Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP025057 Spiroplasma floricola 23-6 chromosome, complete genome 1 crisprs csa3,RT 0 2 2 0

Results visualization

1. NZ_CP025057
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP025057_1 209039-209228 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP025057_1 1.1|209079|35|NZ_CP025057|PILER-CR 209079-209113 35 NZ_CP014068 Enterococcus gallinarum strain FDAARGOS_163 plasmid unnamed, complete sequence 22758-22792 8 0.771
NZ_CP025057_1 1.2|209154|35|NZ_CP025057|PILER-CR 209154-209188 35 NC_019521 Sphingomonas phage PAU, complete genome 80069-80103 9 0.743

1. spacer 1.1|209079|35|NZ_CP025057|PILER-CR matches to NZ_CP014068 (Enterococcus gallinarum strain FDAARGOS_163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.771

ttcaaatgtaacaaacatgagtggaatgtttttat	CRISPR spacer
atccaatgtaacaaacatgagtggcatgttcagta	Protospacer
 ** ******************** *****.    

2. spacer 1.2|209154|35|NZ_CP025057|PILER-CR matches to NC_019521 (Sphingomonas phage PAU, complete genome) position: , mismatch: 9, identity: 0.743

gtcaaaagtaactaatatgtcaaacttgtttaaca	CRISPR spacer
tagtaaagtaactaatatgtcaagcatgttcagaa	Protospacer
    *******************.* ****.*. *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4587 : 18682 12 Streptococcus_phage(25.0%) tRNA NA
DBSCAN-SWA_2 96911 : 107275 8 Staphylococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage