1. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP028352 (Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence) position: , mismatch: 0, identity: 1.0
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccggctttgcc Protospacer
********************************
2. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028352 (Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence) position: , mismatch: 0, identity: 1.0
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccggctttgc Protospacer
*****************************
3. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014126 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.931
gcgggttcggcggagcttaccggctttgc CRISPR spacer
aggggttcggcggagcttaccggctttgc Protospacer
. ***************************
4. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014126 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.931
gcgggttcggcggagcttaccggctttgc CRISPR spacer
aggggttcggcggagcttaccggctttgc Protospacer
. ***************************
5. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014126 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.931
gcgggttcggcggagcttaccggctttgc CRISPR spacer
aggggttcggcggagcttaccggctttgc Protospacer
. ***************************
6. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_013973 (Erwinia amylovora ATCC 49946 plasmid 2, complete sequence) position: , mismatch: 2, identity: 0.931
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttggcggctttgc Protospacer
******************. *********
7. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_013973 (Erwinia amylovora ATCC 49946 plasmid 2, complete sequence) position: , mismatch: 2, identity: 0.931
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttggcggctttgc Protospacer
******************. *********
8. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_013973 (Erwinia amylovora ATCC 49946 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.906
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ctgcgggttcggcggagcttggcggctttgcc Protospacer
.*******************. **********
9. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_013973 (Erwinia amylovora ATCC 49946 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.906
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ctgcgggttcggcggagcttggcggctttgcc Protospacer
.*******************. **********
10. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 3, identity: 0.897
gcgggttcggcggagcttaccggctttgc CRISPR spacer
agggattcggcggagcttaccggctttgc Protospacer
. **.************************
11. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 3, identity: 0.897
gcgggttcggcggagcttaccggctttgc CRISPR spacer
agggattcggcggagcttaccggctttgc Protospacer
. **.************************
12. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP014126 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
gaaggggttcggcggagcttaccggctttgcc Protospacer
. ****************************
13. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP014126 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ggaggggttcggcggagcttaccggctttgcc Protospacer
. ****************************
14. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP014126 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
gaaggggttcggcggagcttaccggctttgcc Protospacer
. ****************************
15. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP016891 (Pantoea agglomerans strain C410P1 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.862
gcgggttcggcggagcttaccggctttgc CRISPR spacer
agggattcagcggagcttaccggctttgc Protospacer
. **.***.********************
16. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031652 (Pantoea agglomerans strain TH81 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.862
gcgggttcggcggagcttaccggctttgc CRISPR spacer
aggggttcggcggagcttaccggcaatgc Protospacer
. ********************** ***
17. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 5, identity: 0.844
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ggagggattcggcggagcttaccggctttgcc Protospacer
. **.*************************
18. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 5, identity: 0.844
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttcgcggtccggcggagcttaccggctctgcc Protospacer
** ***.******************.****
19. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 5, identity: 0.844
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ggagggattcggcggagcttaccggctttgcc Protospacer
. **.*************************
20. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 5, identity: 0.844
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttcgcggtccggcggagcttaccggctctgcc Protospacer
** ***.******************.****
21. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014126 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
aggggttcggcggagcttagcggcttgcc Protospacer
. ***************** ****** *
22. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
cgcggtccggcggagcttaccggctctgc Protospacer
***.******************.***
23. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
cgcggtccggcggagcttaccggctctgc Protospacer
***.******************.***
24. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgggtgcta Protospacer
*********************** * .
25. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_014312 (Klebsiella pneumoniae plasmid pKP048, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
26. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026280 (Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
27. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026280 (Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
28. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
29. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
30. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
31. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
32. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
33. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
34. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
35. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
36. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
37. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
38. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
39. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
40. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
41. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
42. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
43. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
44. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY689238 (Klebsiella pneumoniae strain TP-P16 plasmid pKPC_P16, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
45. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY689238 (Klebsiella pneumoniae strain TP-P16 plasmid pKPC_P16, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
46. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY689238 (Klebsiella pneumoniae strain TP-P16 plasmid pKPC_P16, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
47. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
48. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
49. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
50. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY174332 (Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
51. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY174332 (Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
52. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY174332 (Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
53. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
54. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
55. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
56. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP032197 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
57. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
58. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
59. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
60. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
61. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
62. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
63. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
64. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
65. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
66. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
67. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
68. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
69. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
70. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
71. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
72. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
73. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
74. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
75. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
76. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
77. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
78. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
79. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
80. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
81. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
82. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
83. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
84. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
85. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
86. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KP345882 (Escherichia coli strain BK32533 plasmid pBK32533, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
87. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
88. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
89. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
90. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
91. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
92. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
93. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
94. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
95. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
96. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
97. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
98. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
99. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
100. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
101. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
102. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
103. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
104. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
105. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
106. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
107. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
108. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
109. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
110. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
111. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP043048 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
112. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
113. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
114. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
115. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
116. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
117. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
118. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
119. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
120. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
121. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
122. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
123. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
124. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
125. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
126. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
127. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
128. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
129. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
130. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
131. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP037444 (Klebsiella sp. PO552 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
132. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP037444 (Klebsiella sp. PO552 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
133. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP019900 (Raoultella planticola strain GODA plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
134. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP019900 (Raoultella planticola strain GODA plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
135. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_020893 (Klebsiella pneumoniae plasmid pKPC-LK30, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
136. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_020893 (Klebsiella pneumoniae plasmid pKPC-LK30, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
137. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_020893 (Klebsiella pneumoniae plasmid pKPC-LK30, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
138. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
139. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
140. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
141. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
142. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
143. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
144. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP045264 (Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
145. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP045264 (Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
146. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
147. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
148. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
149. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
150. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
151. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
152. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
153. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
154. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
155. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
156. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
157. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
158. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
159. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
160. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
161. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
162. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
163. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
164. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
165. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
166. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
167. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
168. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
169. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
170. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
171. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
172. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP033394 (Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
173. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
174. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
175. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
176. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
177. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
178. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
179. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
180. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
181. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
182. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
183. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
184. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
185. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052145 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
186. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052145 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
187. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052145 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
188. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
189. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
190. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
191. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
192. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028955 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
193. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028955 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
194. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
195. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
196. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
197. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
198. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
199. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036362 (Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
200. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036362 (Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
201. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036362 (Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
202. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
203. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
204. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
205. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
206. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
207. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
208. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
209. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
210. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
211. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
212. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to HG969998 (Klebsiella pneumoniae plasmid pIT-11C07, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
213. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to HG969998 (Klebsiella pneumoniae plasmid pIT-11C07, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
214. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
215. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
216. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
217. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
218. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
219. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
220. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
221. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
222. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
223. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
224. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
225. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
226. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
227. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
228. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
229. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
230. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034777 (Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
231. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034777 (Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
232. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
233. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
234. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
235. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
236. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
237. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
238. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
239. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
240. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
241. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
242. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
243. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
244. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
245. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
246. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
247. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
248. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
249. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
250. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
251. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
252. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
253. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
254. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
255. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
256. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
257. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
258. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
259. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
260. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
261. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
262. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
263. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
264. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
265. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
266. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
267. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
268. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN891684 (Klebsiella pneumoniae strain BJ107 plasmid pBJ107-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
269. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN891684 (Klebsiella pneumoniae strain BJ107 plasmid pBJ107-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
270. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN891685 (Klebsiella pneumoniae strain BJ119 plasmid pBJ119-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
271. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN891686 (Klebsiella pneumoniae strain ZZ58 plasmid pZZ58-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
272. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN891686 (Klebsiella pneumoniae strain ZZ58 plasmid pZZ58-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
273. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
274. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
275. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
276. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
277. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_LR134255 (Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
278. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_LR134255 (Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
279. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_LR134255 (Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
280. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_LR134255 (Klebsiella aerogenes strain NCTC9644 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
281. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
282. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
283. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
284. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
285. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
286. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
287. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
288. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
289. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
290. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
291. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
292. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
293. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
294. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
295. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
296. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
297. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
298. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
299. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
300. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
301. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
302. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
303. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
304. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
305. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
306. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
307. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
308. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
309. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
310. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
311. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MG700549 (Klebsiella pneumoniae strain st015256/1 plasmid pUJ-83KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
312. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052219 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
313. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052219 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
314. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052219 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
315. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
316. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
317. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
318. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
319. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
320. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
321. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
322. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
323. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
324. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP023840 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
325. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP037964 (Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
326. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP037964 (Klebsiella pneumoniae strain SCKP020135 plasmid pMCR8_020135, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
327. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
328. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
329. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
330. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
331. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
332. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
333. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
334. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
335. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
336. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
337. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018992 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
338. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018992 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
339. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018992 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
340. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
341. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
342. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
343. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
344. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
345. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
346. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
347. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
348. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
349. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
350. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
351. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027614 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
352. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP009275 (Klebsiella variicola strain DX120E plasmid pKV1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
353. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP009275 (Klebsiella variicola strain DX120E plasmid pKV1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
354. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
355. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
356. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
357. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
358. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
359. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
360. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
361. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
362. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
363. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
364. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
365. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
366. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
367. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
368. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
369. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
370. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
371. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
372. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
373. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
374. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
375. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
376. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
377. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
378. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
379. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
380. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
381. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
382. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
383. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
384. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
385. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
386. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP045217 (Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
387. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
388. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
389. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
390. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
391. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
392. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026173 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
393. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026173 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
394. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
395. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
396. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
397. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
398. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
399. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
400. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
401. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
402. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
403. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
404. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
405. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
406. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
407. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
408. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
409. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
410. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
411. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
412. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
413. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
414. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
415. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
416. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
417. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
418. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
419. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027044 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
420. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027044 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
421. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021166 (Klebsiella pneumoniae strain 203 plasmid p203, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
422. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
423. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
424. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
425. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
426. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
427. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
428. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
429. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
430. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
431. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
432. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
433. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
434. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
435. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
436. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
437. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
438. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
439. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
440. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
441. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052526 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
442. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052526 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
443. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP017851 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
444. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
445. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
446. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
447. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP017286 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
448. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
449. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
450. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
451. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
452. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
453. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
454. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
455. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP009773 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH33 plasmid pKPC-63d, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
456. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP009776 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPC-def, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
457. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
458. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
459. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
460. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
461. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
462. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
463. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
464. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
465. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
466. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
467. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
468. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP046947 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed8) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
469. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP006926 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
470. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
471. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
472. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008932 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
473. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
474. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
475. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP006663 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
476. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP006663 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pCuAs, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
477. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
478. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
479. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
480. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
481. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
482. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
483. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
484. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
485. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
486. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
487. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
488. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
489. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
490. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008843 (Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
491. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP017281 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
492. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
493. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
494. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
495. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022825 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
496. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022825 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
497. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020065 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
498. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
499. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
500. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
501. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
502. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
503. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
504. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
505. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
506. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
507. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
508. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
509. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
510. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
511. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
512. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP038279 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
513. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP038279 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
514. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
515. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
516. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
517. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
518. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
519. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
520. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
521. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
522. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
523. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
524. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
525. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
526. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
527. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
528. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
529. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
530. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
531. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
532. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
533. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
534. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
535. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
536. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
537. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
538. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
539. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
540. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
541. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
542. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
543. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
544. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
545. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
546. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_021199 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
547. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022613 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
548. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022613 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
549. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP050373 (Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
550. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP050373 (Klebsiella pneumoniae strain 50595 plasmid p50595_IncFII, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
551. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
552. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP050374 (Klebsiella pneumoniae strain 50595 plasmid p50595_NDM_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
553. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
554. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
555. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
556. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
557. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
558. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
559. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
560. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
561. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
562. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
563. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
564. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
565. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026148 (Klebsiella pneumoniae strain F132 plasmid pF132_3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
566. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026152 (Klebsiella pneumoniae strain F138 plasmid pF138_3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
567. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
568. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP023916 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
569. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP023916 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
570. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
571. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
572. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
573. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
574. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
575. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
576. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020904 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
577. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020904 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
578. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
579. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
580. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
581. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
582. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
583. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP042547 (Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
584. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP013339 (Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
585. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047161 (Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
586. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047161 (Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
587. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029723 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
588. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029723 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
589. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
590. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
591. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
592. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
593. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
594. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN823996 (Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
595. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN823996 (Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
596. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN823996 (Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
597. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
598. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
599. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
600. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
601. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
602. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
603. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
604. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
605. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
606. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
607. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
608. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
609. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
610. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
611. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
612. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024510 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
613. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024510 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
614. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
615. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
616. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
617. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036366 (Klebsiella pneumoniae strain WCHKP115068 plasmid pCTXM65_115068, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
618. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
619. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
620. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
621. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
622. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
623. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
624. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
625. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
626. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
627. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP015824 (Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
628. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP015824 (Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
629. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
630. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
631. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
632. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
633. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
634. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
635. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
636. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
637. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
638. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
639. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
640. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
641. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
642. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
643. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
644. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
645. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
646. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
647. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
648. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
649. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
650. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
651. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
652. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
653. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
654. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
655. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
656. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
657. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021946 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
658. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
659. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
660. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
661. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027067 (Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
662. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027067 (Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
663. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027067 (Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
664. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
665. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
666. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
667. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
668. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034125 (Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
669. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034125 (Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
670. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034125 (Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
671. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
672. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
673. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
674. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
675. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
676. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041937 (Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
677. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052436 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
678. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
679. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
680. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
681. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
682. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
683. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
684. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
685. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031883 (Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
686. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
687. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
688. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
689. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
690. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
691. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
692. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
693. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
694. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
695. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
696. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
697. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
698. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
699. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
700. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024484 (Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
701. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
702. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054265 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
703. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
704. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
705. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
706. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
707. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
708. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
709. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
710. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
711. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
712. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
713. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
714. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_023905 (Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
715. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_023905 (Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
716. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
717. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
718. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
719. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
720. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
721. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
722. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
723. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
724. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
725. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
726. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
727. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
728. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
729. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
730. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
731. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
732. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
733. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
734. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
735. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
736. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026016 (Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
737. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
738. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
739. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
740. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
741. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
742. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
743. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
744. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
745. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
746. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
747. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054734 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
748. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054734 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
749. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054734 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
750. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
751. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
752. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
753. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
754. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK649823 (Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
755. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK649823 (Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
756. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK649823 (Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
757. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
758. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
759. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
760. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP023943 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
761. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP023943 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
762. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
763. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
764. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP019904 (Escherichia coli strain MDR_56 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
765. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP019904 (Escherichia coli strain MDR_56 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
766. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
767. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
768. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
769. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
770. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
771. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
772. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
773. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP015396 (Klebsiella pneumoniae strain CR14 plasmid pCR14_4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
774. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027696 (Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
775. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027696 (Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
776. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
777. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
778. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
779. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
780. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
781. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
782. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
783. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
784. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
785. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
786. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
787. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
788. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
789. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK433206 (Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
790. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK433206 (Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
791. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK433206 (Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
792. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
793. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
794. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
795. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
796. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
797. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
798. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MH569712 (Serratia marcescens strain S120 plasmid pPM120-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
799. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MH255827 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
800. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MH255827 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
801. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MH255827 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
802. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
803. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
804. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
805. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
806. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
807. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
808. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MH263653 (Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
809. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MH263653 (Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
810. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MH263653 (Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
811. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK036887 (Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
812. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK036887 (Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
813. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK036887 (Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
814. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK036888 (Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
815. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK036888 (Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
816. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK036888 (Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
817. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK036886 (Klebsiella pneumoniae strain 283149 plasmid p283149-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
818. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MK036886 (Klebsiella pneumoniae strain 283149 plasmid p283149-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
819. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN657248 (Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
820. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN657248 (Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
821. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN657248 (Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
822. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014777 (Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
823. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
824. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
825. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
826. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MF133495 (Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
827. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MF133495 (Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
828. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MF133495 (Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
829. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MF168404 (Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
830. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MF168404 (Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
831. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MF168404 (Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
832. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
833. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
834. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
835. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MF168402 (Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
836. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MF168402 (Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
837. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MF168402 (Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
838. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MF156695 (Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
839. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MF156695 (Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
840. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018455 (Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
841. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018455 (Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
842. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018455 (Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
843. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
844. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
845. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP030134 (Klebsiella pneumoniae strain 160111 plasmid pKPC2_L111, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
846. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP030134 (Klebsiella pneumoniae strain 160111 plasmid pKPC2_L111, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
847. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP030134 (Klebsiella pneumoniae strain 160111 plasmid pKPC2_L111, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
848. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN823997 (Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
849. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MT109193 (Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
850. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MT109193 (Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
851. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP035536 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
852. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP035536 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
853. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP035536 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
854. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MG764553 (Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
855. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MG764553 (Klebsiella pneumoniae strain A3295 plasmid pA3295-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
856. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MG288683 (Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
857. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MG288683 (Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
858. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MG288683 (Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
859. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP033755 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
860. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029441 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
861. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029441 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
862. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029441 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
863. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP032169 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
864. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP032169 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
865. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
866. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
867. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
868. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
869. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034407 (Klebsiella pneumoniae strain NH34 plasmid pNH34.2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
870. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034407 (Klebsiella pneumoniae strain NH34 plasmid pNH34.2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
871. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031720 (Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
872. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031720 (Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
873. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031720 (Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
874. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN661404 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
875. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN661404 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
876. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN661404 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
877. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MT090958 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
878. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MT090958 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
879. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MT090958 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
880. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MT108209 (Klebsiella pneumoniae strain BJ108 plasmid pBJ108-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
881. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MT108209 (Klebsiella pneumoniae strain BJ108 plasmid pBJ108-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
882. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MT108209 (Klebsiella pneumoniae strain BJ108 plasmid pBJ108-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
883. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040535 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
884. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040535 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
885. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040535 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
886. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to LK391770 (Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
887. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to LK391770 (Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
888. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
889. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
890. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
891. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
892. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
893. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
894. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
895. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
896. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
897. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY270850 (Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
898. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY270850 (Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
899. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY270850 (Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
900. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
901. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
902. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
903. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
904. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
905. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
906. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
907. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
908. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
909. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
910. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
911. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
912. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
913. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
914. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
915. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
916. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
917. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
918. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
919. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
920. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026133 (Klebsiella pneumoniae strain F5 plasmid pF5_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
921. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026133 (Klebsiella pneumoniae strain F5 plasmid pF5_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
922. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040994 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
923. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040994 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
924. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040994 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
925. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
926. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
927. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
928. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
929. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
930. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
931. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
932. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
933. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
934. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
935. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
936. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP037744 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
937. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
938. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
939. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_009651 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN5, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
940. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
941. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
942. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
943. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
944. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
945. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
946. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_AP018754 (Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
947. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_AP018754 (Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
948. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
949. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
950. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
951. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
952. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
953. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
954. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
955. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
956. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
957. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
958. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
959. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
960. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
961. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
962. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
963. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
964. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP033395 (Klebsiella pneumoniae strain WCHKP015625 plasmid pKPC12_015625, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
965. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP033395 (Klebsiella pneumoniae strain WCHKP015625 plasmid pKPC12_015625, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
966. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
967. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
968. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
969. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
970. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
971. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_AP023150 (Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03M, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
972. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
973. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
974. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
975. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
976. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
977. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
978. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
979. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MT066418 (Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
980. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MT066418 (Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
981. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
982. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
983. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
984. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
985. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
986. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
987. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
988. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
989. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
990. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
991. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
992. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
993. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
994. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
995. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
996. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
997. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
998. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
999. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020852 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1000. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1001. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1002. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1003. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1004. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN891681 (Klebsiella pneumoniae strain 14899 plasmid p14899-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1005. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN891681 (Klebsiella pneumoniae strain 14899 plasmid p14899-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1006. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1007. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1008. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1009. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1010. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1011. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1012. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1013. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1014. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1015. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1016. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_FO834905 (Klebsiella pneumoniae strain Kp52.145 plasmid II, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1017. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1018. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1019. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1020. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1021. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1022. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1023. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN310380 (Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1024. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1025. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1026. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1027. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1028. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1029. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1030. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1031. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1032. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1033. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018818 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1034. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018818 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1035. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1036. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1037. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1038. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1039. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1040. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1041. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1042. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1043. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1044. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1045. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1046. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1047. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1048. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1049. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1050. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1051. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1052. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1053. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1054. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1055. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1056. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1057. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1058. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP042483 (Klebsiella pneumoniae strain C51 plasmid pC51_002, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1059. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1060. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1061. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027616 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1062. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1063. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1064. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1065. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1066. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1067. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1068. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1069. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1070. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1071. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1072. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1073. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1074. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP010881 (Escherichia coli strain MNCRE44 plasmid pMNCRE44_5, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1075. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1076. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1077. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1078. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1079. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1080. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1081. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034325 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-CTX-M-3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1082. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1083. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1084. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1085. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1086. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1087. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1088. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1089. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1090. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028991 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1091. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028991 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1092. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1093. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1094. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029583 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1095. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1096. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1097. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1098. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1099. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1100. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1101. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1102. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1103. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1104. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1105. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1106. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1107. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1108. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1109. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1110. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1111. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1112. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1113. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1114. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP038003 (Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1115. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP038003 (Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1116. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1117. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1118. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1119. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP007736 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-b0b, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1120. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026179 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPC-224e, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1121. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026180 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1122. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026180 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1123. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1124. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1125. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031851 (Klebsiella pneumoniae strain 121 plasmid pKP121-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1126. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031851 (Klebsiella pneumoniae strain 121 plasmid pKP121-2, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1127. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1128. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1129. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1130. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1131. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1132. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1133. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1134. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041648 (Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1135. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1136. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1137. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1138. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1139. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 5, identity: 0.828
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcttt Protospacer
********************** *.* .
1140. spacer 3.5|3727455|29|NZ_CP017453|PILER-CR matches to NZ_CP040097 (Pantoea sp. SO10 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
cagataataccttctttacctgtctttct CRISPR spacer
cagataatatcttctttaactgttctttt Protospacer
*********.******** ****..**.*
1141. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to LK391770 (Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1142. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to LK391770 (Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1143. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1144. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1145. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026280 (Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1146. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026280 (Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1147. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026283 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-e6bf, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1148. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1149. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1150. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1151. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1152. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1153. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1154. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1155. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1156. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1157. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KY689238 (Klebsiella pneumoniae strain TP-P16 plasmid pKPC_P16, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1158. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1159. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1160. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1161. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1162. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1163. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1164. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1165. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1166. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1167. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1168. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1169. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1170. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1171. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1172. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1173. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1174. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1175. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1176. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1177. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1178. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1179. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1180. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1181. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1182. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1183. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1184. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1185. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1186. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1187. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1188. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1189. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1190. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1191. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1192. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1193. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026133 (Klebsiella pneumoniae strain F5 plasmid pF5_1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1194. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP040994 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1195. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP040994 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1196. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP040994 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1197. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1198. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1199. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1200. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1201. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1202. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1203. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1204. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1205. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1206. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052165 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1207. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1208. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1209. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1210. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1211. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1212. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1213. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1214. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1215. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1216. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1217. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1218. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1219. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1220. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1221. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP037444 (Klebsiella sp. PO552 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1222. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1223. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1224. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1225. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1226. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1227. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1228. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1229. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1230. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1231. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1232. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1233. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1234. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1235. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1236. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1237. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1238. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1239. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1240. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1241. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1242. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1243. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1244. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1245. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1246. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1247. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP020508 (Serratia marcescens strain BWH-35 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1248. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP033394 (Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1249. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1250. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1251. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1252. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1253. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1254. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1255. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052145 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1256. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052145 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1257. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1258. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1259. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP028955 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1260. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1261. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1262. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1263. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP036362 (Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1264. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1265. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1266. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1267. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1268. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1269. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1270. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1271. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1272. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1273. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to HG969999 (Klebsiella pneumoniae plasmid pIT-FIPP-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1274. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1275. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP020506 (Serratia marcescens strain 95 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1276. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1277. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP034777 (Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1278. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1279. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1280. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1281. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1282. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1283. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1284. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1285. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1286. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1287. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1288. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1289. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1290. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1291. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1292. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1293. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK312247 (Klebsiella pneumoniae strain K232 plasmid pK232_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1294. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1295. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1296. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1297. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1298. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1299. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1300. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN891677 (Klebsiella pneumoniae strain ZZ41 plasmid pZZ41-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1301. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1302. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1303. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN891679 (Klebsiella pneumoniae strain ZZ40 plasmid pZZ40-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1304. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1305. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1306. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1307. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1308. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1309. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1310. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1311. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1312. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1313. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1314. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP027056 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1315. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1316. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1317. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1318. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1319. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1320. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1321. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1322. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1323. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1324. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1325. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1326. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MG700549 (Klebsiella pneumoniae strain st015256/1 plasmid pUJ-83KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1327. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1328. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052219 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1329. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052219 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1330. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1331. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1332. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1333. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1334. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1335. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1336. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1337. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1338. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1339. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1340. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1341. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1342. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1343. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1344. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1345. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1346. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1347. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1348. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_021655 (Klebsiella pneumoniae plasmid pKpQIL-LS6, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1349. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP018992 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1350. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP018992 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1351. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1352. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1353. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1354. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1355. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1356. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1357. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1358. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1359. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1360. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1361. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1362. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1363. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1364. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1365. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1366. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1367. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1368. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1369. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1370. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1371. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1372. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1373. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1374. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1375. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1376. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1377. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1378. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1379. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP028991 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1380. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1381. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1382. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1383. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1384. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1385. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1386. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1387. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1388. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1389. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1390. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1391. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP045217 (Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1392. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1393. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1394. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1395. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1396. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1397. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1398. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1399. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1400. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1401. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026173 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1402. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026173 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1403. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1404. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1405. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1406. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1407. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1408. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1409. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1410. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1411. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1412. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1413. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1414. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1415. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1416. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1417. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1418. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1419. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1420. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1421. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1422. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1423. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP041648 (Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1424. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1425. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1426. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1427. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1428. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1429. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1430. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1431. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1432. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1433. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1434. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1435. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1436. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1437. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1438. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1439. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1440. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1441. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP033947 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1442. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1443. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1444. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1445. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1446. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1447. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP028553 (Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1448. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1449. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1450. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1451. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1452. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP046952 (Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1453. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP046952 (Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1454. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP046952 (Klebsiella pneumoniae strain BD_DM_914 plasmid pKP914, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1455. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP046942 (Klebsiella pneumoniae strain BD_DM_697 plasmid pKP697) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1456. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP046947 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed8) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1457. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP009115 (Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1458. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1459. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1460. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1461. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1462. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1463. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1464. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1465. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1466. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP048380 (Klebsiella variicola strain 118 plasmid p118_A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1467. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026396 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1468. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026396 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1469. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1470. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1471. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1472. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP041250 (Raoultella electrica strain DSM 102253 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1473. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1474. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1475. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1476. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1477. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1478. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP025966 (Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1479. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP020065 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1480. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1481. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1482. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP029435 (Klebsiella quasipneumoniae strain CAV2013 plasmid pCAV2013-156, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1483. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1484. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP029430 (Klebsiella quasipneumoniae strain CAV2018 plasmid pCAV2018-177, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1485. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP038279 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1486. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1487. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1488. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1489. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1490. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1491. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP050170 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1492. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1493. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1494. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP025516 (Klebsiella pneumoniae strain 002SK2 plasmid p002SK2_A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1495. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1496. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1497. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1498. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1499. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1500. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1501. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1502. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1503. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1504. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP016891 (Pantoea agglomerans strain C410P1 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ggagggattcagcggagcttaccggctttgcc Protospacer
. **.***.*********************
1505. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP046384 (Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1506. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP046384 (Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1507. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP046384 (Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1508. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1509. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1510. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1511. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1512. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1513. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1514. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1515. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1516. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP030342 (Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1517. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP030342 (Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1518. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP030342 (Klebsiella pneumoniae strain AR_362 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1519. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1520. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1521. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026141 (Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1522. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1523. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP023916 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1524. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP023725 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1525. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026584 (Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1526. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1527. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1528. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1529. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP045678 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1530. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP045678 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1531. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP045678 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_5, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1532. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1533. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026212 (Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1534. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026212 (Citrobacter sp. CFNIH10 plasmid pCIT-a850, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1535. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP029723 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1536. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1537. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1538. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN823996 (Klebsiella pneumoniae strain 0239 plasmid p0239-FIIK, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1539. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN824001 (Klebsiella pneumoniae strain N201205880 plasmid p205880-1FIIK, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1540. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1541. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1542. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1543. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1544. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP011630 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-49, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1545. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1546. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1547. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1548. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP024510 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1549. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP032189 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1550. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP032189 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1551. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP036366 (Klebsiella pneumoniae strain WCHKP115068 plasmid pCTXM65_115068, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1552. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN842291 (Klebsiella pneumoniae strain 11935 plasmid p11935-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1553. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN842292 (Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1554. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1555. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1556. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1557. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1558. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1559. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1560. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1561. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1562. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1563. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1564. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP016403 (Klebsiella pneumoniae subsp. pneumoniae strain F5 plasmid pF5, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1565. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1566. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1567. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP015823 (Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1568. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1569. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1570. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP044395 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1571. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP044395 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1572. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP044395 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-2_MCR8, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1573. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1574. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1575. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1576. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1577. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1578. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1579. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1580. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1581. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1582. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1583. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_AP018674 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1584. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_AP018674 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1585. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1586. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1587. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP021946 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1588. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP031652 (Pantoea agglomerans strain TH81 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
gaaggggttcggcggagcttaccggcaatgcc Protospacer
. ********************** ****
1589. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1590. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP028479 (Klebsiella pneumoniae strain 2e plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1591. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP027158 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1592. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP027158 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1593. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP027158 (Klebsiella pneumoniae strain AR_0361 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1594. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP027067 (Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1595. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP025010 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1596. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP025010 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1597. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP025010 (Klebsiella pneumoniae strain AUSMDU00008119 plasmid pAUSMDU8119-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1598. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1599. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1600. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1601. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP034125 (Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1602. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1603. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP041937 (Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1604. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1605. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1606. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1607. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP035124 (Escherichia coli strain EC25 plasmid pEC25-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1608. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1609. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1610. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1611. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1612. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1613. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_016846 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1614. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1615. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1616. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1617. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP024484 (Klebsiella pneumoniae strain INF322 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1618. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP034085 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-CTX, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1619. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP050282 (Klebsiella pneumoniae strain 9949 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1620. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1621. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1622. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1623. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1624. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1625. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1626. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1627. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1628. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1629. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1630. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1631. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1632. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP028717 (Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1633. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1634. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1635. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1636. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1637. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1638. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1639. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1640. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1641. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1642. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1643. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1644. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP044369 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-1_MCR8, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1645. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP054734 (Klebsiella pneumoniae strain KP20194d plasmid pKP20194d-p2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1646. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1647. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP028389 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pKPC2_095132, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1648. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP050278 (Klebsiella pneumoniae strain 10553 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1649. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK649823 (Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1650. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1651. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052316 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1652. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052316 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1653. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052316 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1654. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052316 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1655. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP023942 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1656. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1657. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP037930 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid p8788-IT, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1658. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP037930 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid p8788-IT, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1659. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP037930 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid p8788-IT, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1660. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP019904 (Escherichia coli strain MDR_56 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1661. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1662. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1663. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1664. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP015395 (Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1665. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP015395 (Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1666. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP015395 (Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1667. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1668. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP018955 (Escherichia coli strain Ecol_316 plasmid pEC316_2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1669. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP018955 (Escherichia coli strain Ecol_316 plasmid pEC316_2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1670. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP047634 (Klebsiella pneumoniae strain K2606 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1671. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN891678 (Klebsiella pneumoniae strain Kpn47 plasmid pKpn47-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1672. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1673. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1674. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1675. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP052496 (Klebsiella pneumoniae strain B17KP0067 plasmid pB17KP0067-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1676. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1677. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1678. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1679. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1680. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MK167987 (Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1681. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MK167987 (Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1682. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MK167987 (Klebsiella pneumoniae strain 6BS12CTX plasmid pHNBS12, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1683. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MK433206 (Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1684. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1685. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1686. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1687. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MN543570 (Klebsiella pneumoniae strain HKU49 plasmid pHKU49_CIP, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1688. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP044045 (Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1689. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN657251 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1690. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN657251 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1691. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN657251 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKPC-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1692. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP050286 (Klebsiella pneumoniae strain 9630 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1693. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to CP050286 (Klebsiella pneumoniae strain 9630 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1694. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MH909340 (Klebsiella pneumoniae strain A1763 plasmid pA1763-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1695. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1696. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1697. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1698. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MK413718 (Klebsiella pneumoniae strain 427113 plasmid p427113-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1699. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1700. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MH263653 (Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1701. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MH464586 (Klebsiella pneumoniae strain KP1572 plasmid pIMP1572, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1702. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MK036887 (Klebsiella pneumoniae strain 397108 plasmid p397108-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1703. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MK036888 (Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1704. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN657248 (Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1705. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1706. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP014777 (Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1707. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1708. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1709. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1710. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MF133495 (Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1711. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MF168404 (Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1712. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1713. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1714. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MF168402 (Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1715. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP018455 (Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1716. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1717. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1718. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP030134 (Klebsiella pneumoniae strain 160111 plasmid pKPC2_L111, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1719. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP035536 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1720. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MG252894 (Klebsiella pneumoniae strain Kpn-35963cz plasmid pKpn-35963cz, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1721. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MG736312 (Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1722. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MG736312 (Klebsiella pneumoniae strain KP91 plasmid pKP91, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1723. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MG288683 (Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1724. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP026370 (Klebsiella quasipneumoniae strain A708 plasmid pA708-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1725. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP035204 (Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1726. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP035204 (Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1727. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP035204 (Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1728. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP025463 (Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1729. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP029441 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1730. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP029441 (Klebsiella quasipneumoniae strain CAV1947 plasmid pCAV1947-173, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1731. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP032169 (Klebsiella pneumoniae strain AR_0076 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1732. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1733. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1734. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1735. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP031720 (Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1736. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN661404 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1737. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN661404 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1738. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MT090958 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1739. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MT108207 (Klebsiella pneumoniae strain A1750 plasmid pA1750-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1740. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MT108209 (Klebsiella pneumoniae strain BJ108 plasmid pBJ108-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1741. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MT108210 (Klebsiella pneumoniae strain W09308 plasmid pW09308-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1742. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MT108212 (Klebsiella pneumoniae strain 12478 plasmid p12478-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1743. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MT108213 (Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1744. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MT108213 (Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1745. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MT108213 (Klebsiella pneumoniae strain ZZ100 plasmid pZZ100-KPC, complete sequence) position: , mismatch: 6, identity: 0.812
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcggagcttaccgcgtctttt Protospacer
************************ *.* ..
1746. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
agggattcggcggagcttaccggcacagc Protospacer
. **.******************* . **
1747. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
agggattcggcggagcttaccggcgcagc Protospacer
. **.******************* . **
1748. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
agggattcggcggagcttaccggcgcagc Protospacer
. **.******************* . **
1749. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
agggattcggcggagcttaccggcacagc Protospacer
. **.******************* . **
1750. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028554 (Klebsiella variicola strain WCHKP19 plasmid pKPC2_020019, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1751. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028554 (Klebsiella variicola strain WCHKP19 plasmid pKPC2_020019, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1752. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP028554 (Klebsiella variicola strain WCHKP19 plasmid pKPC2_020019, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1753. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026280 (Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagtttaccgcatcttt Protospacer
***************.****** *.* .
1754. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY399973 (Enterobacter cloacae strain EClY2403 plasmid pKPC2_EClY2403, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1755. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY399973 (Enterobacter cloacae strain EClY2403 plasmid pKPC2_EClY2403, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1756. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY399973 (Enterobacter cloacae strain EClY2403 plasmid pKPC2_EClY2403, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1757. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY399972 (Enterobacter cloacae strain EClY2402 plasmid pKPC2_EClY2402, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1758. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY399972 (Enterobacter cloacae strain EClY2402 plasmid pKPC2_EClY2402, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1759. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KY399972 (Enterobacter cloacae strain EClY2402 plasmid pKPC2_EClY2402, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1760. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP032198 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1761. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP050837 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1762. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP050837 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1763. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KP868646 (Enterobacter cloacae strain WCHECl-14653 plasmid pKPC2-EC14653, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1764. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KP868646 (Enterobacter cloacae strain WCHECl-14653 plasmid pKPC2-EC14653, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1765. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KP868646 (Enterobacter cloacae strain WCHECl-14653 plasmid pKPC2-EC14653, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1766. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1767. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1768. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1769. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1770. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1771. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP023418 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1772. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP023418 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1773. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP023418 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1774. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1775. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1776. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcatt Protospacer
********************** *. .
1777. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1778. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1779. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1780. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1781. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1782. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagtttaccgcatcttt Protospacer
***************.****** *.* .
1783. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1784. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1785. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1786. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025040 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1787. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025040 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1788. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025040 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1789. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027614 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1790. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027614 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1791. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1792. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1793. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1794. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022349 (Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1795. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022349 (Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1796. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022349 (Klebsiella michiganensis strain K516 plasmid pK516_KPC, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1797. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_LT991960 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1798. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_LT991960 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1799. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_LT991960 (Enterobacter cloacae complex sp. isolate C45 plasmid pC45-p3) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1800. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1801. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026173 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-c4ac, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagtttaccgcatcttt Protospacer
***************.****** *.* .
1802. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026181 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1803. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026181 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1804. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026181 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1805. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1806. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1807. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1808. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to KY940546 (Klebsiella pneumoniae plasmid pUCLA3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1809. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to KY940546 (Klebsiella pneumoniae plasmid pUCLA3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1810. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to KY940546 (Klebsiella pneumoniae plasmid pUCLA3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1811. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1812. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1813. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1814. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagtttaccgcgtcttt Protospacer
***************.****** *.* .
1815. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008932 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-C, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagctaaccgcgtcttt Protospacer
***************** **** *.* .
1816. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP006922 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1817. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP006922 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1818. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP006922 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1819. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041249 (Raoultella electrica strain DSM 102253 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1820. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041249 (Raoultella electrica strain DSM 102253 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1821. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041249 (Raoultella electrica strain DSM 102253 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1822. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagtttaccgcatcttt Protospacer
***************.****** *.* .
1823. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008843 (Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1824. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP008843 (Klebsiella michiganensis strain M1 plasmid pKOXM1B, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1825. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1826. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1827. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1828. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1829. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024642 (Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1830. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024642 (Klebsiella michiganensis strain F107 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1831. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1832. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1833. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagtttaccgcgtcttt Protospacer
***************.****** *.* .
1834. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagtttaccgcgtcttt Protospacer
***************.****** *.* .
1835. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP042547 (Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1836. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP042547 (Klebsiella michiganensis strain C52 plasmid pC52_002, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1837. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1838. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1839. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1840. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1841. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011634 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1842. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011634 (Klebsiella oxytoca strain CAV1374 plasmid pCAV1374-228, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1843. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024509 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1844. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024509 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1845. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024509 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1846. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1847. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1848. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcagagcttaccgcgtcttt Protospacer
***********.********** *.* .
1849. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP036439 (Klebsiella pneumoniae strain ABFQB plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcatt Protospacer
********************** *. .
1850. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011621 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1851. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011621 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1852. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP011621 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1853. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagtttaccgcgtcttt Protospacer
***************.****** *.* .
1854. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041937 (Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1855. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041937 (Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1856. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP041937 (Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1857. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052438 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1858. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052438 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1859. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052438 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1860. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024544 (Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1861. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024544 (Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1862. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP024544 (Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1863. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_AP014954 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1864. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_AP014954 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1865. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_AP014954 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1866. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1867. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1868. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1869. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MH192342 (Klebsiella grimontii strain WCHKG020121 plasmid pKPC2_020121, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1870. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MH192342 (Klebsiella grimontii strain WCHKG020121 plasmid pKPC2_020121, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1871. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_MH192342 (Klebsiella grimontii strain WCHKG020121 plasmid pKPC2_020121, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1872. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1873. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1874. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1875. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1876. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagtttaccgcgtcttt Protospacer
***************.****** *.* .
1877. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN661403 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1878. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN661403 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1879. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN661403 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1880. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1881. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020359 (Klebsiella oxytoca strain AR_0147 plasmid unitig_2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1882. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020359 (Klebsiella oxytoca strain AR_0147 plasmid unitig_2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1883. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP020359 (Klebsiella oxytoca strain AR_0147 plasmid unitig_2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1884. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcatt Protospacer
********************** *. .
1885. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP048110 (Klebsiella michiganensis strain BD177 plasmid unnamed2) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1886. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP048110 (Klebsiella michiganensis strain BD177 plasmid unnamed2) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1887. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP048111 (Klebsiella michiganensis strain BD177 plasmid unnamed3) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1888. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022275 (Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1889. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022275 (Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1890. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022275 (Citrobacter freundii strain 18-1 plasmid pBKPC18-1, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1891. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MN310380 (Raoultella ornithinolytica strain 170602815 plasmid p602815-NR, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcatt Protospacer
********************** *. .
1892. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1893. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1894. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcatt Protospacer
********************** *. .
1895. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1896. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to CP052321 (Klebsiella pneumoniae strain E16KP0035 plasmid pE16KP0035-1, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagtttaccgcgtcttt Protospacer
***************.****** *.* .
1897. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026271 (Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1898. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026271 (Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1899. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026271 (Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1900. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP027616 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1901. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1902. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagtttaccgcgtcttt Protospacer
***************.****** *.* .
1903. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1904. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026174 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1905. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026174 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcgtcctt Protospacer
********************** *.. .
1906. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP026174 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcggagcttaccgcatcctt Protospacer
********************** *.. .
1907. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 6, identity: 0.793
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgtagcttaccgcgtcttt Protospacer
************ ********* *.* .
1908. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt Protospacer
************** ********* *.* ..
1909. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt Protospacer
************** ********* *.* ..
1910. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt Protospacer
************** ********* *.* ..
1911. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt Protospacer
************** ********* *.* ..
1912. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt Protospacer
************** ********* *.* ..
1913. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt Protospacer
************** ********* *.* ..
1914. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt Protospacer
************** ********* *.* ..
1915. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ctgcgggttcggcggagcttaccgcgtctttt Protospacer
.*********************** *.* ..
1916. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt Protospacer
************** ********* *.* ..
1917. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt Protospacer
************** ********* *.* ..
1918. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP017935 (Klebsiella pneumoniae strain CAV1016 plasmid pCAV1016-90, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt Protospacer
************** ********* *.* ..
1919. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt Protospacer
************** ********* *.* ..
1920. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt Protospacer
************** ********* *.* ..
1921. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN823985 (Serratia marcescens strain 160316055 plasmid p16055-KPC, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt Protospacer
************** ********* *.* ..
1922. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt Protospacer
************** ********* *.* ..
1923. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcagagcttaccgcgtctttt Protospacer
*************.********** *.* ..
1924. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt Protospacer
************** ********* *.* ..
1925. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP021741 (Klebsiella pneumoniae strain AR_0126 plasmid tig00000001, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt Protospacer
************** ********* *.* ..
1926. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
tagcgggttcggcggagcttaccgggtgctaa Protospacer
* *********************** * .
1927. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 7, identity: 0.781
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ttgcgggttcggcgtagcttaccgcgtctttt Protospacer
************** ********* *.* ..
1928. spacer 3.3|3727453|32|NZ_CP017453|CRT matches to NZ_CP040097 (Pantoea sp. SO10 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
gccagataataccttctttacctgtctttctt CRISPR spacer
cccagataatatcttctttaactgttctttta Protospacer
**********.******** ****..**.*
1929. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 7, identity: 0.759
gcgggttcggcggagcttaccggctttgc CRISPR spacer
cgcggtccggcggagcttaccggcgcagc Protospacer
***.***************** . **
1930. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034472 (Pantoea agglomerans strain CFSAN047153 plasmid pCFSAN047153_3, complete sequence) position: , mismatch: 7, identity: 0.759
gcgggttcggcggagcttaccggctttgc CRISPR spacer
cgcggtccggcggagcttaccggcacagc Protospacer
***.***************** . **
1931. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 7, identity: 0.759
gcgggttcggcggagcttaccggctttgc CRISPR spacer
cgcggtccggcggagcttaccggcacagc Protospacer
***.***************** . **
1932. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP034477 (Pantoea agglomerans strain CFSAN047154 plasmid pCFSAN047154_3, complete sequence) position: , mismatch: 7, identity: 0.759
gcgggttcggcggagcttaccggctttgc CRISPR spacer
cgcggtccggcggagcttaccggcgcagc Protospacer
***.***************** . **
1933. spacer 3.4|3727395|29|NZ_CP017453|PILER-CR matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 7, identity: 0.759
gcgggttcggcggagcttaccggctttgc CRISPR spacer
gcgggttcggcgaagcttaccgcgtcctt Protospacer
************.********* *.. .
1934. spacer 3.5|3727455|29|NZ_CP017453|PILER-CR matches to MN693242 (Marine virus AFVG_25M170, complete genome) position: , mismatch: 7, identity: 0.759
cagataataccttctttacctgtctttct CRISPR spacer
gaacgtatcccatctttacctgtctttct Protospacer
*. ** ** *****************
1935. spacer 3.2|3727393|32|NZ_CP017453|CRT matches to NZ_CP014126 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgcgggttcggcggagcttaccggctttgcc CRISPR spacer
ggaggggttcggcggagcttagcggcttgccg Protospacer
. ***************** ****** *
1936. spacer 3.3|3727453|32|NZ_CP017453|CRT matches to MN693242 (Marine virus AFVG_25M170, complete genome) position: , mismatch: 8, identity: 0.75
gccagataatacct--tctttacctgtctttctt CRISPR spacer
--tagaacgtatcccatctttacctgtctttctt Protospacer
.*** .**.*. ******************
1937. spacer 3.5|3727455|29|NZ_CP017453|PILER-CR matches to NC_019401 (Cronobacter phage vB_CsaM_GAP32, complete genome) position: , mismatch: 8, identity: 0.724
cagataataccttctttacctgtctttct CRISPR spacer
aagataatactttctatacctgtcaagac Protospacer
*********.**** ******** .
1938. spacer 3.3|3727453|32|NZ_CP017453|CRT matches to NC_019401 (Cronobacter phage vB_CsaM_GAP32, complete genome) position: , mismatch: 11, identity: 0.656
gccagataataccttctttacctgtctttctt CRISPR spacer
agaagataatactttctatacctgtcaagacg Protospacer
. *********.**** ******** .