Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP024199 Thalassospira marina strain CSC3H3 chromosome, complete genome 1 crisprs csa3,DinG,WYL,DEDDh,RT 0 1 3 0
NZ_CP024200 Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP024199
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024199_1 3765933-3766010 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP024199_1 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder 3765957-3765986 30 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 250687-250716 8 0.733
NZ_CP024199_1 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder 3765957-3765986 30 NZ_KT020860 Yersinia pestis strain I-2638 plasmid pTP33, complete sequence 21019-21048 8 0.733
NZ_CP024199_1 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder 3765957-3765986 30 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 1211868-1211897 8 0.733
NZ_CP024199_1 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder 3765957-3765986 30 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 431286-431315 8 0.733
NZ_CP024199_1 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder 3765957-3765986 30 NZ_CP045261 Yersinia pestis strain SCPM-O-B-5942 (I-2638) plasmid pTP33, complete sequence 27341-27370 8 0.733
NZ_CP024199_1 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder 3765957-3765986 30 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 959799-959828 8 0.733
NZ_CP024199_1 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder 3765957-3765986 30 NZ_CP045152 Yersinia pestis strain SCPM-O-DNA-18 (I-3113) plasmid pTP33, complete sequence 10322-10351 8 0.733
NZ_CP024199_1 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder 3765957-3765986 30 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 1211868-1211897 8 0.733
NZ_CP024199_1 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder 3765957-3765986 30 NZ_CP030761 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence 625848-625877 8 0.733
NZ_CP024199_1 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder 3765957-3765986 30 NC_012848 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence 193103-193132 8 0.733
NZ_CP024199_1 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder 3765957-3765986 30 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 383336-383365 8 0.733
NZ_CP024199_1 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder 3765957-3765986 30 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 389779-389808 8 0.733
NZ_CP024199_1 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder 3765957-3765986 30 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 8188-8217 8 0.733
NZ_CP024199_1 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder 3765957-3765986 30 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 432481-432510 8 0.733
NZ_CP024199_1 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder 3765957-3765986 30 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 1191821-1191850 8 0.733
NZ_CP024199_1 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder 3765957-3765986 30 CP013974 Erwinia phage LS-2018a, complete sequence 7356-7385 8 0.733
NZ_CP024199_1 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder 3765957-3765986 30 CP013974 Erwinia phage LS-2018a, complete sequence 39154-39183 8 0.733

1. spacer 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatattaccagcctgcgcgacggggcag	CRISPR spacer
acgagattaccatcctgcgcgacgggcaga	Protospacer
 .** ******* *************  ..

2. spacer 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder matches to NZ_KT020860 (Yersinia pestis strain I-2638 plasmid pTP33, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatattaccagcctgcgcgacggggcag	CRISPR spacer
ttgaaattaccagcctgcgcgtcacctttg	Protospacer
**** **************** *.   . *

3. spacer 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatattaccagcctgcgcgacggggcag	CRISPR spacer
attatctcaccagcctgcgcgacgggcgga	Protospacer
 * ** *.******************  ..

4. spacer 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatattaccagcctgcgcgacggggcag	CRISPR spacer
attatctcaccagcctgcgcgacgggcgga	Protospacer
 * ** *.******************  ..

5. spacer 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder matches to NZ_CP045261 (Yersinia pestis strain SCPM-O-B-5942 (I-2638) plasmid pTP33, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatattaccagcctgcgcgacggggcag	CRISPR spacer
ttgaaattaccagcctgcgcgtcacctttg	Protospacer
**** **************** *.   . *

6. spacer 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatattaccagcctgcgcgacggggcag	CRISPR spacer
attatctcaccagcctgcgcgacgggcgga	Protospacer
 * ** *.******************  ..

7. spacer 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder matches to NZ_CP045152 (Yersinia pestis strain SCPM-O-DNA-18 (I-3113) plasmid pTP33, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatattaccagcctgcgcgacggggcag	CRISPR spacer
ttgaaattaccagcctgcgcgtcacctttg	Protospacer
**** **************** *.   . *

8. spacer 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatattaccagcctgcgcgacggggcag	CRISPR spacer
attatctcaccagcctgcgcgacgggcgga	Protospacer
 * ** *.******************  ..

9. spacer 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatattaccagcctgcgcgacggggcag	CRISPR spacer
cttatctcaccagcctgcgcgacgggcgga	Protospacer
.* ** *.******************  ..

10. spacer 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatattaccagcctgcgcgacggggcag	CRISPR spacer
attatctcaccagcctgcgcgacgggcgga	Protospacer
 * ** *.******************  ..

11. spacer 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatattaccagcctgcgcgacggggcag	CRISPR spacer
attatctcaccagcctgcgcgacgggcgga	Protospacer
 * ** *.******************  ..

12. spacer 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatattaccagcctgcgcgacggggcag	CRISPR spacer
attatctcaccagcctgcgcgacgggcgga	Protospacer
 * ** *.******************  ..

13. spacer 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatattaccagcctgcgcgacggggcag	CRISPR spacer
attatctcaccagcctgcgcgacgggcgga	Protospacer
 * ** *.******************  ..

14. spacer 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatattaccagcctgcgcgacggggcag	CRISPR spacer
attatctcaccagcctgcgcgacgggcgga	Protospacer
 * ** *.******************  ..

15. spacer 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatattaccagcctgcgcgacggggcag	CRISPR spacer
attatctcaccagcctgcgcgacgggcgga	Protospacer
 * ** *.******************  ..

16. spacer 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder matches to CP013974 (Erwinia phage LS-2018a, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatattaccagcctgcgcgacggggcag	CRISPR spacer
ttgaaattaccagcctgcgcgtcacctttg	Protospacer
**** **************** *.   . *

17. spacer 1.1|3765957|30|NZ_CP024199|CRISPRCasFinder matches to CP013974 (Erwinia phage LS-2018a, complete sequence) position: , mismatch: 8, identity: 0.733

ttgatattaccagcctgcgcgacggggcag	CRISPR spacer
ttgaaattaccagcctgcgcgtcacctttg	Protospacer
**** **************** *.   . *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2009902 : 2016509 8 uncultured_Mediterranean_phage(85.71%) tRNA NA
DBSCAN-SWA_2 3341613 : 3362307 28 Pseudomonas_phage(11.76%) protease,head NA
DBSCAN-SWA_3 4196936 : 4206673 9 Klosneuvirus(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage