Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP022549 Sphingorhabdus sp. YGSMI21 plasmid unnamed, complete sequence 1 crisprs csa3 0 1 0 0
NZ_CP022548 Sphingorhabdus sp. YGSMI21 chromosome, complete genome 2 crisprs DEDDh,WYL,DinG,csa3 0 0 3 0

Results visualization

1. NZ_CP022548
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022548_1 2034684-2034772 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022548_2 2924474-2924587 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8013 : 64224 43 Bacillus_phage(16.67%) transposase,integrase attL 19735:19750|attR 66948:66963
DBSCAN-SWA_2 1449445 : 1474624 21 Wolbachia_phage(50.0%) holin,transposase NA
DBSCAN-SWA_3 1792506 : 1799652 12 Geobacillus_phage(25.0%) portal,capsid,protease,head,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP022549
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022549_1 18917-18990 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP022549_1 1.1|18941|26|NZ_CP022549|CRISPRCasFinder 18941-18966 26 NZ_CP022549 Sphingorhabdus sp. YGSMI21 plasmid unnamed, complete sequence 18941-18966 0 1.0

1. spacer 1.1|18941|26|NZ_CP022549|CRISPRCasFinder matches to NZ_CP022549 (Sphingorhabdus sp. YGSMI21 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ctggaccgcgaatccagtggcgaaaa	CRISPR spacer
ctggaccgcgaatccagtggcgaaaa	Protospacer
**************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage