage(25.0%) tRNA NA
DBSCAN-SWA_220 2890307 : 2894954 5 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_221 2913428 : 2917572 5 Synechococcus_phage(66.67%) NA NA
DBSCAN-SWA_222 2922270 : 2923614 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_223 2928616 : 2930601 2 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_224 2934975 : 2935677 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_225 2956929 : 2959128 3 Dickeya_phage(66.67%) NA NA
DBSCAN-SWA_226 2963142 : 2968996 5 Dickeya_phage(33.33%) NA NA
DBSCAN-SWA_227 2973336 : 2976115 3 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_228 2989215 : 2991038 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_229 2996982 : 3006536 6 Bacillus_phage(20.0%) tail,transposase NA
DBSCAN-SWA_230 3010217 : 3012206 2 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_231 3019537 : 3024275 5 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_232 3035724 : 3036456 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_233 3041795 : 3043673 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_234 3055386 : 3057033 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_235 3072772 : 3074797 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_236 3082754 : 3084487 2 Cafeteria_roenbergensis_virus(50.0%) NA NA
DBSCAN-SWA_237 3088617 : 3092969 4 Catovirus(33.33%) NA NA
DBSCAN-SWA_238 3102653 : 3106862 5 Bodo_saltans_virus(50.0%) NA NA
DBSCAN-SWA_239 3117974 : 3121848 3 Gordonia_phage(50.0%) NA NA
DBSCAN-SWA_240 3127075 : 3128905 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_241 3132393 : 3133476 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_242 3148270 : 3150561 2 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_243 3157929 : 3160377 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_244 3171085 : 3173503 1 Iris_mild_mosaic_virus(100.0%) NA NA
DBSCAN-SWA_245 3184350 : 3192738 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_246 3203683 : 3204511 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_247 3208715 : 3213741 4 Dickeya_phage(50.0%) NA NA
DBSCAN-SWA_248 3219238 : 3226925 5 Ralstonia_phage(25.0%) protease NA
DBSCAN-SWA_249 3231541 : 3233461 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_250 3250338 : 3251109 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_251 3255543 : 3261145 7 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_252 3280093 : 3284415 6 Prochlorococcus_phage(33.33%) tRNA NA
DBSCAN-SWA_253 3298990 : 3302674 1 Dickeya_phage(100.0%) NA NA
DBSCAN-SWA_254 3306201 : 3307242 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_255 3319263 : 3320241 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_256 3325864 : 3326407 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_257 3334029 : 3402504 10 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_258 3420099 : 3421692 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_259 3425714 : 3430962 7 Lake_Baikal_phage(33.33%) NA NA
DBSCAN-SWA_260 3439366 : 3441037 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_261 3448557 : 3450472 2 Powai_lake_megavirus(50.0%) NA NA
DBSCAN-SWA_262 3462599 : 3468122 5 Pithovirus(20.0%) NA NA
DBSCAN-SWA_263 3473144 : 3476801 2 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_264 3482228 : 3486189 3 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_265 3490814 : 3491969 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_266 3507462 : 3508695 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_267 3512990 : 3517047 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_268 3528786 : 3530913 2 Cyanophage(50.0%) NA NA
DBSCAN-SWA_269 3534414 : 3544433 7 Chrysochromulina_ericina_virus(25.0%) tRNA NA
DBSCAN-SWA_270 3548883 : 3550032 1 Halovirus(100.0%) NA NA
DBSCAN-SWA_271 3555564 : 3556047 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_272 3564929 : 3570418 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_273 3574197 : 3575665 2 Brazilian_cedratvirus(50.0%) NA NA
DBSCAN-SWA_274 3580064 : 3582808 3 Micromonas_sp._RCC1109_virus(50.0%) NA NA
DBSCAN-SWA_275 3595944 : 3599882 2 Catovirus(50.0%) NA NA
DBSCAN-SWA_276 3624072 : 3627353 5 Rhizoctonia_fumigata_mycovirus(50.0%) NA NA
DBSCAN-SWA_277 3642311 : 3643736 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_278 3654555 : 3655296 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_279 3664018 : 3666133 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_280 3677970 : 3682280 4 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_281 3696151 : 3696571 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_282 3700544 : 3712147 11 uncultured_phage(20.0%) tail NA
DBSCAN-SWA_283 3722736 : 3727100 3 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_284 3734666 : 3740535 5 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_285 3746285 : 3748726 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_286 3755470 : 3757669 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_287 3760818 : 3761412 1 Euphorbia_ringspot_virus(100.0%) NA NA
DBSCAN-SWA_288 3769862 : 3772346 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_289 3802447 : 3802978 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_290 3807118 : 3808366 1 Klebsiella_phage(100.0%) NA NA
DBSCAN-SWA_291 3813985 : 3821019 7 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_292 3829935 : 3835345 4 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_293 3838829 : 3841863 2 Only_Syngen_Nebraska_virus(50.0%) NA NA
DBSCAN-SWA_294 3849765 : 3850437 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_295 3858173 : 3860244 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_296 3863645 : 3866848 3 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_297 3871510 : 3872542 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_298 3886259 : 3886685 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_299 3896827 : 3898030 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_300 3911983 : 3912715 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_301 3924983 : 3925565 1 Caulobacter_phage(100.0%) NA NA
DBSCAN-SWA_302 3935173 : 3937541 2 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_303 3941873 : 3944422 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_304 3951214 : 3952894 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_305 3958711 : 3960403 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_306 3972784 : 3974293 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_307 3977924 : 3979472 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_308 3982827 : 3991510 8 Escherichia_phage(20.0%) tRNA NA
DBSCAN-SWA_309 4002796 : 4003861 1 Escherichia_coli_O157_typing_phage(100.0%) NA NA
DBSCAN-SWA_310 4009983 : 4012557 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_311 4019273 : 4027613 9 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_312 4031830 : 4036412 6 Mycoplasma_phage(33.33%) NA NA
DBSCAN-SWA_313 4039965 : 4041369 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_314 4044520 : 4050590 3 Moumouvirus(50.0%) NA NA
DBSCAN-SWA_315 4055370 : 4055715 1 Lake_Baikal_phage(100.0%) NA NA
DBSCAN-SWA_316 4059233 : 4060682 1 uncultured_Mediterranean_phage(100.0%) protease NA
DBSCAN-SWA_317 4065146 : 4066139 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_318 4069661 : 4072786 3 Equid_alphaherpesvirus(33.33%) NA NA
DBSCAN-SWA_319 4078675 : 4085457 8 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_320 4089731 : 4091918 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_321 4097026 : 4105196 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_322 4112019 : 4116488 3 Aureococcus_anophage(50.0%) NA NA
DBSCAN-SWA_323 4121054 : 4121846 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_324 4126574 : 4135788 11 Faustovirus(16.67%) NA NA
DBSCAN-SWA_325 4140398 : 4141673 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_326 4146931 : 4149951 2 Indivirus(50.0%) NA NA
DBSCAN-SWA_327 4155318 : 4156320 1 Shigella_phage(100.0%) NA NA
DBSCAN-SWA_328 4160146 : 4161154 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_329 4169833 : 4171546 1 Xanthomonas_phage(100.0%) NA NA
DBSCAN-SWA_330 4185425 : 4190233 4 Phage_TP(50.0%) tRNA NA
DBSCAN-SWA_331 4208902 : 4210960 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_332 4214363 : 4217754 6 uncultured_Caudovirales_phage(25.0%) protease NA
DBSCAN-SWA_333 4225613 : 4227309 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_334 4235531 : 4238097 3 Moumouvirus(50.0%) tRNA NA
DBSCAN-SWA_335 4247177 : 4247960 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_336 4260817 : 4268261 6 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_337 4271294 : 4272509 1 Oenococcus_phage(100.0%) NA NA
DBSCAN-SWA_338 4277625 : 4278735 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_339 4288184 : 4289258 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_340 4298451 : 4299180 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_341 4311994 : 4315237 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_342 4339491 : 4340250 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_343 4348292 : 4361870 4 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_344 4386415 : 4389183 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_345 4409574 : 4411092 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_346 4414458 : 4415232 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_347 4423724 : 4427030 3 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_348 4450496 : 4454829 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_349 4478222 : 4479440 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_350 4490322 : 4491117 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_351 4503335 : 4507211 3 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_352 4520357 : 4537420 2 Paenibacillus_phage(50.0%) NA NA
DBSCAN-SWA_353 4540971 : 4557192 3 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_354 4563864 : 4565091 3 Salmonella_phage(66.67%) holin,lysis NA
DBSCAN-SWA_355 4584138 : 4585615 2 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_356 4598310 : 4599261 1 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_357 4630349 : 4631138 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_358 4636562 : 4638230 1 Catovirus(100.0%) holin NA
DBSCAN-SWA_359 4643732 : 4645397 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_360 4653502 : 4654423 1 Morganella_phage(100.0%) NA NA
DBSCAN-SWA_361 4659157 : 4659400 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_362 4671232 : 4671469 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_363 4674763 : 4676426 2 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_364 4701275 : 4708096 8 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_365 4711235 : 4712687 1 Microcystis_phage(100.0%) NA NA
DBSCAN-SWA_366 4717628 : 4723835 4 Enterobacteria_phage(75.0%) tRNA NA
DBSCAN-SWA_367 4734001 : 4734823 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_368 4744012 : 4745947 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_369 4750302 : 4755179 3 Pandoravirus(50.0%) NA NA
DBSCAN-SWA_370 4763587 : 4766836 3 Indivirus(50.0%) NA NA
DBSCAN-SWA_371 4781505 : 4786451 5 Indivirus(25.0%) NA NA
DBSCAN-SWA_372 4793229 : 4794507 1 Cronobacter_phage(100.0%) tRNA NA
DBSCAN-SWA_373 4801319 : 4801913 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_374 4812194 : 4814126 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_375 4818796 : 4819612 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_376 4849909 : 4905581 47 Salmonella_phage(23.81%) protease,tail,tRNA NA
DBSCAN-SWA_377 4909473 : 4918647 10 Escherichia_phage(62.5%) plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP017455
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017455_1 7461-7540 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP018471 Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence 32851-32884 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KP289281 Pseudomonas sp. EGD-AKN5 plasmid unnamed, complete sequence 90478-90511 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_MN366359 Bacterium plasmid pALTS31, complete sequence 59481-59514 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_001735 Enterobacter aerogenes plasmid R751, complete sequence 15114-15147 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP015373 Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence 20808-20841 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 AGRM01000006 Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence 38663-38696 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 AJ863570 Uncultured bacterium IncP-1beta multiresistance plasmid pB8 9128-9161 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 KU238092 Uncultured bacterium plasmid pDTC28, complete sequence 46402-46435 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 JN106172 Uncultured bacterium plasmid pAKD29, complete sequence 40881-40914 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_004956 Pseudomonas sp. ADP atrazine catabolic plasmid pADP-1, complete sequence 90478-90511 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 JN106164 Uncultured bacterium plasmid pAKD1, complete sequence 58135-58168 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 JN106169 Uncultured bacterium plasmid pAKD18, complete sequence 42023-42056 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP026230 Aeromonas sp. ASNIH1 plasmid pKPC-038c, complete sequence 62770-62803 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_014911 Alicycliphilus denitrificans BC plasmid pALIDE02, complete sequence 44978-45011 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN386974 Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence 50407-50440 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_016978 Comamonas testosteroni plasmid pI2, complete sequence 68487-68520 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MG879028 Uncultured bacterium plasmid pEG1-1, complete sequence 15422-15455 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP021650 Acidovorax sp. T1 plasmid p2-T1, complete sequence 24539-24572 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 KF743817 Proteus mirabilis plasmid R772, complete sequence 40975-41008 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 KF743818 Bordetella bronchiseptica plasmid R906, complete sequence 43193-43226 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 JX486125 Uncultured bacterium plasmid pRWC72a, complete sequence 61808-61841 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP019238 Rhodoferax koreense strain DCY-110 plasmid unnamed2 24486-24519 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 AJ639924 Uncultured bacterium plasmid pB3 complete genome 1380-1413 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 KC170279 Uncultured bacterium plasmid pMBUI8, complete sequence 53202-53235 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 KU356987 Variovorax paradoxus plasmid pBS64, complete sequence 58634-58667 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 KU356988 Variovorax paradoxus plasmid pHB44, complete sequence 57339-57372 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP009797 Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence 393-426 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_019312 Delftia sp. KV29 plasmid pKV29, complete sequence 1299-1332 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP017455 Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence 7484-7517 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_021077 Comamonas sp. 7D-2 plasmid pBHB, complete sequence 78343-78376 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_024998 Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83 47406-47439 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_MN366358 Bacterium plasmid pALTS29, complete sequence 54288-54321 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_005088 Delftia acidovorans B plasmid pUO1, complete sequence 16818-16851 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_008385 Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence 2454-2487 0 1.0
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KJ588780 Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence 49693-49726 1 0.971
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_008459 Bordetella pertussis plasmid pBP136 DNA, complete sequence 9414-9447 1 0.971
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_MH053445 Pseudomonas aeruginosa strain PA1280 plasmid pICP-4GES, complete sequence 1310-1343 1 0.971
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP034651 Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence 16614-16647 2 0.941
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_001735 Enterobacter aerogenes plasmid R751, complete sequence 39318-39351 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP015373 Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence 45128-45161 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 AGRM01000006 Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence 14164-14197 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 AJ863570 Uncultured bacterium IncP-1beta multiresistance plasmid pB8 33912-33945 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 KU238092 Uncultured bacterium plasmid pDTC28, complete sequence 18091-18124 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 JN106172 Uncultured bacterium plasmid pAKD29, complete sequence 16559-16592 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 JN106164 Uncultured bacterium plasmid pAKD1, complete sequence 29890-29923 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 JN106169 Uncultured bacterium plasmid pAKD18, complete sequence 17722-17755 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_014911 Alicycliphilus denitrificans BC plasmid pALIDE02, complete sequence 305-338 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN386974 Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence 25914-25947 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MG879028 Uncultured bacterium plasmid pEG1-1, complete sequence 49946-49979 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 KF743817 Proteus mirabilis plasmid R772, complete sequence 16652-16685 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 KF743818 Bordetella bronchiseptica plasmid R906, complete sequence 18870-18903 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 JX486125 Uncultured bacterium plasmid pRWC72a, complete sequence 28447-28480 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 AJ639924 Uncultured bacterium plasmid pB3 complete genome 33627-33660 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_021077 Comamonas sp. 7D-2 plasmid pBHB, complete sequence 102677-102710 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_024998 Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83 21659-21692 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_MN366358 Bacterium plasmid pALTS29, complete sequence 30368-30401 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_005088 Delftia acidovorans B plasmid pUO1, complete sequence 44367-44400 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KJ588780 Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence 21379-21412 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_MH053445 Pseudomonas aeruginosa strain PA1280 plasmid pICP-4GES, complete sequence 32872-32905 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 1045116-1045149 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 599293-599326 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_017908 Mycobacterium abscessus subsp. bolletii F1725 plasmid BRA100, complete sequence 19095-19128 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 JX469834 Uncultured bacterium plasmid pDS3, complete sequence 16721-16754 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 JX469831 Uncultured bacterium plasmid pKSP212, complete sequence 23560-23593 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 JN106173 Uncultured bacterium plasmid pAKD31, complete sequence 17737-17770 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 JN106174 Uncultured bacterium plasmid pAKD33, complete sequence 17740-17773 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 JN106165 Uncultured bacterium plasmid pAKD14, complete sequence 17737-17770 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 JN106166 Uncultured bacterium plasmid pAKD15, complete sequence 17737-17770 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 JN106168 Uncultured bacterium plasmid pAKD17, complete sequence 17737-17770 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP021356 Rhodococcus sp. S2-17 plasmid pRB29, complete sequence 36613-36646 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP038640 Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence 52092-52125 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_019320 Variovorax sp. DB1 plasmid pDB1, complete sequence 51166-51199 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_007337 Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence 73585-73618 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP032995 Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence 11850-11883 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP050860 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence 86244-86277 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KX832927 Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence 70997-71030 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KY399978 Vibrio cholerae O139 strain ICDC-211 plasmid pVC211, complete sequence 36080-36113 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KY986974 Citrobacter freundii strain 112298 plasmid p112298-tetA, complete sequence 20276-20309 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_MF133496 Klebsiella pneumoniae strain 675920 plasmid p675920-2, complete sequence 13722-13755 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP028541 Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence 166271-166304 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP034785 Escherichia coli strain ECZP248 plasmid pTBMCR401, complete sequence 97072-97105 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP034786 Escherichia coli strain ECZP248 plasmid pTB402, complete sequence 39042-39075 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MF399199 Acinetobacter baumannii strain D46 plasmid pD46-4, complete sequence 77874-77907 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MF679146 Escherichia coli plasmid pBJ114-141, complete sequence 47763-47796 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MF679147 Escherichia coli plasmid pBJ114T-190, complete sequence 96080-96113 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP009414 Salmonella enterica strain CFSAN007428 isolate N11150 plasmid pCFSAN007428_01, complete sequence 23129-23162 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KX443408 Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence 32690-32723 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KU321583 Escherichia coli strain E80 plasmid pE80, complete sequence 9431-9464 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KX815983 Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence 111201-111234 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KT997783 Escherichia coli strain Y5 plasmid pECY53, complete sequence 38205-38238 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KU302802 Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence 42216-42249 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 187940-187973 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KX029331 Klebsiella pneumoniae strain K-109-R plasmid unnamed, complete sequence 41395-41428 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KU302801 Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence 42216-42249 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP028537 Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence 157646-157679 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP028537 Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence 248847-248880 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP028537 Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence 287260-287293 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP035548 Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_IncA/C2, complete sequence 20279-20312 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP009412 Salmonella enterica strain CFSAN007426 isolate N19767 plasmid pCFSAN007426_01, complete sequence 22244-22277 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP009411 Salmonella enterica strain CFSAN007425 isolate 22697 plasmid pCFSAN007425_01, complete sequence 21416-21449 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP009413 Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence 132056-132089 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KJ909290 Aeromonas salmonicida subsp. salmonicida strain 2004-05MF26 plasmid pSN254b, complete sequence 20243-20276 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KM083064 Vibrio cholerae strain ICDC-1447 plasmid pVC1447, complete sequence 20357-20390 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KP893385 Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence 55903-55936 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KR559888 Klebsiella pneumoniae strain Kpn642 plasmid pKP-Gr642, complete sequence 21417-21450 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KR559889 Klebsiella pneumoniae strain Kpn8143 plasmid pKP-Gr8143, complete sequence 21417-21450 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KT818627 Klebsiella pneumoniae strain U25 plasmid U25P002, complete sequence 106109-106142 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KR091911 Salmonella enterica subsp. enterica serovar Corvallis strain RH-1238 plasmid pRH-1238, complete sequence 178768-178801 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KP276584 Escherichia coli strain 39R861 plasmid p39R861-4, complete sequence 134513-134546 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KT990220 Escherichia coli strain 42-2 plasmid p42-2, complete sequence 7195-7228 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KP056256 Escherichia coli strain YDC637 plasmid pYDC637, complete sequence 20300-20333 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 LT221038 Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence 53837-53870 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP028197 Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence 171086-171119 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP028197 Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence 190636-190669 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP028197 Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence 293649-293682 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP032391 Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence 134019-134052 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP026133 Klebsiella pneumoniae strain F5 plasmid pF5_1, complete sequence 92694-92727 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP011601 Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence 167256-167289 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP011601 Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence 186806-186839 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP017987 Klebsiella pneumoniae strain 825795-1 plasmid unnamed2, complete sequence 57685-57718 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_AP023191 Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence 109117-109150 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP028975 Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence 178985-179018 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP028975 Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence 331067-331100 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 214727-214760 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP045742 Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence 63928-63961 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 282132-282165 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP044256 Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence 111838-111871 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_009651 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN5, complete sequence 22775-22808 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP048305 Escherichia coli strain 9 plasmid p009_A, complete sequence 23659-23692 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP026131 Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence 261-294 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP025240 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE3-1928, complete sequence 21417-21450 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP025242 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1929 plasmid pSNE1-1929, complete sequence 21122-21155 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP045264 Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence 118007-118040 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP024192 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed1, complete sequence 31991-32024 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP044294 Escherichia coli strain P276M plasmid p276M-CTX-M-55, complete sequence 58694-58727 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP019272 Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence 7743-7776 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 205573-205606 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 212418-212451 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_010886 Klebsiella pneumoniae plasmid pK245, complete sequence 58622-58655 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_012886 Escherichia coli plasmid pRAx, complete sequence 41507-41540 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP027679 Salmonella enterica subsp. enterica serovar Corvallis strain 12-01738 plasmid pSE12-01738-2, complete sequence 168181-168214 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP033962 Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence 124914-124947 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP017059 Citrobacter freundii strain SL151 plasmid unnamed2, complete sequence 41296-41329 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP026241 Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-e790, complete sequence 174670-174703 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP033394 Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence 47479-47512 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN539018 Salmonella sp. strain OYZ4 plasmid pOYZ4, complete sequence 27710-27743 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_LS992184 Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence 6612-6645 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_LS992184 Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence 174690-174723 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 84659-84692 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_KJ187752 Klebsiella pneumoniae strain 7433 plasmid pTR2, complete sequence 87722-87755 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP018716 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-2, complete sequence 48114-48147 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP018722 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-2, complete sequence 5340-5373 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP018704 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-2, complete sequence 30343-30376 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP029249 Salmonella enterica subsp. enterica serovar Thompson strain HFCDC-SM-846 plasmid p846, complete sequence 137808-137841 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 131299-131332 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 138144-138177 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN543573 Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence 122035-122068 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_008612 Photobacterium damselae subsp. piscicida plasmid pP99-018, complete sequence 14027-14060 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_010119 Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pOU7519, complete sequence 88653-88686 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP033957 Klebsiella pneumoniae strain L39_2 plasmid p4_L39, complete sequence 6309-6342 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP047093 Salmonella sp. S13 plasmid pS13-4, complete sequence 6370-6403 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP034739 Escherichia coli strain L65 plasmid pL65-2, complete sequence 97051-97084 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MT077884 Escherichia coli plasmid p33, complete sequence 140813-140846 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MT077884 Escherichia coli plasmid p33, complete sequence 254004-254037 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MT077886 Escherichia coli plasmid p39, complete sequence 223879-223912 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MT077886 Escherichia coli plasmid p39, complete sequence 240137-240170 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP022359 Shewanella bicestrii strain JAB-1 plasmid pSHE-CTX-M, complete sequence 164709-164742 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP051432 Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence 12108-12141 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_LT904892 Salmonella enterica subsp. enterica serovar Typhi strain 80-2002 plasmid 2 133516-133549 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP048293 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence 46940-46973 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP048293 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence 66490-66523 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP029802 Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_90k, complete sequence 40616-40649 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP027038 Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence 124850-124883 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP036362 Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence 53496-53529 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN423361 Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence 220769-220802 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN423361 Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence 236727-236760 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MT066418 Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence 5870-5903 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP012682 Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33676_IncA/C, complete sequence 112477-112510 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 CP045559 Citrobacter sp. S39 plasmid pS39-4, complete sequence 14717-14750 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP025952 Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence 92618-92651 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP019260 Escherichia coli strain 13C1065T plasmid p13C1065T-1, complete sequence 163479-163512 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP047128 Escherichia coli K-12 plasmid pT-HNK130-3, complete sequence 66353-66386 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP031549 Escherichia coli strain cq9 plasmid unnamed3, complete sequence 178854-178887 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP032385 Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_1, complete sequence 69593-69626 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP032388 Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_1, complete sequence 109085-109118 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP036372 Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence 161525-161558 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP012007 Acinetobacter baumannii strain Ab04-mff plasmid pAB04-1, complete sequence 118285-118318 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP020856 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-3, complete sequence 46047-46080 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MK312245 Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence 108514-108547 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MK312248 Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence 109574-109607 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN175387 Klebsiella pneumoniae strain KP-14-6 plasmid pKP-14-6-NDM-1, complete sequence 31214-31247 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN086777 Escherichia coli plasmid p16EC-p0111, complete sequence 63779-63812 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN891681 Klebsiella pneumoniae strain 14899 plasmid p14899-KPC, complete sequence 37485-37518 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN891684 Klebsiella pneumoniae strain BJ107 plasmid pBJ107-KPC, complete sequence 11612-11645 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN891686 Klebsiella pneumoniae strain ZZ58 plasmid pZZ58-KPC, complete sequence 9865-9898 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 266586-266619 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP053046 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence 11154-11187 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP014978 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 plasmid pSTY1-1896, complete sequence 22133-22166 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_008613 Photobacterium damselae subsp. piscicida plasmid pP91278, complete sequence 6469-6502 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 CM019853 Escherichia coli strain CVM N17EC0326 plasmid pN17EC0326-3, complete sequence, whole genome shotgun sequence 23783-23816 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 CM019853 Escherichia coli strain CVM N17EC0326 plasmid pN17EC0326-3, complete sequence, whole genome shotgun sequence 34189-34222 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP031568 Enterobacter hormaechei strain 2013_1a plasmid pSHV12-1301491, complete sequence 10138-10171 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP031568 Enterobacter hormaechei strain 2013_1a plasmid pSHV12-1301491, complete sequence 29687-29720 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP031564 Klebsiella pneumoniae strain 2-1 plasmid pKP21AC2, complete sequence 54762-54795 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP032397 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence 319358-319391 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP027055 Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2 124854-124887 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP035774 Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence 24468-24501 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN254970 Escherichia coli strain EC009 plasmid pEC009.1, complete sequence 20279-20312 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MK312241 Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence 117187-117220 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP014658 Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 plasmid pSAN1-1736, complete sequence 21417-21450 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP006665 Edwardsiella anguillarum ET080813 strain 80813 plasmid 1, complete sequence 17695-17728 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP035381 Leclercia adecarboxylata strain R25 plasmid pLA-64, complete sequence 63607-63640 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP043190 Escherichia coli O16:H48 strain PG20180175 plasmid pPG20180175.1-IncAC2, complete sequence 90086-90119 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP044142 Escherichia coli O157 strain AR-0429 plasmid pAR-0429-1, complete sequence 110726-110759 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP025231 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1924 plasmid pSNE1-1924, complete sequence 21417-21450 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP044306 Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence 68979-69012 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP028179 Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_3, complete sequence 19119-19152 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP039562 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014847 plasmid p08-5333.1, complete sequence 109773-109806 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP037964 Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence 112965-112998 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP038330 Escherichia coli O157:H7 strain NE 1092-2 plasmid pNE1092-3, complete sequence 55251-55284 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP038326 Escherichia coli O157:H7 strain NE 1169-1 plasmid pNE1169-3, complete sequence 2975-3008 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP041083 Klebsiella pneumoniae strain Kp202 plasmid pKp202_1, complete sequence 20243-20276 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP043215 Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.1-IncAC2, complete sequence 90086-90119 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP027855 Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-3, complete sequence 11140-11173 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 CP052417 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-3, complete sequence 1184-1217 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP038322 Escherichia coli O157:H7 strain NE1127 plasmid pNE1127-2, complete sequence 32767-32800 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_016974 Providencia stuartii plasmid pMR0211, complete sequence 21416-21449 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP041376 Klebsiella pneumoniae strain KP58 plasmid pKP58-3, complete sequence 48893-48926 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN310369 Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-Ct1/2, complete sequence 20279-20312 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN310370 Klebsiella pneumoniae strain 11935 plasmid p11935-Ct1/2, complete sequence 20279-20312 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP021956 Klebsiella pneumoniae strain AR_0107 plasmid unitig_1_pilon, complete sequence 128848-128881 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP009560 Salmonella enterica subsp. enterica serovar Newport str. CVM 22425 plasmid pCVM22425, complete sequence 113554-113587 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP034324 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence 261-294 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP034326 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence 74803-74836 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP022697 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-2, complete sequence 44148-44181 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP040547 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence 115534-115567 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_022372 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pYT3 DNA, complete sequence 10951-10984 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP032243 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed3, complete sequence 81892-81925 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP047878 Escherichia coli strain LD22-1 plasmid pLD22-1-135kb, complete sequence 72088-72121 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP039820 Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence 160756-160789 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP046718 Escherichia coli strain T16R plasmid pT16R-2, complete sequence 81763-81796 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 CP052554 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-3, complete sequence 70574-70607 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP041177 Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence 103464-103497 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 LC511657 Escherichia coli 2017.02.01CC plasmid p2017.02.01CC DNA, complete genome 110104-110137 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP041641 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MCR1, complete sequence 72932-72965 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP044215 Klebsiella aerogenes strain KA_P10_L5_03.19 plasmid pIMPIncH12_334kb, complete sequence 307348-307381 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP044259 Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence 104828-104861 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP026753 Klebsiella pneumoniae strain AR_0066 plasmid tig00000084_pilon, complete sequence 14475-14508 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP009562 Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 plasmid pCVM22513, complete sequence 78788-78821 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP031802 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence 50545-50578 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP034761 Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence 56536-56569 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP021168 Enterobacter hormaechei strain 388 plasmid p388, complete sequence 11968-12001 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP045517 Salmonella enterica subsp. enterica serovar Anatum strain Sal-4737 plasmid pSal-4737_DHA, complete sequence 21087-21120 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP045520 Salmonella enterica subsp. enterica serovar Anatum strain Sal-5091 plasmid pSal-5091_DHA, complete sequence 40616-40649 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP045462 Salmonella enterica subsp. enterica serovar Anatum strain M-3851 plasmid pM-3851_DHA, complete sequence 40616-40649 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP045467 Salmonella enterica subsp. enterica serovar Anatum strain Sal-3973 plasmid pSal-3973_DHA_CMY, complete sequence 145965-145998 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP045510 Salmonella enterica subsp. enterica serovar Anatum strain M-5360 plasmid pM-5360_DHA, complete sequence 25187-25220 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP050707 Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence 27759-27792 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 CP038003 Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence 101596-101629 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP006029 Escherichia coli O145:H28 str. RM13514 plasmid pRM13514, complete sequence 43525-43558 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP050416 Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence 149345-149378 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_AP019676 Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-1, complete sequence 77654-77687 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP038464 Aeromonas hydrophila strain WCX23 plasmid unnamed, complete sequence 113002-113035 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP027043 Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence 186986-187019 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP007137 Escherichia coli O145:H28 str. RM12581 plasmid pRM12581, complete sequence 43526-43559 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 276378-276411 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP038468 Citrobacter sp. SNU WT2 plasmid unnamed1, complete sequence 45907-45940 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP040807 Escherichia fergusonii strain EFCF056 plasmid pEF02, complete sequence 23338-23371 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP040809 Escherichia fergusonii strain EFCF056 plasmid pEF04, complete sequence 14649-14682 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP040810 Escherichia fergusonii strain EFCF056 plasmid pEF05, complete sequence 38451-38484 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_009140 Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence 21417-21450 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_011092 Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 plasmid pCVM19633_110, complete sequence 80419-80452 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP010168 Escherichia coli strain H3 plasmid A, complete genome 8098-8131 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP017086 Proteus mirabilis strain T18 plasmid pT18, complete sequence 25630-25663 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP024824 Escherichia coli strain CREC-591 plasmid pCREC-591_3, complete sequence 51122-51155 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP024857 Escherichia coli strain AR_0011 plasmid tig00001069_pilon, complete sequence 58092-58125 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP035277 Citrobacter freundii strain R17 plasmid pCFR17_1, complete sequence 84653-84686 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP036180 Escherichia coli strain WCHEC025970 plasmid p1_025970, complete sequence 46214-46247 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP036306 Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence 101597-101630 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP021163 Enterobacter hormaechei strain 234 plasmid p234, complete sequence 52496-52529 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP024157 Escherichia coli strain 14EC047 plasmid p14EC047b, complete sequence 62274-62307 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP038466 Aeromonas hydrophila strain 23-C-23 plasmid unnamed, complete sequence 74178-74211 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP050426 Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence 149345-149378 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_021667 Klebsiella pneumoniae plasmid IncA/C-LS6, complete sequence 46998-47031 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 CP040054 Acinetobacter baumannii strain VB35179 plasmid unnamed1, complete sequence 180466-180499 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP030186 Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence 214514-214547 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 CP028790 Klebsiella pneumoniae strain WCHKP020030 plasmid pKPC2_020030, complete sequence 93565-93598 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 CP043753 Escherichia coli strain CVM N56639 plasmid pN56639, complete sequence 6660-6693 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 200511-200544 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP050433 Acinetobacter baumannii strain PM194229 plasmid pPM194229_1, complete sequence 225354-225387 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP050386 Acinetobacter baumannii strain VB82 plasmid pVB82_1, complete sequence 187960-187993 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 105149-105182 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP040696 Citrobacter freundii strain R47 plasmid pR47-309, complete sequence 178135-178168 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP040696 Citrobacter freundii strain R47 plasmid pR47-309, complete sequence 216548-216581 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP040697 Citrobacter freundii strain R47 plasmid pR47-54, complete sequence 53152-53185 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 133161-133194 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_017645 Escherichia coli UMNK88 plasmid pUMNK88, complete sequence 21417-21450 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP009567 Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCFSAN000934_02, complete sequence 55443-55476 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP008899 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-8a4, complete sequence 210931-210964 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP048380 Klebsiella variicola strain 118 plasmid p118_A, complete sequence 5906-5939 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP007636 Vibrio cholerae strain 2012EL-2176 plasmid unnamed, complete sequence 40309-40342 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 CP052289 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-3, complete sequence 29800-29833 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_AP019668 Klebsiella pneumoniae strain TA6363 plasmid pTMTA63633, complete sequence 7953-7986 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_012690 Escherichia coli plasmid peH4H, complete sequence 21417-21450 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP042552 Enterobacter hormaechei strain C45 plasmid pC45_001, complete sequence 239591-239624 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP019074 Escherichia coli strain CRE1493 plasmid p1493-3, complete sequence 58412-58445 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP047195 Klebsiella pneumoniae strain Kp36 plasmid unnamed3, complete sequence 13514-13547 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 228644-228677 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP032238 Escherichia coli strain ECCWS199 plasmid pTB221, complete sequence 22167-22200 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP032239 Escherichia coli strain ECCWS199 plasmid pTB222, complete sequence 90268-90301 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP016526 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence 177828-177861 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_006856 Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 plasmid pSC138, complete sequence 47558-47591 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP028931 Klebsiella pneumoniae strain AR_0153 plasmid unnamed3, complete sequence 58772-58805 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP031575 Enterobacter hormaechei strain A1 plasmid pIncHI2-1502264, complete sequence 63281-63314 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP010243 Escherichia coli strain S56 plasmid A, complete sequence 261-294 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP024557 Klebsiella pneumoniae strain INF164 plasmid unnamed1, complete sequence 31991-32024 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP034322 Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence 22489-22522 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP025233 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 plasmid pSNE1-1925, complete sequence 40979-41012 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 173270-173303 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP041172 Salmonella enterica subsp. enterica serovar Thompson strain SH11G0791 plasmid pSH11G0791, complete sequence 63349-63382 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP017633 Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence 56527-56560 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP011617 Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence 5693-5726 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP039170 Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence 133837-133870 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP039170 Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence 180533-180566 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 CP042971 Escherichia coli strain CFSAN061769 plasmid pCFSAN061769_02, complete sequence 11644-11677 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP024529 Klebsiella pneumoniae strain INF157 plasmid unnamed1, complete sequence 31991-32024 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP025458 Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence 44888-44921 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP016919 Klebsiella pneumoniae isolate 11 plasmid pIncR_DHQP1300920, complete sequence 18681-18714 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP018457 Shewanella algae strain CCU101 plasmid unnamed, complete sequence 68602-68635 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP034677 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence 66087-66120 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 CP050155 Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence 46019-46052 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MF918372 Klebsiella pneumoniae plasmid p1512-KPC, complete sequence 57827-57860 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP041112 Escherichia coli strain ECCTRSRTH03 plasmid unnamed2, complete sequence 45873-45906 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP017930 Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence 111403-111436 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP016013 Salmonella enterica subsp. enterica serovar Newport strain CFSAN003890 plasmid pCFSAN003890, complete sequence 36597-36630 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP032491 Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence 4757-4790 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP032496 Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_IncA/C2, complete sequence 20279-20312 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP024459 Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence 82285-82318 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP024522 Klebsiella pneumoniae strain INF158 plasmid unnamed1, complete sequence 31991-32024 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP047577 Escherichia coli strain 94EC plasmid p94EC-1, complete sequence 107396-107429 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 221516-221549 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_019065 Escherichia coli plasmid pPG010208, complete sequence 26261-26294 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_019066 Escherichia coli plasmid pAPEC1990_61, complete sequence 21417-21450 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP029382 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pQnrS1_020079, complete sequence 1881-1914 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP042586 Escherichia coli strain LD91-1 plasmid pLD91-1-146kb, complete sequence 78353-78386 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 CP028804 Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence 20279-20312 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP026141 Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence 65811-65844 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP026147 Klebsiella pneumoniae strain F132 plasmid pF132_2, complete sequence 24552-24585 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP026152 Klebsiella pneumoniae strain F138 plasmid pF138_3, complete sequence 62203-62236 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP019001 Escherichia coli strain Ecol_AZ155 plasmid pECAZ155_KPC, complete sequence 146132-146165 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP040541 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence 166340-166373 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP043927 Klebsiella quasipneumoniae subsp. quasipneumoniae strain M17277 plasmid p17277A_477, complete sequence 212371-212404 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP043927 Klebsiella quasipneumoniae subsp. quasipneumoniae strain M17277 plasmid p17277A_477, complete sequence 434706-434739 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP044075 Providencia stuartii strain FDAARGOS_645 plasmid unnamed1, complete sequence 173053-173086 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP026137 Klebsiella pneumoniae strain F77 plasmid pF77_1, complete sequence 18096-18129 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP035669 Edwardsiella piscicida strain MS-18-199 plasmid pEP-MS-18-199, complete sequence 18488-18521 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP025275 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1923 plasmid pSNE2-1923 59978-60011 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP025275 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1923 plasmid pSNE2-1923 117654-117687 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP040362 Klebsiella pneumoniae strain R50 plasmid pR50-74, complete sequence 8998-9031 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP045016 Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-1, complete sequence 31664-31697 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP025677 Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence 28888-28921 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP047161 Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence 115995-116028 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP012170 Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence 138431-138464 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP012170 Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence 157981-158014 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP030283 Escherichia coli strain E308 plasmid pLKSZ02, complete sequence 79943-79976 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN823990 Klebsiella pneumoniae strain 120314013 plasmid p314013-FII, complete sequence 40381-40414 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP028582 Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence 61910-61943 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 CP028419 Aeromonas hydrophila strain WCX23 plasmid pWCX23_1, complete sequence 72555-72588 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP026578 Escherichia coli strain WCHEC005237 plasmid pQnrS1_005237, complete sequence 86164-86197 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP044962 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014881 plasmid pPNCS014881.1, complete sequence 21095-21128 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP024550 Klebsiella pneumoniae strain INF163 plasmid unnamed1, complete sequence 31991-32024 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP018318 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-2, complete sequence 80832-80865 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP032212 Klebsiella pneumoniae strain AR_0109 plasmid unnamed6, complete sequence 30975-31008 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP036366 Klebsiella pneumoniae strain WCHKP115068 plasmid pCTXM65_115068, complete sequence 35883-35916 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP037959 Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence 109293-109326 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP037959 Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence 155989-156022 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN865122 Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence 85840-85873 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN842292 Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence 26196-26229 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN842295 Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence 57808-57841 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN823987 Escherichia coli strain 2016061604 plasmid p6061604-KPC, complete sequence 5530-5563 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP052879 Escherichia coli strain C21 plasmid pC21-2, complete sequence 41073-41106 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 KR827392 Uncultured bacterium plasmid pKAZ3, complete sequence 18677-18710 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 CP016403 Klebsiella pneumoniae subsp. pneumoniae strain F5 plasmid pF5, complete sequence 25883-25916 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP028782 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pQnrB52_020046, complete sequence 59051-59084 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP011596 Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence 5693-5726 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP021712 Klebsiella pneumoniae strain AR_0143 plasmid tig00000857, complete sequence 45405-45438 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP047667 Escherichia coli strain LD26-1 plasmid pLD26-1-135kb, complete sequence 1245-1278 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 154834-154867 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP039861 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence 56418-56451 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP033379 Escherichia coli strain L73 plasmid pL73-2, complete sequence 82203-82236 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP025236 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1926 plasmid pSNE2-1926, complete sequence 21122-21155 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP013215 Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence 128465-128498 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP013215 Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence 283244-283277 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP009570 Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 isolate CFSAN000926 plasmid pCVMN1543, complete sequence 51745-51778 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP009564 Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 plasmid pCVM21550, complete sequence 78384-78417 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP009563 Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 plasmid pCVM21538, complete sequence 940-973 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP027144 Enterobacter hormaechei subsp. hoffmannii strain AR_0365 plasmid unnamed1, complete sequence 9602-9635 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP027144 Enterobacter hormaechei subsp. hoffmannii strain AR_0365 plasmid unnamed1, complete sequence 29152-29185 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP021946 Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence 83856-83889 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP028480 Klebsiella pneumoniae strain 2e plasmid unnamed2 51473-51506 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_012556 Enterobacter cloacae plasmid pEC-IMPQ, complete sequence 257420-257453 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_012556 Enterobacter cloacae plasmid pEC-IMPQ, complete sequence 276970-277003 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_012555 Enterobacter cloacae plasmid pEC-IMP, complete sequence 251699-251732 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_012555 Enterobacter cloacae plasmid pEC-IMP, complete sequence 271249-271282 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP027067 Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence 108829-108862 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP041209 Salmonella enterica subsp. enterica serovar Newport strain SAP18-8729 plasmid pCFSAN074384_1, complete sequence 123165-123198 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP042579 Enterobacter kobei strain C16 plasmid pC16_001, complete sequence 216634-216667 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP031106 Escherichia coli strain AMSCJX02 plasmid pAMSC1, complete sequence 88292-88325 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP034126 Klebsiella pneumoniae strain BJCFK909 plasmid p3s1, complete sequence 84730-84763 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP025578 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_2, complete sequence 78729-78762 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP006801 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p3, complete sequence 32812-32845 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP020596 Acinetobacter baumannii strain HWBA8 plasmid pHWBA8_1, complete sequence 11698-11731 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP020596 Acinetobacter baumannii strain HWBA8 plasmid pHWBA8_1, complete sequence 170745-170778 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP048776 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence 109293-109326 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP011611 Citrobacter freundii strain CAV1321 plasmid pKPC_CAV1321-244, complete sequence 47290-47323 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP018689 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-2, complete sequence 55342-55375 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_019107 Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_174, complete sequence 27059-27092 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_019116 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH163_135, complete sequence 23136-23169 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_019118 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH696_135, complete sequence 23076-23109 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_019121 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_166, complete sequence 147563-147596 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP035209 Klebsiella quasipneumoniae strain TH114 plasmid pTH114-1, complete sequence 45327-45360 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP019053 Escherichia coli strain CRE1540 plasmid p1540-2, complete sequence 21190-21223 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP048027 Escherichia coli strain GZEC065 plasmid pTET-GZEC065, complete sequence 45713-45746 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP029743 Escherichia coli strain AR_0085 plasmid unnamed2, complete sequence 70269-70302 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 MN419308 Klebsiella pneumoniae strain 12478 plasmid p12478-rmtB, complete sequence 51909-51942 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP040260 Acinetobacter baumannii strain P7774 plasmid unnamed1, complete sequence 78627-78660 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_AP023198 Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence 109117-109150 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP041631 Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence 12122-12155 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP049193 Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence 105003-105036 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP049193 Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence 246898-246931 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP050812 Yokenella regensburgei strain W13 plasmid pYRW13-125, complete sequence 21295-21328 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_012692 Escherichia coli plasmid pAR060302, complete sequence 23105-23138 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NC_012693 Salmonella enterica plasmid pAM04528, complete sequence 21417-21450 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP032842 Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence 120608-120641 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP018341 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-4, complete sequence 55635-55668 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP024564 Klebsiella pneumoniae strain INF278 plasmid unnamed1, complete sequence 31991-32024 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP014775 Aeromonas veronii strain AVNIH1 plasmid pASP-a58, complete sequence 123923-123956 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP049189 Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence 125729-125762 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP049189 Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence 287199-287232 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 CP050283 Klebsiella pneumoniae strain 9949 plasmid unnamed3, complete sequence 34246-34279 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP025340 Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p220k, complete sequence 184207-184240 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP025245 Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0663 isolate USDA-ARS-USMARC-1936 plasmid pSNE2-2012K-0663, complete sequence 21122-21155 7 0.794
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 509669-509702 8 0.765
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 416136-416169 8 0.765
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 AP018709 Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence 25652-25685 8 0.765
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP015091 Pelagibaca abyssi strain JLT2014 plasmid pPABY1, complete sequence 15240-15273 9 0.735
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP018471 Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence 57386-57419 10 0.706
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP013856 Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence 32567-32600 10 0.706
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 594556-594589 10 0.706
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP010991 Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence 39548-39581 10 0.706
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP012186 Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence 166761-166794 10 0.706
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1191841-1191874 10 0.706
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1857368-1857401 11 0.676
NZ_CP017455_1 1.1|7484|34|NZ_CP017455|CRISPRCasFinder 7484-7517 34 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 144910-144943 11 0.676

1. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

2. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KP289281 (Pseudomonas sp. EGD-AKN5 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

3. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_MN366359 (Bacterium plasmid pALTS31, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

4. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

5. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

6. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

7. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

8. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to KU238092 (Uncultured bacterium plasmid pDTC28, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

9. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

10. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_004956 (Pseudomonas sp. ADP atrazine catabolic plasmid pADP-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

11. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

12. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

13. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP026230 (Aeromonas sp. ASNIH1 plasmid pKPC-038c, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

14. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_014911 (Alicycliphilus denitrificans BC plasmid pALIDE02, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

15. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

16. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_016978 (Comamonas testosteroni plasmid pI2, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

17. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

18. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

19. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to KF743817 (Proteus mirabilis plasmid R772, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

20. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to KF743818 (Bordetella bronchiseptica plasmid R906, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

21. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

22. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

23. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

24. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

25. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to KU356987 (Variovorax paradoxus plasmid pBS64, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

26. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to KU356988 (Variovorax paradoxus plasmid pHB44, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

27. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP009797 (Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

28. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_019312 (Delftia sp. KV29 plasmid pKV29, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

29. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP017455 (Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

30. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

31. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

32. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

33. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_005088 (Delftia acidovorans B plasmid pUO1, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

34. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_008385 (Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctggtgcgcggtact	Protospacer
**********************************

35. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 1, identity: 0.971

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgggctggtgcgcggtact	Protospacer
*****************.****************

36. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_008459 (Bordetella pertussis plasmid pBP136 DNA, complete sequence) position: , mismatch: 1, identity: 0.971

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgagctagtgcgcggtact	Protospacer
*********************.************

37. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_MH053445 (Pseudomonas aeruginosa strain PA1280 plasmid pICP-4GES, complete sequence) position: , mismatch: 1, identity: 0.971

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcgggctggtgcgcggtact	Protospacer
*****************.****************

38. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 2, identity: 0.941

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgatgtgcgcgagccggtgcgcggtact	Protospacer
*********.**********.*************

39. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

40. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

41. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

42. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

43. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to KU238092 (Uncultured bacterium plasmid pDTC28, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

44. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

45. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

46. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

47. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_014911 (Alicycliphilus denitrificans BC plasmid pALIDE02, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

48. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

49. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

50. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to KF743817 (Proteus mirabilis plasmid R772, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

51. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to KF743818 (Bordetella bronchiseptica plasmid R906, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

52. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

53. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

54. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

55. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

56. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

57. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_005088 (Delftia acidovorans B plasmid pUO1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

58. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

59. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_MH053445 (Pseudomonas aeruginosa strain PA1280 plasmid pICP-4GES, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

60. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggtgcgcggtact-----	CRISPR spacer
gcagctcgacgtgcgcgacctgctgcg-----ctcgcaa	Protospacer
****************** *** ****     **     

61. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggtgcgcggtact-----	CRISPR spacer
gcagctcgacgtgcgcgacctgctgcg-----ctcgcaa	Protospacer
****************** *** ****     **     

62. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_017908 (Mycobacterium abscessus subsp. bolletii F1725 plasmid BRA100, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

63. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to JX469834 (Uncultured bacterium plasmid pDS3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

64. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

65. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

66. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

67. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

68. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

69. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

70. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP021356 (Rhodococcus sp. S2-17 plasmid pRB29, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggtgcgcggtact-	CRISPR spacer
ccaactcgacgtgctcgagctggtgca-gcgactg	Protospacer
 **.********** ***********. *  *** 

71. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

72. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

73. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

74. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP032995 (Escherichia coli strain W5-6 plasmid p3_W5-6, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

75. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

76. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KX832927 (Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

77. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KY399978 (Vibrio cholerae O139 strain ICDC-211 plasmid pVC211, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

78. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KY986974 (Citrobacter freundii strain 112298 plasmid p112298-tetA, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

79. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_MF133496 (Klebsiella pneumoniae strain 675920 plasmid p675920-2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

80. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

81. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP034785 (Escherichia coli strain ECZP248 plasmid pTBMCR401, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

82. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP034786 (Escherichia coli strain ECZP248 plasmid pTB402, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

83. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MF399199 (Acinetobacter baumannii strain D46 plasmid pD46-4, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

84. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MF679146 (Escherichia coli plasmid pBJ114-141, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

85. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MF679147 (Escherichia coli plasmid pBJ114T-190, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

86. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP009414 (Salmonella enterica strain CFSAN007428 isolate N11150 plasmid pCFSAN007428_01, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

87. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KX443408 (Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

88. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KU321583 (Escherichia coli strain E80 plasmid pE80, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

89. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KX815983 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

90. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KT997783 (Escherichia coli strain Y5 plasmid pECY53, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

91. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KU302802 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

92. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

93. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KX029331 (Klebsiella pneumoniae strain K-109-R plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

94. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KU302801 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

95. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

96. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

97. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

98. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP035548 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_IncA/C2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

99. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP009412 (Salmonella enterica strain CFSAN007426 isolate N19767 plasmid pCFSAN007426_01, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

100. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP009411 (Salmonella enterica strain CFSAN007425 isolate 22697 plasmid pCFSAN007425_01, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

101. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP009413 (Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

102. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KJ909290 (Aeromonas salmonicida subsp. salmonicida strain 2004-05MF26 plasmid pSN254b, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

103. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KM083064 (Vibrio cholerae strain ICDC-1447 plasmid pVC1447, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

104. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

105. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KR559888 (Klebsiella pneumoniae strain Kpn642 plasmid pKP-Gr642, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

106. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KR559889 (Klebsiella pneumoniae strain Kpn8143 plasmid pKP-Gr8143, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

107. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KT818627 (Klebsiella pneumoniae strain U25 plasmid U25P002, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

108. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KR091911 (Salmonella enterica subsp. enterica serovar Corvallis strain RH-1238 plasmid pRH-1238, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

109. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KP276584 (Escherichia coli strain 39R861 plasmid p39R861-4, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

110. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KT990220 (Escherichia coli strain 42-2 plasmid p42-2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

111. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KP056256 (Escherichia coli strain YDC637 plasmid pYDC637, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

112. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to LT221038 (Yersinia pseudotuberculosis strain Yps.R2, plasmid pYps.R2 complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

113. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP028197 (Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

114. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP028197 (Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

115. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP028197 (Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

116. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP032391 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

117. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP026133 (Klebsiella pneumoniae strain F5 plasmid pF5_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

118. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP011601 (Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

119. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP011601 (Phytobacter ursingii strain CAV1151 plasmid pCAV1151-296, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

120. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP017987 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

121. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_AP023191 (Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

122. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP028975 (Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

123. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP028975 (Cronobacter sakazakii strain GZcsf-1 plasmid pGW1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

124. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

125. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP045742 (Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

126. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

127. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP044256 (Salmonella enterica strain CFSAN096147 plasmid pCFSAN096147, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

128. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_009651 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN5, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

129. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP048305 (Escherichia coli strain 9 plasmid p009_A, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

130. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

131. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP025240 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE3-1928, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

132. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP025242 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1929 plasmid pSNE1-1929, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

133. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP045264 (Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

134. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP024192 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

135. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP044294 (Escherichia coli strain P276M plasmid p276M-CTX-M-55, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

136. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP019272 (Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

137. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

138. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

139. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_010886 (Klebsiella pneumoniae plasmid pK245, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

140. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_012886 (Escherichia coli plasmid pRAx, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

141. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP027679 (Salmonella enterica subsp. enterica serovar Corvallis strain 12-01738 plasmid pSE12-01738-2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

142. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

143. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP017059 (Citrobacter freundii strain SL151 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

144. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP026241 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-e790, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

145. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP033394 (Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

146. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN539018 (Salmonella sp. strain OYZ4 plasmid pOYZ4, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

147. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_LS992184 (Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

148. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_LS992184 (Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

149. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

150. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_KJ187752 (Klebsiella pneumoniae strain 7433 plasmid pTR2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

151. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP018716 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

152. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP018722 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

153. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP018704 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

154. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP029249 (Salmonella enterica subsp. enterica serovar Thompson strain HFCDC-SM-846 plasmid p846, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

155. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

156. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

157. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

158. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_008612 (Photobacterium damselae subsp. piscicida plasmid pP99-018, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

159. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_010119 (Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pOU7519, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

160. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP033957 (Klebsiella pneumoniae strain L39_2 plasmid p4_L39, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

161. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP047093 (Salmonella sp. S13 plasmid pS13-4, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

162. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP034739 (Escherichia coli strain L65 plasmid pL65-2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

163. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MT077884 (Escherichia coli plasmid p33, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

164. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MT077884 (Escherichia coli plasmid p33, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

165. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MT077886 (Escherichia coli plasmid p39, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

166. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MT077886 (Escherichia coli plasmid p39, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

167. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP022359 (Shewanella bicestrii strain JAB-1 plasmid pSHE-CTX-M, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

168. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP051432 (Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

169. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_LT904892 (Salmonella enterica subsp. enterica serovar Typhi strain 80-2002 plasmid 2) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

170. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP048293 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

171. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP048293 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

172. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP029802 (Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_90k, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

173. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP027038 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

174. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP036362 (Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

175. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN423361 (Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

176. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN423361 (Leclercia sp. strain 1106151 plasmid p1106151-mcr, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

177. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MT066418 (Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

178. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP012682 (Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33676_IncA/C, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

179. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to CP045559 (Citrobacter sp. S39 plasmid pS39-4, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

180. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

181. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP019260 (Escherichia coli strain 13C1065T plasmid p13C1065T-1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

182. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP047128 (Escherichia coli K-12 plasmid pT-HNK130-3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

183. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP031549 (Escherichia coli strain cq9 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

184. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP032385 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

185. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP032388 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

186. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

187. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP012007 (Acinetobacter baumannii strain Ab04-mff plasmid pAB04-1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

188. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP020856 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

189. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

190. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

191. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN175387 (Klebsiella pneumoniae strain KP-14-6 plasmid pKP-14-6-NDM-1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

192. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN086777 (Escherichia coli plasmid p16EC-p0111, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

193. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN891681 (Klebsiella pneumoniae strain 14899 plasmid p14899-KPC, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

194. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN891684 (Klebsiella pneumoniae strain BJ107 plasmid pBJ107-KPC, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

195. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN891686 (Klebsiella pneumoniae strain ZZ58 plasmid pZZ58-KPC, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

196. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

197. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP053046 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

198. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP014978 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 plasmid pSTY1-1896, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

199. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_008613 (Photobacterium damselae subsp. piscicida plasmid pP91278, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

200. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to CM019853 (Escherichia coli strain CVM N17EC0326 plasmid pN17EC0326-3, complete sequence, whole genome shotgun sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

201. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to CM019853 (Escherichia coli strain CVM N17EC0326 plasmid pN17EC0326-3, complete sequence, whole genome shotgun sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

202. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP031568 (Enterobacter hormaechei strain 2013_1a plasmid pSHV12-1301491, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

203. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP031568 (Enterobacter hormaechei strain 2013_1a plasmid pSHV12-1301491, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

204. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP031564 (Klebsiella pneumoniae strain 2-1 plasmid pKP21AC2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

205. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

206. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP027055 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

207. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP035774 (Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

208. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN254970 (Escherichia coli strain EC009 plasmid pEC009.1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

209. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

210. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP014658 (Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 plasmid pSAN1-1736, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

211. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP006665 (Edwardsiella anguillarum ET080813 strain 80813 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

212. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP035381 (Leclercia adecarboxylata strain R25 plasmid pLA-64, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

213. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP043190 (Escherichia coli O16:H48 strain PG20180175 plasmid pPG20180175.1-IncAC2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

214. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP044142 (Escherichia coli O157 strain AR-0429 plasmid pAR-0429-1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

215. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP025231 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1924 plasmid pSNE1-1924, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

216. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP044306 (Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

217. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP028179 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

218. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP039562 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014847 plasmid p08-5333.1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

219. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP037964 (Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

220. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP038330 (Escherichia coli O157:H7 strain NE 1092-2 plasmid pNE1092-3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

221. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP038326 (Escherichia coli O157:H7 strain NE 1169-1 plasmid pNE1169-3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

222. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP041083 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

223. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP043215 (Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.1-IncAC2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

224. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP027855 (Plesiomonas shigelloides strain MS-17-188 plasmid pPS-MS-17-188-3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

225. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to CP052417 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

226. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP038322 (Escherichia coli O157:H7 strain NE1127 plasmid pNE1127-2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

227. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_016974 (Providencia stuartii plasmid pMR0211, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

228. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP041376 (Klebsiella pneumoniae strain KP58 plasmid pKP58-3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

229. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN310369 (Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-Ct1/2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

230. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN310370 (Klebsiella pneumoniae strain 11935 plasmid p11935-Ct1/2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

231. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP021956 (Klebsiella pneumoniae strain AR_0107 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

232. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP009560 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22425 plasmid pCVM22425, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

233. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

234. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

235. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP022697 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

236. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

237. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_022372 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pYT3 DNA, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

238. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP032243 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

239. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP047878 (Escherichia coli strain LD22-1 plasmid pLD22-1-135kb, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

240. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

241. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP046718 (Escherichia coli strain T16R plasmid pT16R-2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

242. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to CP052554 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

243. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP041177 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

244. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to LC511657 (Escherichia coli 2017.02.01CC plasmid p2017.02.01CC DNA, complete genome) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

245. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP041641 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MCR1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

246. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP044215 (Klebsiella aerogenes strain KA_P10_L5_03.19 plasmid pIMPIncH12_334kb, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

247. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

248. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP026753 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000084_pilon, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

249. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP009562 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 plasmid pCVM22513, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

250. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP031802 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

251. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP034761 (Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

252. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP021168 (Enterobacter hormaechei strain 388 plasmid p388, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

253. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP045517 (Salmonella enterica subsp. enterica serovar Anatum strain Sal-4737 plasmid pSal-4737_DHA, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

254. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP045520 (Salmonella enterica subsp. enterica serovar Anatum strain Sal-5091 plasmid pSal-5091_DHA, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

255. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP045462 (Salmonella enterica subsp. enterica serovar Anatum strain M-3851 plasmid pM-3851_DHA, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

256. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP045467 (Salmonella enterica subsp. enterica serovar Anatum strain Sal-3973 plasmid pSal-3973_DHA_CMY, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

257. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP045510 (Salmonella enterica subsp. enterica serovar Anatum strain M-5360 plasmid pM-5360_DHA, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

258. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP050707 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

259. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to CP038003 (Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

260. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP006029 (Escherichia coli O145:H28 str. RM13514 plasmid pRM13514, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

261. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP050416 (Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

262. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_AP019676 (Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

263. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP038464 (Aeromonas hydrophila strain WCX23 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

264. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP027043 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

265. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP007137 (Escherichia coli O145:H28 str. RM12581 plasmid pRM12581, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

266. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

267. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP038468 (Citrobacter sp. SNU WT2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

268. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP040807 (Escherichia fergusonii strain EFCF056 plasmid pEF02, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

269. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP040809 (Escherichia fergusonii strain EFCF056 plasmid pEF04, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

270. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP040810 (Escherichia fergusonii strain EFCF056 plasmid pEF05, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

271. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_009140 (Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

272. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_011092 (Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 plasmid pCVM19633_110, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

273. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP010168 (Escherichia coli strain H3 plasmid A, complete genome) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

274. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP017086 (Proteus mirabilis strain T18 plasmid pT18, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

275. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP024824 (Escherichia coli strain CREC-591 plasmid pCREC-591_3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

276. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP024857 (Escherichia coli strain AR_0011 plasmid tig00001069_pilon, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

277. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP035277 (Citrobacter freundii strain R17 plasmid pCFR17_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

278. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP036180 (Escherichia coli strain WCHEC025970 plasmid p1_025970, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

279. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP036306 (Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

280. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP021163 (Enterobacter hormaechei strain 234 plasmid p234, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

281. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP024157 (Escherichia coli strain 14EC047 plasmid p14EC047b, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

282. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP038466 (Aeromonas hydrophila strain 23-C-23 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

283. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP050426 (Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

284. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_021667 (Klebsiella pneumoniae plasmid IncA/C-LS6, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

285. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to CP040054 (Acinetobacter baumannii strain VB35179 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

286. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP030186 (Salmonella enterica strain SA20094620 plasmid pSA20094620.1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

287. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to CP028790 (Klebsiella pneumoniae strain WCHKP020030 plasmid pKPC2_020030, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

288. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to CP043753 (Escherichia coli strain CVM N56639 plasmid pN56639, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

289. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

290. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP050433 (Acinetobacter baumannii strain PM194229 plasmid pPM194229_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

291. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP050386 (Acinetobacter baumannii strain VB82 plasmid pVB82_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

292. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

293. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP040696 (Citrobacter freundii strain R47 plasmid pR47-309, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

294. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP040696 (Citrobacter freundii strain R47 plasmid pR47-309, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

295. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP040697 (Citrobacter freundii strain R47 plasmid pR47-54, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

296. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

297. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_017645 (Escherichia coli UMNK88 plasmid pUMNK88, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

298. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP009567 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCFSAN000934_02, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

299. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP008899 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-8a4, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

300. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

301. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP007636 (Vibrio cholerae strain 2012EL-2176 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

302. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to CP052289 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

303. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_AP019668 (Klebsiella pneumoniae strain TA6363 plasmid pTMTA63633, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

304. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_012690 (Escherichia coli plasmid peH4H, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

305. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP042552 (Enterobacter hormaechei strain C45 plasmid pC45_001, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

306. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP019074 (Escherichia coli strain CRE1493 plasmid p1493-3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

307. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP047195 (Klebsiella pneumoniae strain Kp36 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

308. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

309. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP032238 (Escherichia coli strain ECCWS199 plasmid pTB221, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

310. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP032239 (Escherichia coli strain ECCWS199 plasmid pTB222, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

311. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP016526 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

312. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_006856 (Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 plasmid pSC138, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

313. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP028931 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

314. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP031575 (Enterobacter hormaechei strain A1 plasmid pIncHI2-1502264, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

315. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP010243 (Escherichia coli strain S56 plasmid A, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

316. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP024557 (Klebsiella pneumoniae strain INF164 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

317. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

318. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP025233 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 plasmid pSNE1-1925, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

319. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

320. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP041172 (Salmonella enterica subsp. enterica serovar Thompson strain SH11G0791 plasmid pSH11G0791, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

321. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP017633 (Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

322. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP011617 (Klebsiella oxytoca strain CAV1335 plasmid pCAV1335-115, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

323. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP039170 (Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

324. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP039170 (Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

325. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to CP042971 (Escherichia coli strain CFSAN061769 plasmid pCFSAN061769_02, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

326. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP024529 (Klebsiella pneumoniae strain INF157 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

327. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

328. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP016919 (Klebsiella pneumoniae isolate 11 plasmid pIncR_DHQP1300920, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

329. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP018457 (Shewanella algae strain CCU101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

330. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP034677 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

331. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

332. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MF918372 (Klebsiella pneumoniae plasmid p1512-KPC, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

333. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP041112 (Escherichia coli strain ECCTRSRTH03 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

334. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP017930 (Klebsiella oxytoca strain CAV1015 plasmid pCAV1015-114, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

335. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP016013 (Salmonella enterica subsp. enterica serovar Newport strain CFSAN003890 plasmid pCFSAN003890, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

336. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP032491 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

337. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP032496 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_IncA/C2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

338. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

339. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP024522 (Klebsiella pneumoniae strain INF158 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

340. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP047577 (Escherichia coli strain 94EC plasmid p94EC-1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

341. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

342. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_019065 (Escherichia coli plasmid pPG010208, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

343. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_019066 (Escherichia coli plasmid pAPEC1990_61, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

344. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP029382 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pQnrS1_020079, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

345. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP042586 (Escherichia coli strain LD91-1 plasmid pLD91-1-146kb, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

346. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

347. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP026141 (Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

348. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP026147 (Klebsiella pneumoniae strain F132 plasmid pF132_2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

349. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP026152 (Klebsiella pneumoniae strain F138 plasmid pF138_3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

350. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP019001 (Escherichia coli strain Ecol_AZ155 plasmid pECAZ155_KPC, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

351. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

352. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP043927 (Klebsiella quasipneumoniae subsp. quasipneumoniae strain M17277 plasmid p17277A_477, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

353. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP043927 (Klebsiella quasipneumoniae subsp. quasipneumoniae strain M17277 plasmid p17277A_477, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

354. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP044075 (Providencia stuartii strain FDAARGOS_645 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

355. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP026137 (Klebsiella pneumoniae strain F77 plasmid pF77_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

356. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP035669 (Edwardsiella piscicida strain MS-18-199 plasmid pEP-MS-18-199, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

357. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP025275 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1923 plasmid pSNE2-1923) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

358. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP025275 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1923 plasmid pSNE2-1923) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

359. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP040362 (Klebsiella pneumoniae strain R50 plasmid pR50-74, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

360. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP045016 (Klebsiella pneumoniae subsp. pneumoniae strain BK13048 plasmid pBK13048-1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

361. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP025677 (Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

362. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP047161 (Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

363. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP012170 (Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

364. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP012170 (Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

365. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP030283 (Escherichia coli strain E308 plasmid pLKSZ02, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

366. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN823990 (Klebsiella pneumoniae strain 120314013 plasmid p314013-FII, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

367. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

368. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to CP028419 (Aeromonas hydrophila strain WCX23 plasmid pWCX23_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

369. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP026578 (Escherichia coli strain WCHEC005237 plasmid pQnrS1_005237, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

370. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP044962 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014881 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

371. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP024550 (Klebsiella pneumoniae strain INF163 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

372. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP018318 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

373. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP032212 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

374. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP036366 (Klebsiella pneumoniae strain WCHKP115068 plasmid pCTXM65_115068, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

375. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP037959 (Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

376. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP037959 (Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

377. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN865122 (Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

378. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN842292 (Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

379. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

380. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN823987 (Escherichia coli strain 2016061604 plasmid p6061604-KPC, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

381. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

382. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to KR827392 (Uncultured bacterium plasmid pKAZ3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

383. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to CP016403 (Klebsiella pneumoniae subsp. pneumoniae strain F5 plasmid pF5, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

384. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP028782 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pQnrB52_020046, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

385. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP011596 (Klebsiella oxytoca strain CAV1099 plasmid pCAV1099-114, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

386. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP021712 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000857, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

387. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP047667 (Escherichia coli strain LD26-1 plasmid pLD26-1-135kb, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

388. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

389. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP039861 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

390. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP033379 (Escherichia coli strain L73 plasmid pL73-2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

391. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP025236 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1926 plasmid pSNE2-1926, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

392. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP013215 (Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

393. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP013215 (Klebsiella pneumoniae subsp. pneumoniae strain H11 plasmid pH11, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

394. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP009570 (Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 isolate CFSAN000926 plasmid pCVMN1543, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

395. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP009564 (Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 plasmid pCVM21550, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

396. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP009563 (Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 plasmid pCVM21538, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

397. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP027144 (Enterobacter hormaechei subsp. hoffmannii strain AR_0365 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

398. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP027144 (Enterobacter hormaechei subsp. hoffmannii strain AR_0365 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

399. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP021946 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

400. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP028480 (Klebsiella pneumoniae strain 2e plasmid unnamed2) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

401. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_012556 (Enterobacter cloacae plasmid pEC-IMPQ, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

402. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_012556 (Enterobacter cloacae plasmid pEC-IMPQ, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

403. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_012555 (Enterobacter cloacae plasmid pEC-IMP, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

404. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_012555 (Enterobacter cloacae plasmid pEC-IMP, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

405. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP027067 (Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

406. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP041209 (Salmonella enterica subsp. enterica serovar Newport strain SAP18-8729 plasmid pCFSAN074384_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

407. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP042579 (Enterobacter kobei strain C16 plasmid pC16_001, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

408. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP031106 (Escherichia coli strain AMSCJX02 plasmid pAMSC1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

409. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP034126 (Klebsiella pneumoniae strain BJCFK909 plasmid p3s1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

410. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP025578 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

411. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP006801 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

412. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP020596 (Acinetobacter baumannii strain HWBA8 plasmid pHWBA8_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

413. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP020596 (Acinetobacter baumannii strain HWBA8 plasmid pHWBA8_1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

414. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

415. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP011611 (Citrobacter freundii strain CAV1321 plasmid pKPC_CAV1321-244, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

416. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP018689 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

417. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_019107 (Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_174, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

418. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_019116 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH163_135, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

419. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_019118 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH696_135, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

420. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_019121 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_166, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

421. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP035209 (Klebsiella quasipneumoniae strain TH114 plasmid pTH114-1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

422. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP019053 (Escherichia coli strain CRE1540 plasmid p1540-2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

423. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP048027 (Escherichia coli strain GZEC065 plasmid pTET-GZEC065, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

424. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP029743 (Escherichia coli strain AR_0085 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

425. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to MN419308 (Klebsiella pneumoniae strain 12478 plasmid p12478-rmtB, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

426. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP040260 (Acinetobacter baumannii strain P7774 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

427. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_AP023198 (Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

428. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP041631 (Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

429. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP049193 (Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

430. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP049193 (Enterobacter hormaechei strain Y2152 plasmid pIHI2-2152, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

431. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP050812 (Yokenella regensburgei strain W13 plasmid pYRW13-125, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

432. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_012692 (Escherichia coli plasmid pAR060302, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

433. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NC_012693 (Salmonella enterica plasmid pAM04528, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

434. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP032842 (Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

435. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP018341 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-4, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

436. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP024564 (Klebsiella pneumoniae strain INF278 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

437. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP014775 (Aeromonas veronii strain AVNIH1 plasmid pASP-a58, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

438. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

439. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP049189 (Enterobacter hormaechei strain Y323 plasmid pIHI2-323, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

440. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to CP050283 (Klebsiella pneumoniae strain 9949 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

441. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP025340 (Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p220k, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

442. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP025245 (Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0663 isolate USDA-ARS-USMARC-1936 plasmid pSNE2-2012K-0663, complete sequence) position: , mismatch: 7, identity: 0.794

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcggca--	Protospacer
*****************. *****   * ***.*  

443. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 8, identity: 0.765

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
ccccgtcgacgtgcgcgaggtggtgcgcgacacg	Protospacer
 *   ************** *********..** 

444. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.765

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gccgctcgacgtgcgcgcgctggtgccgcgtctc	Protospacer
** ************** ********   ** ..

445. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to AP018709 (Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence) position: , mismatch: 8, identity: 0.765

gcagctcgacgtgcgcgagctggt--gcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcgtctcgtca--	Protospacer
*****************. *****   * ** .*  

446. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP015091 (Pelagibaca abyssi strain JLT2014 plasmid pPABY1, complete sequence) position: , mismatch: 9, identity: 0.735

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
ctggctcgacgtgcccgagctgctgcgccagacg	Protospacer
 ..*********** ******* ***** . ** 

447. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 10, identity: 0.706

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gcagctcgacgtgcgcggcctggtcggccccggc	Protospacer
*****************. *****  **  .. .

448. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 10, identity: 0.706

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gttccacgacgtgcgcgagcaggtgcccggcgag	Protospacer
*.  * ************** ***** ***..  

449. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 10, identity: 0.706

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
cgagatcaacgtgcgcgagctggtgcaggacggt	Protospacer
  ** **.******************. *... *

450. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP010991 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence) position: , mismatch: 10, identity: 0.706

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gttccacgacgtgcgcgagcaggtgcccggcgag	Protospacer
*.  * ************** ***** ***..  

451. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 10, identity: 0.706

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
gttccacgacgtgcgcgagcaggtgcccggcgag	Protospacer
*.  * ************** ***** ***..  

452. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 10, identity: 0.706

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
cgagatcaacgtgcgcgagctggtgcaggatggc	Protospacer
  ** **.******************. *.*. .

453. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.676

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
cgagatcaacgtgcgcgagctggtgcaggacggc	Protospacer
  ** **.******************. *... .

454. spacer 1.1|7484|34|NZ_CP017455|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.676

gcagctcgacgtgcgcgagctggtgcgcggtact	CRISPR spacer
cgagatcaacgtgcgcgagctggtgcaggacggc	Protospacer
  ** **.******************. *... .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage