Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP024598 Porphyromonas gingivalis strain KCOM 2798 chromosome, complete genome 6 crisprs cas1,cas9,DEDDh,cas3,cas13b,Csx28 3 30 165 3

Results visualization

1. NZ_CP024598
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024598_1 352994-353097 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024598_2 372546-375021 TypeII NA
32 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024598_3 828205-828299 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024598_4 1488948-1489975 TypeVI-B2,TypeVI-B1 VI-B2
15 spacers
Csx28,cas13b

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024598_5 2115585-2115681 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024598_6 2129547-2129643 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP024598_3 3.1|828235|35|NZ_CP024598|CRISPRCasFinder 828235-828269 35 NZ_CP024598.1 1221431-1221465 0 1.0
NZ_CP024598_6 6.1|2129579|33|NZ_CP024598|CRISPRCasFinder 2129579-2129611 33 NZ_CP024598.1 1146157-1146189 1 0.97
NZ_CP024598_5 5.1|2115616|35|NZ_CP024598|CRISPRCasFinder 2115616-2115650 35 NZ_CP024598.1 1819215-1819249 2 0.943

1. spacer 3.1|828235|35|NZ_CP024598|CRISPRCasFinder matches to position: 1221431-1221465, mismatch: 0, identity: 1.0

ttttcacgaagctggaggccatactcgctcgtctt	CRISPR spacer
ttttcacgaagctggaggccatactcgctcgtctt	Protospacer
***********************************

2. spacer 6.1|2129579|33|NZ_CP024598|CRISPRCasFinder matches to position: 1146157-1146189, mismatch: 1, identity: 0.97

tcctccacgatctcggtgtctgatctgcttttt	CRISPR spacer
tcctccacgacctcggtgtctgatctgcttttt	Protospacer
**********.**********************

3. spacer 5.1|2115616|35|NZ_CP024598|CRISPRCasFinder matches to position: 1819215-1819249, mismatch: 2, identity: 0.943

tatgctcacgccatgggcaattccaccggcaacct	CRISPR spacer
tacgctcacgccatgggcaattcgaccggcaacct	Protospacer
**.******************** ***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP024598_2 2.17|373808|30|NZ_CP024598|CRISPRCasFinder 373808-373837 30 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 46145-46174 5 0.833
NZ_CP024598_2 2.32|374946|30|NZ_CP024598|CRISPRCasFinder,PILER-CR 374946-374975 30 NC_042140 Bacillus virus BM15, complete genome 62622-62651 5 0.833
NZ_CP024598_2 2.32|374946|30|NZ_CP024598|CRISPRCasFinder,PILER-CR 374946-374975 30 MH638309 Bacillus phage Hobo, complete genome 62622-62651 5 0.833
NZ_CP024598_2 2.1|372592|30|NZ_CP024598|CRISPRCasFinder 372592-372621 30 NZ_CP013925 Acinetobacter baumannii strain KBN10P02143 plasmid pKBN10P02143, complete sequence 34821-34850 6 0.8
NZ_CP024598_2 2.2|372668|30|NZ_CP024598|CRISPRCasFinder 372668-372697 30 NZ_CP049297 Bacillus megaterium strain S188 plasmid pS188, complete sequence 7313-7342 6 0.8
NZ_CP024598_2 2.2|372668|30|NZ_CP024598|CRISPRCasFinder 372668-372697 30 NZ_CP017081 Bacillus muralis strain G25-68 plasmid pG25-68, complete sequence 34233-34262 6 0.8
NZ_CP024598_2 2.2|372668|30|NZ_CP024598|CRISPRCasFinder 372668-372697 30 MT708547 Klebsiella phage Muenster, complete genome 110752-110781 6 0.8
NZ_CP024598_2 2.13|373504|30|NZ_CP024598|CRISPRCasFinder 373504-373533 30 MT110073 Stenotrophomonas phage vB_SmaS_DLP_3, complete genome 25852-25881 6 0.8
NZ_CP024598_2 2.21|374111|30|NZ_CP024598|CRISPRCasFinder 374111-374140 30 MG945137 UNVERIFIED: Microviridae sp. isolate 235-1602, complete genome 1116-1145 6 0.8
NZ_CP024598_2 2.23|374263|30|NZ_CP024598|CRISPRCasFinder 374263-374292 30 LT960552 Yersinia phage fHe-Yen9-03 genome assembly, complete genome: monopartite 281213-281242 6 0.8
NZ_CP024598_2 2.26|374491|30|NZ_CP024598|CRISPRCasFinder 374491-374520 30 MN694076 Marine virus AFVG_250M1096, complete genome 28352-28381 6 0.8
NZ_CP024598_2 2.26|374491|30|NZ_CP024598|CRISPRCasFinder 374491-374520 30 MN694359 Marine virus AFVG_250M1098, complete genome 10094-10123 6 0.8
NZ_CP024598_2 2.26|374491|30|NZ_CP024598|CRISPRCasFinder 374491-374520 30 MN694688 Marine virus AFVG_250M1099, complete genome 10115-10144 6 0.8
NZ_CP024598_2 2.26|374491|30|NZ_CP024598|CRISPRCasFinder 374491-374520 30 MN694415 Marine virus AFVG_250M1100, complete genome 10095-10124 6 0.8
NZ_CP024598_2 2.26|374491|30|NZ_CP024598|CRISPRCasFinder 374491-374520 30 MN694502 Marine virus AFVG_250M1097, complete genome 10114-10143 6 0.8
NZ_CP024598_2 2.32|374946|30|NZ_CP024598|CRISPRCasFinder,PILER-CR 374946-374975 30 NC_027352 Bacillus phage JBP901, complete genome 123204-123233 6 0.8
NZ_CP024598_4 4.11|1489644|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489644-1489673 30 NZ_CP022140 Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K plasmid unnamed1, complete sequence 80591-80620 6 0.8
NZ_CP024598_4 4.11|1489644|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489644-1489673 30 NZ_CP022118 Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 plasmid unnamed1, complete sequence 222718-222747 6 0.8
NZ_CP024598_2 2.2|372668|30|NZ_CP024598|CRISPRCasFinder 372668-372697 30 NZ_KF559313 Lactobacillus sakei strain KCA311 plasmid pKCA15, complete sequence 2789-2818 7 0.767
NZ_CP024598_2 2.2|372668|30|NZ_CP024598|CRISPRCasFinder 372668-372697 30 NZ_KF559314 Lactobacillus sakei strain KCA311 plasmid pKCA9, complete sequence 1971-2000 7 0.767
NZ_CP024598_2 2.2|372668|30|NZ_CP024598|CRISPRCasFinder 372668-372697 30 CP033548 Acinetobacter nosocomialis strain 2014N23-120 plasmid p2014N23-120-3, complete sequence 4491-4520 7 0.767
NZ_CP024598_2 2.2|372668|30|NZ_CP024598|CRISPRCasFinder 372668-372697 30 NC_012923 Streptococcus suis BM407 plasmid pBM407, complete sequence 7884-7913 7 0.767
NZ_CP024598_2 2.2|372668|30|NZ_CP024598|CRISPRCasFinder 372668-372697 30 AM087120 Acidianus filamentous virus 3, partial viral genome 12322-12351 7 0.767
NZ_CP024598_2 2.3|372744|30|NZ_CP024598|CRISPRCasFinder 372744-372773 30 NZ_CP022549 Sphingorhabdus sp. YGSMI21 plasmid unnamed, complete sequence 192715-192744 7 0.767
NZ_CP024598_2 2.4|372820|30|NZ_CP024598|CRISPRCasFinder 372820-372849 30 NZ_CP016618 Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence 628737-628766 7 0.767
NZ_CP024598_2 2.4|372820|30|NZ_CP024598|CRISPRCasFinder 372820-372849 30 NZ_CP016617 Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence 914559-914588 7 0.767
NZ_CP024598_2 2.4|372820|30|NZ_CP024598|CRISPRCasFinder 372820-372849 30 NC_022042 Paracoccus aminophilus JCM 7686 plasmid pAMI1, complete sequence 64875-64904 7 0.767
NZ_CP024598_2 2.9|373200|30|NZ_CP024598|CRISPRCasFinder 373200-373229 30 NZ_LN907828 Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence 173897-173926 7 0.767
NZ_CP024598_2 2.11|373352|30|NZ_CP024598|CRISPRCasFinder 373352-373381 30 MN694201 Marine virus AFVG_250M801, complete genome 7368-7397 7 0.767
NZ_CP024598_2 2.13|373504|30|NZ_CP024598|CRISPRCasFinder 373504-373533 30 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 100670-100699 7 0.767
NZ_CP024598_2 2.14|373580|30|NZ_CP024598|CRISPRCasFinder 373580-373609 30 MH616728 Myoviridae sp. isolate ctge_1, complete genome 29125-29154 7 0.767
NZ_CP024598_2 2.19|373960|29|NZ_CP024598|CRISPRCasFinder 373960-373988 29 MK448726 Streptococcus phage Javan29, complete genome 12608-12636 7 0.759
NZ_CP024598_2 2.21|374111|30|NZ_CP024598|CRISPRCasFinder 374111-374140 30 NZ_CP013615 Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence 102942-102971 7 0.767
NZ_CP024598_2 2.22|374187|30|NZ_CP024598|CRISPRCasFinder 374187-374216 30 NZ_LT598658 Legionella pneumophila strain Lpm7613 isolate Lpm7613 plasmid 2 121418-121447 7 0.767
NZ_CP024598_2 2.22|374187|30|NZ_CP024598|CRISPRCasFinder 374187-374216 30 NC_018141 Legionella pneumophila subsp. pneumophila plasmid pLELO, complete sequence 8215-8244 7 0.767
NZ_CP024598_2 2.22|374187|30|NZ_CP024598|CRISPRCasFinder 374187-374216 30 NZ_CP021282 Legionella pneumophila subsp. pneumophila strain Flint 2 (D-7477) plasmid unnamed, complete sequence 76483-76512 7 0.767
NZ_CP024598_2 2.22|374187|30|NZ_CP024598|CRISPRCasFinder 374187-374216 30 NZ_CP045305 Legionella longbeachae strain B1445CHC plasmid pB1445CHC_150k, complete sequence 145839-145868 7 0.767
NZ_CP024598_2 2.22|374187|30|NZ_CP024598|CRISPRCasFinder 374187-374216 30 NZ_CP025492 Legionella sainthelensi strain LA01-117 plasmid pLA01-117_150k, complete sequence 80677-80706 7 0.767
NZ_CP024598_2 2.22|374187|30|NZ_CP024598|CRISPRCasFinder 374187-374216 30 NZ_CP021284 Legionella pneumophila subsp. pneumophila strain Allentown 1 (D-7475) plasmid unnamed1, complete sequence 1549-1578 7 0.767
NZ_CP024598_2 2.22|374187|30|NZ_CP024598|CRISPRCasFinder 374187-374216 30 NZ_CP042253 Legionella longbeachae strain B3526CHC plasmid pB3526CHC_150k, complete sequence 148027-148056 7 0.767
NZ_CP024598_2 2.22|374187|30|NZ_CP024598|CRISPRCasFinder 374187-374216 30 NZ_CP011106 Legionella pneumophila strain L10-023 isolate Ulm plasmid unnamed, complete sequence 5166-5195 7 0.767
NZ_CP024598_2 2.22|374187|30|NZ_CP024598|CRISPRCasFinder 374187-374216 30 NZ_LN681226 Legionella hackeliae strain ATCC 35250 plasmid II, complete sequence 80415-80444 7 0.767
NZ_CP024598_2 2.22|374187|30|NZ_CP024598|CRISPRCasFinder 374187-374216 30 NZ_CP016031 Legionella pneumophila strain OLDA plasmid unnamed, complete sequence 96781-96810 7 0.767
NZ_CP024598_2 2.22|374187|30|NZ_CP024598|CRISPRCasFinder 374187-374216 30 NZ_CP021287 Legionella pneumophila subsp. pneumophila strain Albuquerque 1 (D-7474) plasmid unnamed, complete sequence 21840-21869 7 0.767
NZ_CP024598_2 2.22|374187|30|NZ_CP024598|CRISPRCasFinder 374187-374216 30 NC_006365 Legionella pneumophila str. Paris plasmid pLPP, complete sequence 126950-126979 7 0.767
NZ_CP024598_2 2.22|374187|30|NZ_CP024598|CRISPRCasFinder 374187-374216 30 NZ_CP048619 Legionella pneumophila strain ERS1305867 plasmid unnamed, complete sequence 5828-5857 7 0.767
NZ_CP024598_4 4.5|1489248|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489248-1489277 30 NZ_CP005191 Sphingobium sp. MI1205 plasmid pMI2, complete sequence 149490-149519 7 0.767
NZ_CP024598_4 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489380-1489409 30 MN694748 Marine virus AFVG_250M355, complete genome 6091-6120 7 0.767
NZ_CP024598_4 4.8|1489446|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489446-1489475 30 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 1127739-1127768 7 0.767
NZ_CP024598_4 4.9|1489512|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489512-1489541 30 KU594606 Cyanophage S-RIM32 isolate RW_108_0702, complete genome 7146-7175 7 0.767
NZ_CP024598_4 4.9|1489512|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489512-1489541 30 KU594606 Cyanophage S-RIM32 isolate RW_108_0702, complete genome 91743-91772 7 0.767
NZ_CP024598_4 4.9|1489512|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489512-1489541 30 MK310226 Halobacterium virus ChaoS9, complete genome 29325-29354 7 0.767
NZ_CP024598_4 4.9|1489512|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489512-1489541 30 MH697579 Mycobacterium phage Cane17, complete genome 120521-120550 7 0.767
NZ_CP024598_4 4.9|1489512|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489512-1489541 30 MK359359 Mycobacterium phage Colt, complete genome 119752-119781 7 0.767
NZ_CP024598_4 4.9|1489512|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489512-1489541 30 AP014250 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S40-C9, *** SEQUENCING IN PROGRESS *** 13369-13398 7 0.767
NZ_CP024598_4 4.11|1489644|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489644-1489673 30 MH362766 Escherichia phage Halfdan, complete genome 11142-11171 7 0.767
NZ_CP024598_4 4.15|1489910|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489910-1489939 30 AP013464 Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C51-MedDCM-OCT-S31-C32 8116-8145 7 0.767
NZ_CP024598_4 4.15|1489910|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489910-1489939 30 AP013466 Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C51A-MedDCM-OCT-S38-C51 25165-25194 7 0.767
NZ_CP024598_4 4.15|1489910|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489910-1489939 30 AP013465 Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C51-MedDCM-OCT-S32-C58 26383-26412 7 0.767
NZ_CP024598_4 4.15|1489910|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489910-1489939 30 AP013750 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C51-MedDCM-OCT-S46-C76, *** SEQUENCING IN PROGRESS *** 913-942 7 0.767
NZ_CP024598_2 2.1|372592|30|NZ_CP024598|CRISPRCasFinder 372592-372621 30 NC_009990 Thalassomonas phage BA3, complete genome 32939-32968 8 0.733
NZ_CP024598_2 2.2|372668|30|NZ_CP024598|CRISPRCasFinder 372668-372697 30 NC_013940 Deferribacter desulfuricans SSM1 megaplasmid pDF308, complete sequence 77542-77571 8 0.733
NZ_CP024598_2 2.2|372668|30|NZ_CP024598|CRISPRCasFinder 372668-372697 30 NZ_MN602039 Staphylococcus capitis strain APC2923 plasmid pJOS_01, complete sequence 17746-17775 8 0.733
NZ_CP024598_2 2.2|372668|30|NZ_CP024598|CRISPRCasFinder 372668-372697 30 NZ_CP025224 Enterococcus sp. CR-Ec1 plasmid pCREc1, complete sequence 30628-30657 8 0.733
NZ_CP024598_2 2.4|372820|30|NZ_CP024598|CRISPRCasFinder 372820-372849 30 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1436295-1436324 8 0.733
NZ_CP024598_2 2.4|372820|30|NZ_CP024598|CRISPRCasFinder 372820-372849 30 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 959282-959311 8 0.733
NZ_CP024598_2 2.5|372896|30|NZ_CP024598|CRISPRCasFinder 372896-372925 30 NC_015710 Simkania negevensis Z plasmid pSn, complete sequence 85122-85151 8 0.733
NZ_CP024598_2 2.8|373124|30|NZ_CP024598|CRISPRCasFinder 373124-373153 30 NZ_CP022417 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence 153816-153845 8 0.733
NZ_CP024598_2 2.11|373352|30|NZ_CP024598|CRISPRCasFinder 373352-373381 30 NZ_MG973074 Clostridioides difficile strain HSJD-312 plasmid pHSJD-312, complete sequence 51909-51938 8 0.733
NZ_CP024598_2 2.12|373428|30|NZ_CP024598|CRISPRCasFinder 373428-373457 30 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 29784-29813 8 0.733
NZ_CP024598_2 2.12|373428|30|NZ_CP024598|CRISPRCasFinder 373428-373457 30 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 658834-658863 8 0.733
NZ_CP024598_2 2.13|373504|30|NZ_CP024598|CRISPRCasFinder 373504-373533 30 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 394970-394999 8 0.733
NZ_CP024598_2 2.14|373580|30|NZ_CP024598|CRISPRCasFinder 373580-373609 30 FQ857195 Erwinia phage phiEa116, WORKING DRAFT SEQUENCE, 6 unordered pieces 38179-38208 8 0.733
NZ_CP024598_2 2.14|373580|30|NZ_CP024598|CRISPRCasFinder 373580-373609 30 MK770412 Salmonella phage SE5, complete genome 82462-82491 8 0.733
NZ_CP024598_2 2.19|373960|29|NZ_CP024598|CRISPRCasFinder 373960-373988 29 MK448668 Streptococcus phage Javan107, complete genome 13551-13579 8 0.724
NZ_CP024598_2 2.19|373960|29|NZ_CP024598|CRISPRCasFinder 373960-373988 29 MK448922 Streptococcus phage Javan38, complete genome 12588-12616 8 0.724
NZ_CP024598_2 2.19|373960|29|NZ_CP024598|CRISPRCasFinder 373960-373988 29 MK448717 Streptococcus phage Javan25, complete genome 12588-12616 8 0.724
NZ_CP024598_2 2.19|373960|29|NZ_CP024598|CRISPRCasFinder 373960-373988 29 MK448906 Streptococcus phage Javan32, complete genome 12588-12616 8 0.724
NZ_CP024598_2 2.19|373960|29|NZ_CP024598|CRISPRCasFinder 373960-373988 29 MK448666 Streptococcus phage Javan101, complete genome 13551-13579 8 0.724
NZ_CP024598_2 2.19|373960|29|NZ_CP024598|CRISPRCasFinder 373960-373988 29 MK448827 Streptococcus phage Javan65, complete genome 12588-12616 8 0.724
NZ_CP024598_2 2.19|373960|29|NZ_CP024598|CRISPRCasFinder 373960-373988 29 MK448840 Streptococcus phage Javan104, complete genome 13551-13579 8 0.724
NZ_CP024598_2 2.19|373960|29|NZ_CP024598|CRISPRCasFinder 373960-373988 29 MK448670 Streptococcus phage Javan113, complete genome 13551-13579 8 0.724
NZ_CP024598_2 2.21|374111|30|NZ_CP024598|CRISPRCasFinder 374111-374140 30 NZ_CP033462 Brevibacillus laterosporus strain 1821L plasmid p1821L02, complete sequence 41453-41482 8 0.733
NZ_CP024598_2 2.22|374187|30|NZ_CP024598|CRISPRCasFinder 374187-374216 30 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1197091-1197120 8 0.733
NZ_CP024598_2 2.22|374187|30|NZ_CP024598|CRISPRCasFinder 374187-374216 30 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1425997-1426026 8 0.733
NZ_CP024598_2 2.22|374187|30|NZ_CP024598|CRISPRCasFinder 374187-374216 30 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1198998-1199027 8 0.733
NZ_CP024598_2 2.23|374263|30|NZ_CP024598|CRISPRCasFinder 374263-374292 30 NZ_CP024447 Moraxella osloensis strain NP7 plasmid pNP7-4, complete sequence 3323-3352 8 0.733
NZ_CP024598_2 2.23|374263|30|NZ_CP024598|CRISPRCasFinder 374263-374292 30 NZ_CP047228 Moraxella osloensis strain YV1 plasmid p2, complete sequence 22807-22836 8 0.733
NZ_CP024598_2 2.26|374491|30|NZ_CP024598|CRISPRCasFinder 374491-374520 30 NZ_AP017562 Pseudanabaena sp. ABRG5-3 plasmid ABRG53b, complete sequence 31846-31875 8 0.733
NZ_CP024598_2 2.27|374567|29|NZ_CP024598|CRISPRCasFinder,PILER-CR 374567-374595 29 MN693085 Marine virus AFVG_25M85, complete genome 36947-36975 8 0.724
NZ_CP024598_2 2.28|374642|30|NZ_CP024598|CRISPRCasFinder,PILER-CR 374642-374671 30 NZ_AP019745 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA5, complete sequence 2647-2676 8 0.733
NZ_CP024598_2 2.28|374642|30|NZ_CP024598|CRISPRCasFinder,PILER-CR 374642-374671 30 AP014094 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C31A-MedDCM-OCT-S30-C133, *** SEQUENCING IN PROGRESS *** 11977-12006 8 0.733
NZ_CP024598_2 2.28|374642|30|NZ_CP024598|CRISPRCasFinder,PILER-CR 374642-374671 30 AP014488 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C31A-MedDCM-OCT-S45-C60, *** SEQUENCING IN PROGRESS ***, 7 ordered pieces 16448-16477 8 0.733
NZ_CP024598_2 2.28|374642|30|NZ_CP024598|CRISPRCasFinder,PILER-CR 374642-374671 30 AP014487 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C31A-MedDCM-OCT-S34-C76, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces 11504-11533 8 0.733
NZ_CP024598_2 2.28|374642|30|NZ_CP024598|CRISPRCasFinder,PILER-CR 374642-374671 30 AP014096 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C31A-MedDCM-OCT-S41-C267, *** SEQUENCING IN PROGRESS *** 1679-1708 8 0.733
NZ_CP024598_2 2.28|374642|30|NZ_CP024598|CRISPRCasFinder,PILER-CR 374642-374671 30 AP014092 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C31A-MedDCM-OCT-S29-C108, *** SEQUENCING IN PROGRESS *** 1487-1516 8 0.733
NZ_CP024598_2 2.28|374642|30|NZ_CP024598|CRISPRCasFinder,PILER-CR 374642-374671 30 AP014095 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C31A-MedDCM-OCT-S38-C149, *** SEQUENCING IN PROGRESS *** 1575-1604 8 0.733
NZ_CP024598_2 2.30|374794|30|NZ_CP024598|CRISPRCasFinder,PILER-CR 374794-374823 30 MT701590 Klebsiella phage Miami, complete genome 196561-196590 8 0.733
NZ_CP024598_4 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489380-1489409 30 NZ_CP028594 Escherichia coli strain 150 plasmid pTA150-2, complete sequence 14384-14413 8 0.733
NZ_CP024598_4 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489380-1489409 30 NZ_CP020924 Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed2, complete sequence 18237-18266 8 0.733
NZ_CP024598_4 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489380-1489409 30 NZ_CP020924 Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed2, complete sequence 58007-58036 8 0.733
NZ_CP024598_4 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489380-1489409 30 NZ_CP028605 Escherichia coli strain 144 plasmid pTA144-2, complete sequence 14384-14413 8 0.733
NZ_CP024598_4 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489380-1489409 30 NZ_CP038311 Escherichia coli O157:H7 strain Show KS 470-1 plasmid pKS470-3, complete sequence 14403-14432 8 0.733
NZ_CP024598_4 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489380-1489409 30 NZ_CP038303 Escherichia coli O157:H7 strain SS TX 313-1 plasmid pTX313-2, complete sequence 16040-16069 8 0.733
NZ_CP024598_4 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489380-1489409 30 NZ_AP018807 Escherichia coli strain E2863 plasmid pE2863-5, complete sequence 18247-18276 8 0.733
NZ_CP024598_4 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489380-1489409 30 NZ_CP022051 Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed1, complete sequence 38029-38058 8 0.733
NZ_CP024598_4 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489380-1489409 30 NZ_CP038317 Escherichia coli O157:H7 strain NE92 plasmid pNE92-2, complete sequence 16040-16069 8 0.733
NZ_CP024598_4 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489380-1489409 30 NZ_CP038367 Escherichia coli O157:H7 strain F6667 plasmid pF6667-2, complete sequence 37301-37330 8 0.733
NZ_CP024598_4 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489380-1489409 30 NZ_CP040110 Escherichia coli O157:H7 strain MB9-1 plasmid pMB9_3, complete sequence 15355-15384 8 0.733
NZ_CP024598_4 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489380-1489409 30 NZ_CP007599 Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 plasmid pCFSAN000111_01, complete sequence 8340-8369 8 0.733
NZ_CP024598_4 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489380-1489409 30 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 1098-1127 8 0.733
NZ_CP024598_4 4.9|1489512|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489512-1489541 30 MH697589 Microbacterium phage Neferthena, complete genome 24531-24560 8 0.733
NZ_CP024598_4 4.14|1489844|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489844-1489873 30 CP025923 Escherichia phage sp. chromosome, complete genome 10529-10558 8 0.733
NZ_CP024598_4 4.14|1489844|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489844-1489873 30 NC_049344 Escherichia phage 520873, complete genome 10529-10558 8 0.733
NZ_CP024598_4 4.15|1489910|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489910-1489939 30 NC_010679 Paraburkholderia phytofirmans PsJN plasmid pBPHYT01, complete sequence 76232-76261 8 0.733
NZ_CP024598_6 6.1|2129579|33|NZ_CP024598|CRISPRCasFinder 2129579-2129611 33 NZ_CP016459 Blastomonas sp. RAC04 plasmid pBSY18_3, complete sequence 18073-18105 8 0.758
NZ_CP024598_2 2.2|372668|30|NZ_CP024598|CRISPRCasFinder 372668-372697 30 NZ_CP039706 Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence 195966-195995 9 0.7
NZ_CP024598_2 2.22|374187|30|NZ_CP024598|CRISPRCasFinder 374187-374216 30 LR606149 Rhizobium sp. Q54 genome assembly, plasmid: 6 64246-64275 9 0.7
NZ_CP024598_2 2.28|374642|30|NZ_CP024598|CRISPRCasFinder,PILER-CR 374642-374671 30 MN856097 Myoviridae sp. isolate 497, complete genome 19129-19158 9 0.7
NZ_CP024598_4 4.1|1488984|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1488984-1489013 30 NZ_CP049041 Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_4, complete sequence 40768-40797 9 0.7
NZ_CP024598_4 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT 1489380-1489409 30 NC_020867 Synechococcus phage S-RIP1 genomic sequence 21767-21796 9 0.7

1. spacer 2.17|373808|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 5, identity: 0.833

ctgggcttgcagcaggcaaacaagatggat	CRISPR spacer
caccgcttgcagcaggaaaacaagatgaat	Protospacer
*   ************ **********.**

2. spacer 2.32|374946|30|NZ_CP024598|CRISPRCasFinder,PILER-CR matches to NC_042140 (Bacillus virus BM15, complete genome) position: , mismatch: 5, identity: 0.833

ctccattgagacggacaacaaggagtaaac	CRISPR spacer
ctatatgtagacggacaacaagcagtaaac	Protospacer
** .**  ************** *******

3. spacer 2.32|374946|30|NZ_CP024598|CRISPRCasFinder,PILER-CR matches to MH638309 (Bacillus phage Hobo, complete genome) position: , mismatch: 5, identity: 0.833

ctccattgagacggacaacaaggagtaaac	CRISPR spacer
ctatatgtagacggacaacaagcagtaaac	Protospacer
** .**  ************** *******

4. spacer 2.1|372592|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP013925 (Acinetobacter baumannii strain KBN10P02143 plasmid pKBN10P02143, complete sequence) position: , mismatch: 6, identity: 0.8

gtagcggtgttttggggatcttaaactttt	CRISPR spacer
ttagcgttgttttggtgatcttaatcgctt	Protospacer
 ***** ******** ******** * .**

5. spacer 2.2|372668|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP049297 (Bacillus megaterium strain S188 plasmid pS188, complete sequence) position: , mismatch: 6, identity: 0.8

tgtctctta----ataataaaaaaagagaccaaa	CRISPR spacer
----ttttaaaagataataaaaaaagagacctaa	Protospacer
    *.***    ****************** **

6. spacer 2.2|372668|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP017081 (Bacillus muralis strain G25-68 plasmid pG25-68, complete sequence) position: , mismatch: 6, identity: 0.8

tgtctcttaataataaaaaaagagaccaaa	CRISPR spacer
ggtttgataaaaataaaaaaagagaacaaa	Protospacer
 **.*  *** ************** ****

7. spacer 2.2|372668|30|NZ_CP024598|CRISPRCasFinder matches to MT708547 (Klebsiella phage Muenster, complete genome) position: , mismatch: 6, identity: 0.8

tgtctcttaataataaaaaaagagaccaaa	CRISPR spacer
tgtctgttaataataaaaaaatcctccata	Protospacer
***** ***************    *** *

8. spacer 2.13|373504|30|NZ_CP024598|CRISPRCasFinder matches to MT110073 (Stenotrophomonas phage vB_SmaS_DLP_3, complete genome) position: , mismatch: 6, identity: 0.8

gtttcgactgcgtgggcgtatga-gcgtggc	CRISPR spacer
gttccgactgcgtgggcgtgtgatgcagag-	Protospacer
***.***************.*** **. .* 

9. spacer 2.21|374111|30|NZ_CP024598|CRISPRCasFinder matches to MG945137 (UNVERIFIED: Microviridae sp. isolate 235-1602, complete genome) position: , mismatch: 6, identity: 0.8

tactactatattatataggtataaatactc	CRISPR spacer
tactactatattatatatatataaatttat	Protospacer
***************** .******* . .

10. spacer 2.23|374263|30|NZ_CP024598|CRISPRCasFinder matches to LT960552 (Yersinia phage fHe-Yen9-03 genome assembly, complete genome: monopartite) position: , mismatch: 6, identity: 0.8

aaatagcatatatttgtattgtacaaccct	CRISPR spacer
atttggcatatatttaaattgtacaaccat	Protospacer
*  *.**********. *********** *

11. spacer 2.26|374491|30|NZ_CP024598|CRISPRCasFinder matches to MN694076 (Marine virus AFVG_250M1096, complete genome) position: , mismatch: 6, identity: 0.8

atatttcgaaataagtctttcataaagact	CRISPR spacer
atttatatcaataagtctttcagaaagact	Protospacer
** * *   ************* *******

12. spacer 2.26|374491|30|NZ_CP024598|CRISPRCasFinder matches to MN694359 (Marine virus AFVG_250M1098, complete genome) position: , mismatch: 6, identity: 0.8

atatttcgaaataagtctttcataaagact	CRISPR spacer
atttatatcaataagtctttcagaaagact	Protospacer
** * *   ************* *******

13. spacer 2.26|374491|30|NZ_CP024598|CRISPRCasFinder matches to MN694688 (Marine virus AFVG_250M1099, complete genome) position: , mismatch: 6, identity: 0.8

atatttcgaaataagtctttcataaagact	CRISPR spacer
atttatatcaataagtctttcagaaagact	Protospacer
** * *   ************* *******

14. spacer 2.26|374491|30|NZ_CP024598|CRISPRCasFinder matches to MN694415 (Marine virus AFVG_250M1100, complete genome) position: , mismatch: 6, identity: 0.8

atatttcgaaataagtctttcataaagact	CRISPR spacer
atttatatcaataagtctttcagaaagact	Protospacer
** * *   ************* *******

15. spacer 2.26|374491|30|NZ_CP024598|CRISPRCasFinder matches to MN694502 (Marine virus AFVG_250M1097, complete genome) position: , mismatch: 6, identity: 0.8

atatttcgaaataagtctttcataaagact	CRISPR spacer
atttatatcaataagtctttcagaaagact	Protospacer
** * *   ************* *******

16. spacer 2.32|374946|30|NZ_CP024598|CRISPRCasFinder,PILER-CR matches to NC_027352 (Bacillus phage JBP901, complete genome) position: , mismatch: 6, identity: 0.8

ctccattgagacggacaacaaggagtaaac	CRISPR spacer
ctgtatgtagacggacaacaagcagtaaat	Protospacer
** .**  ************** ******.

17. spacer 4.11|1489644|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022140 (Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

gcagccgaa----acaatcgcgcaaccggtattc	CRISPR spacer
----cagaaaatgacaatcgggcaaccggtattc	Protospacer
    * ***    ******* *************

18. spacer 4.11|1489644|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022118 (Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

gcagccgaa----acaatcgcgcaaccggtattc	CRISPR spacer
----cagaaaatgacaatcgggcaaccggtattc	Protospacer
    * ***    ******* *************

19. spacer 2.2|372668|30|NZ_CP024598|CRISPRCasFinder matches to NZ_KF559313 (Lactobacillus sakei strain KCA311 plasmid pKCA15, complete sequence) position: , mismatch: 7, identity: 0.767

tgtctcttaataataaaaaaagagaccaaa	CRISPR spacer
actctcttaatactaaaaatagagaagaag	Protospacer
  ********** ****** *****  **.

20. spacer 2.2|372668|30|NZ_CP024598|CRISPRCasFinder matches to NZ_KF559314 (Lactobacillus sakei strain KCA311 plasmid pKCA9, complete sequence) position: , mismatch: 7, identity: 0.767

tgtctcttaataataaaaaaagagaccaaa	CRISPR spacer
actctcttaatactaaaaatagagaagaag	Protospacer
  ********** ****** *****  **.

21. spacer 2.2|372668|30|NZ_CP024598|CRISPRCasFinder matches to CP033548 (Acinetobacter nosocomialis strain 2014N23-120 plasmid p2014N23-120-3, complete sequence) position: , mismatch: 7, identity: 0.767

tgtctcttaataataaaaaaagagaccaaa	CRISPR spacer
cctatattaataataaaaaaataaaccaag	Protospacer
. * * *************** *.*****.

22. spacer 2.2|372668|30|NZ_CP024598|CRISPRCasFinder matches to NC_012923 (Streptococcus suis BM407 plasmid pBM407, complete sequence) position: , mismatch: 7, identity: 0.767

tgtctcttaataataaaaaaagagaccaaa	CRISPR spacer
ttttggttaataataaaaaaatagacaaat	Protospacer
* *.  *************** **** ** 

23. spacer 2.2|372668|30|NZ_CP024598|CRISPRCasFinder matches to AM087120 (Acidianus filamentous virus 3, partial viral genome) position: , mismatch: 7, identity: 0.767

tgtctcttaataataaaaaaa----gagaccaaa	CRISPR spacer
tgtctcttaataatgaaaaaattgcaatac----	Protospacer
**************.******    .* **    

24. spacer 2.3|372744|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP022549 (Sphingorhabdus sp. YGSMI21 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

agttgggtatatgggttatcgctctatccc	CRISPR spacer
tgttgggaatatgggttatcgatccgtcat	Protospacer
 ****** ************* **..** .

25. spacer 2.4|372820|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP016618 (Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

---ttgcgcagggcgcggcatagctgcgggtgc	CRISPR spacer
ggctcg---agggcgcggcatagccgccggtgg	Protospacer
   *.*   ***************.** **** 

26. spacer 2.4|372820|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

---ttgcgcagggcgcggcatagctgcgggtgc	CRISPR spacer
ggctcg---agggcgcggcatagccgccggtgg	Protospacer
   *.*   ***************.** **** 

27. spacer 2.4|372820|30|NZ_CP024598|CRISPRCasFinder matches to NC_022042 (Paracoccus aminophilus JCM 7686 plasmid pAMI1, complete sequence) position: , mismatch: 7, identity: 0.767

ttgcgcagggcgcggcatagctgcgggtgc	CRISPR spacer
cggcaaagcgcgcggcaaagctgcgggtgg	Protospacer
. **. ** ******** *********** 

28. spacer 2.9|373200|30|NZ_CP024598|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 7, identity: 0.767

tcacctataatcgctatcctcattccccta	CRISPR spacer
ctacctataatcgctatcgtcactcatctg	Protospacer
..**************** ***.** .**.

29. spacer 2.11|373352|30|NZ_CP024598|CRISPRCasFinder matches to MN694201 (Marine virus AFVG_250M801, complete genome) position: , mismatch: 7, identity: 0.767

acgaaagagataatggataatttccgtctc	CRISPR spacer
tcaccagagataatgaataatttacgtctt	Protospacer
 *.  **********.******* *****.

30. spacer 2.13|373504|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.767

gtttcgactgcgtgggcgtatgagcgtggc	CRISPR spacer
atatcgactgcgagggcctatgagcgcttc	Protospacer
.* ********* **** ********.  *

31. spacer 2.14|373580|30|NZ_CP024598|CRISPRCasFinder matches to MH616728 (Myoviridae sp. isolate ctge_1, complete genome) position: , mismatch: 7, identity: 0.767

acttccatcagtttcaattcctgtatggtg	CRISPR spacer
gcttccatcagtttcaattactggttcttc	Protospacer
.****************** ***  *  * 

32. spacer 2.19|373960|29|NZ_CP024598|CRISPRCasFinder matches to MK448726 (Streptococcus phage Javan29, complete genome) position: , mismatch: 7, identity: 0.759

atggaagcgagttcttcgtccaaatacag	CRISPR spacer
gaaccagcgagttcttcttccaaatacaa	Protospacer
. .  ************ **********.

33. spacer 2.21|374111|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 7, identity: 0.767

tactactatattatataggtataaatactc	CRISPR spacer
tcttaatatattatataggtataaatttag	Protospacer
* .** ******************** .  

34. spacer 2.22|374187|30|NZ_CP024598|CRISPRCasFinder matches to NZ_LT598658 (Legionella pneumophila strain Lpm7613 isolate Lpm7613 plasmid 2) position: , mismatch: 7, identity: 0.767

cattgagcggatcattgcacgtttcattgc	CRISPR spacer
cattgagcggatgattgcacattataaaga	Protospacer
************ *******.** .*  * 

35. spacer 2.22|374187|30|NZ_CP024598|CRISPRCasFinder matches to NC_018141 (Legionella pneumophila subsp. pneumophila plasmid pLELO, complete sequence) position: , mismatch: 7, identity: 0.767

cattgagcggatcattgcacgtttcattgc	CRISPR spacer
cattgagcggattattgcacattataaaga	Protospacer
************.*******.** .*  * 

36. spacer 2.22|374187|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP021282 (Legionella pneumophila subsp. pneumophila strain Flint 2 (D-7477) plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cattgagcggatcattgcacgtttcattgc	CRISPR spacer
cattgagcggatgattgcacattataaaga	Protospacer
************ *******.** .*  * 

37. spacer 2.22|374187|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP045305 (Legionella longbeachae strain B1445CHC plasmid pB1445CHC_150k, complete sequence) position: , mismatch: 7, identity: 0.767

cattgagcggatcattgcacgtttcattgc	CRISPR spacer
cattgagcggattattgcacattataaaga	Protospacer
************.*******.** .*  * 

38. spacer 2.22|374187|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP025492 (Legionella sainthelensi strain LA01-117 plasmid pLA01-117_150k, complete sequence) position: , mismatch: 7, identity: 0.767

cattgagcggatcattgcacgtttcattgc	CRISPR spacer
cattgagcggattattgcacattataaaga	Protospacer
************.*******.** .*  * 

39. spacer 2.22|374187|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP021284 (Legionella pneumophila subsp. pneumophila strain Allentown 1 (D-7475) plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cattgagcggatcattgcacgtttcattgc	CRISPR spacer
cattgagcggattattgcacattataaaga	Protospacer
************.*******.** .*  * 

40. spacer 2.22|374187|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP042253 (Legionella longbeachae strain B3526CHC plasmid pB3526CHC_150k, complete sequence) position: , mismatch: 7, identity: 0.767

cattgagcggatcattgcacgtttcattgc	CRISPR spacer
cattgagcggattattgcacattataaaga	Protospacer
************.*******.** .*  * 

41. spacer 2.22|374187|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP011106 (Legionella pneumophila strain L10-023 isolate Ulm plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cattgagcggatcattgcacgtttcattgc	CRISPR spacer
cattgagcggattattgcacattataaaga	Protospacer
************.*******.** .*  * 

42. spacer 2.22|374187|30|NZ_CP024598|CRISPRCasFinder matches to NZ_LN681226 (Legionella hackeliae strain ATCC 35250 plasmid II, complete sequence) position: , mismatch: 7, identity: 0.767

cattgagcggatcattgcacgtttcattgc	CRISPR spacer
cattgagcggatgattgcacattataaaga	Protospacer
************ *******.** .*  * 

43. spacer 2.22|374187|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP016031 (Legionella pneumophila strain OLDA plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cattgagcggatcattgcacgtttcattgc	CRISPR spacer
cattgagcggatgattgcacattataaaga	Protospacer
************ *******.** .*  * 

44. spacer 2.22|374187|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP021287 (Legionella pneumophila subsp. pneumophila strain Albuquerque 1 (D-7474) plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cattgagcggatcattgcacgtttcattgc	CRISPR spacer
cattgagcggatgattgcacattataaaga	Protospacer
************ *******.** .*  * 

45. spacer 2.22|374187|30|NZ_CP024598|CRISPRCasFinder matches to NC_006365 (Legionella pneumophila str. Paris plasmid pLPP, complete sequence) position: , mismatch: 7, identity: 0.767

cattgagcggatcattgcacgtttcattgc	CRISPR spacer
cattgagcggatgattgcacattataaaga	Protospacer
************ *******.** .*  * 

46. spacer 2.22|374187|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP048619 (Legionella pneumophila strain ERS1305867 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cattgagcggatcattgcacgtttcattgc	CRISPR spacer
cattgagcggatgattgcacattataaaga	Protospacer
************ *******.** .*  * 

47. spacer 4.5|1489248|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP005191 (Sphingobium sp. MI1205 plasmid pMI2, complete sequence) position: , mismatch: 7, identity: 0.767

ggatatatccgtctgcatatcttcggcgtt	CRISPR spacer
aggcagacccgtctgcatctcttcggcgtc	Protospacer
.*..* *.********** **********.

48. spacer 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to MN694748 (Marine virus AFVG_250M355, complete genome) position: , mismatch: 7, identity: 0.767

aaccttttgcttgttttcgttgtttgtctc	CRISPR spacer
aaccttttacttgtgttcgttgtgatactg	Protospacer
********.***** ********    ** 

49. spacer 4.8|1489446|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 7, identity: 0.767

cgaacggctgaaatcctacgaagcacaggg	CRISPR spacer
ggagatcctgaaaacctgcgaagcacaggg	Protospacer
 **.   ****** ***.************

50. spacer 4.9|1489512|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to KU594606 (Cyanophage S-RIM32 isolate RW_108_0702, complete genome) position: , mismatch: 7, identity: 0.767

ccggagctggttctggatcaggagcaccag	CRISPR spacer
gtgctgctggttctggatcaggagaaccta	Protospacer
 .*  ******************* *** .

51. spacer 4.9|1489512|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to KU594606 (Cyanophage S-RIM32 isolate RW_108_0702, complete genome) position: , mismatch: 7, identity: 0.767

ccggagctggttctggatcaggagcaccag	CRISPR spacer
caacatctggttctggaacaggagcaacat	Protospacer
* . * *********** ******** ** 

52. spacer 4.9|1489512|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to MK310226 (Halobacterium virus ChaoS9, complete genome) position: , mismatch: 7, identity: 0.767

ccggagctggttctggatcaggagcaccag	CRISPR spacer
gtgacgctggttcgggatcaggagcatcac	Protospacer
 .*. ******** ************.** 

53. spacer 4.9|1489512|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to MH697579 (Mycobacterium phage Cane17, complete genome) position: , mismatch: 7, identity: 0.767

ccggagctggttctggatcaggagcaccag	CRISPR spacer
ttcgccctggttctggatctggagcacaag	Protospacer
.. *  ************* ******* **

54. spacer 4.9|1489512|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to MK359359 (Mycobacterium phage Colt, complete genome) position: , mismatch: 7, identity: 0.767

ccggagctggttctggatcaggagcaccag	CRISPR spacer
ttcgccctggttctggatctggagcacaag	Protospacer
.. *  ************* ******* **

55. spacer 4.9|1489512|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to AP014250 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S40-C9, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767

ccggagctggttctggatcaggagcaccag	CRISPR spacer
tcaatggtggttctggatctggagcacaag	Protospacer
.*.. * ************ ******* **

56. spacer 4.11|1489644|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to MH362766 (Escherichia phage Halfdan, complete genome) position: , mismatch: 7, identity: 0.767

gcagccgaaacaatcgcgcaaccggtattc	CRISPR spacer
gccgccgaaacaatcgcgcaagcaaaagcc	Protospacer
** ****************** *.. * .*

57. spacer 4.15|1489910|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to AP013464 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C51-MedDCM-OCT-S31-C32) position: , mismatch: 7, identity: 0.767

tccaatgcgtgtttgagcgctttccacttt	CRISPR spacer
tcttctgcttgtttgagcgcttgccactga	Protospacer
**.  *** ************* *****  

58. spacer 4.15|1489910|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to AP013466 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C51A-MedDCM-OCT-S38-C51) position: , mismatch: 7, identity: 0.767

tccaatgcgtgtttgagcgctttccacttt	CRISPR spacer
tcttctgcttgtttgagcgcttgccactga	Protospacer
**.  *** ************* *****  

59. spacer 4.15|1489910|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to AP013465 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-C51-MedDCM-OCT-S32-C58) position: , mismatch: 7, identity: 0.767

tccaatgcgtgtttgagcgctttccacttt	CRISPR spacer
tcttctgcttgtttgagcgcttgccactga	Protospacer
**.  *** ************* *****  

60. spacer 4.15|1489910|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to AP013750 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C51-MedDCM-OCT-S46-C76, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767

tccaatgcgtgtttgagcgctttccacttt	CRISPR spacer
tcttctgcttgtttgagcgcttgccactga	Protospacer
**.  *** ************* *****  

61. spacer 2.1|372592|30|NZ_CP024598|CRISPRCasFinder matches to NC_009990 (Thalassomonas phage BA3, complete genome) position: , mismatch: 8, identity: 0.733

gtagcggtgttttggggatcttaaactttt	CRISPR spacer
actttggtgttttgcggatattaaactttc	Protospacer
..  .********* **** *********.

62. spacer 2.2|372668|30|NZ_CP024598|CRISPRCasFinder matches to NC_013940 (Deferribacter desulfuricans SSM1 megaplasmid pDF308, complete sequence) position: , mismatch: 8, identity: 0.733

tgtctcttaataataaaaaaagagaccaaa	CRISPR spacer
cctgatataataataaaaaaagagaataaa	Protospacer
. *  . ****************** .***

63. spacer 2.2|372668|30|NZ_CP024598|CRISPRCasFinder matches to NZ_MN602039 (Staphylococcus capitis strain APC2923 plasmid pJOS_01, complete sequence) position: , mismatch: 8, identity: 0.733

tgtctcttaataataaaaaaagagaccaaa	CRISPR spacer
aaccacttattaataaaaaaagagaacatc	Protospacer
 ..* **** *************** **  

64. spacer 2.2|372668|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP025224 (Enterococcus sp. CR-Ec1 plasmid pCREc1, complete sequence) position: , mismatch: 8, identity: 0.733

tgtctcttaataataaaaaaagagaccaaa	CRISPR spacer
agctgcttaataataaaaacagagacagga	Protospacer
 *.. ************** ****** ..*

65. spacer 2.4|372820|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.733

ttgcgcagggcgcggcatagctgcgggtgc	CRISPR spacer
cggtgatccgcgcggcatagctgccggtgc	Protospacer
. *.*    *************** *****

66. spacer 2.4|372820|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.733

ttgcgcagggcgcggcatagctgcgggtgc	CRISPR spacer
cggtgatccgcgcggcatagctgccggtgc	Protospacer
. *.*    *************** *****

67. spacer 2.5|372896|30|NZ_CP024598|CRISPRCasFinder matches to NC_015710 (Simkania negevensis Z plasmid pSn, complete sequence) position: , mismatch: 8, identity: 0.733

aaagccctgttttttttcttgtcatccata	CRISPR spacer
gcttccctgtattttttcttgtcaacccaa	Protospacer
.   ****** ************* **  *

68. spacer 2.8|373124|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 8, identity: 0.733

ttccgtacgaccgccaagtcgcccgctacc	CRISPR spacer
atgaagacgcccgccaagtcgcccgcgaca	Protospacer
 *  . *** **************** ** 

69. spacer 2.11|373352|30|NZ_CP024598|CRISPRCasFinder matches to NZ_MG973074 (Clostridioides difficile strain HSJD-312 plasmid pHSJD-312, complete sequence) position: , mismatch: 8, identity: 0.733

acgaaagagataatggataatttccgtctc	CRISPR spacer
gagaaagagataatgcataagttcctcccg	Protospacer
. ************* **** **** .*. 

70. spacer 2.12|373428|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733

ttcttcacagaggcgataatgtccacgatt	CRISPR spacer
tggaaggcagaggcgatacggtccacgatt	Protospacer
*     .***********  **********

71. spacer 2.12|373428|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733

ttcttcacagaggcgataatgtccacgatt	CRISPR spacer
tggaaggcagaggcgatacggtccacgatt	Protospacer
*     .***********  **********

72. spacer 2.13|373504|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

gtttcgactgcgtgggcgtatgagcgtggc	CRISPR spacer
acatcgactgcgagggcctatgagcgcttc	Protospacer
.. ********* **** ********.  *

73. spacer 2.14|373580|30|NZ_CP024598|CRISPRCasFinder matches to FQ857195 (Erwinia phage phiEa116, WORKING DRAFT SEQUENCE, 6 unordered pieces) position: , mismatch: 8, identity: 0.733

acttccatcagtttcaattcctgtatggtg	CRISPR spacer
tttcaaatcagattcaattcctgtatgata	Protospacer
 .*.  ***** ***************.*.

74. spacer 2.14|373580|30|NZ_CP024598|CRISPRCasFinder matches to MK770412 (Salmonella phage SE5, complete genome) position: , mismatch: 8, identity: 0.733

acttccatcagtttcaattcctgtatggtg	CRISPR spacer
tttcaaatcagattcaattcctgtatgata	Protospacer
 .*.  ***** ***************.*.

75. spacer 2.19|373960|29|NZ_CP024598|CRISPRCasFinder matches to MK448668 (Streptococcus phage Javan107, complete genome) position: , mismatch: 8, identity: 0.724

atggaagcgagttcttcgtccaaatacag	CRISPR spacer
gaaccagtgagttcttcttccaaatacaa	Protospacer
. .  **.********* **********.

76. spacer 2.19|373960|29|NZ_CP024598|CRISPRCasFinder matches to MK448922 (Streptococcus phage Javan38, complete genome) position: , mismatch: 8, identity: 0.724

atggaagcgagttcttcgtccaaatacag	CRISPR spacer
gaaccagtgagttcttcttccaaatacaa	Protospacer
. .  **.********* **********.

77. spacer 2.19|373960|29|NZ_CP024598|CRISPRCasFinder matches to MK448717 (Streptococcus phage Javan25, complete genome) position: , mismatch: 8, identity: 0.724

atggaagcgagttcttcgtccaaatacag	CRISPR spacer
gaaccagtgagttcttcttccaaatacaa	Protospacer
. .  **.********* **********.

78. spacer 2.19|373960|29|NZ_CP024598|CRISPRCasFinder matches to MK448906 (Streptococcus phage Javan32, complete genome) position: , mismatch: 8, identity: 0.724

atggaagcgagttcttcgtccaaatacag	CRISPR spacer
gaaccagtgagttcttcttccaaatacaa	Protospacer
. .  **.********* **********.

79. spacer 2.19|373960|29|NZ_CP024598|CRISPRCasFinder matches to MK448666 (Streptococcus phage Javan101, complete genome) position: , mismatch: 8, identity: 0.724

atggaagcgagttcttcgtccaaatacag	CRISPR spacer
gaaccagtgagttcttcttccaaatacaa	Protospacer
. .  **.********* **********.

80. spacer 2.19|373960|29|NZ_CP024598|CRISPRCasFinder matches to MK448827 (Streptococcus phage Javan65, complete genome) position: , mismatch: 8, identity: 0.724

atggaagcgagttcttcgtccaaatacag	CRISPR spacer
gaaccagtgagttcttcttccaaatacaa	Protospacer
. .  **.********* **********.

81. spacer 2.19|373960|29|NZ_CP024598|CRISPRCasFinder matches to MK448840 (Streptococcus phage Javan104, complete genome) position: , mismatch: 8, identity: 0.724

atggaagcgagttcttcgtccaaatacag	CRISPR spacer
gaaccagtgagttcttcttccaaatacaa	Protospacer
. .  **.********* **********.

82. spacer 2.19|373960|29|NZ_CP024598|CRISPRCasFinder matches to MK448670 (Streptococcus phage Javan113, complete genome) position: , mismatch: 8, identity: 0.724

atggaagcgagttcttcgtccaaatacag	CRISPR spacer
gaaccagtgagttcttcttccaaatacaa	Protospacer
. .  **.********* **********.

83. spacer 2.21|374111|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP033462 (Brevibacillus laterosporus strain 1821L plasmid p1821L02, complete sequence) position: , mismatch: 8, identity: 0.733

tactactatattatataggtataaatactc	CRISPR spacer
acataatatattatataagtataaataagt	Protospacer
   ** ***********.*********  .

84. spacer 2.22|374187|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.733

cattgagcggatcattgcacgtttcattgc	CRISPR spacer
acgggagcggatcattgcaggtttcagatc	Protospacer
    *************** ******   *

85. spacer 2.22|374187|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.733

cattgagcggatcattgcacgtttcattgc	CRISPR spacer
acttacctggatcatttcacgtttcattga	Protospacer
  **.  .******** ************ 

86. spacer 2.22|374187|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 8, identity: 0.733

cattgagcggatcattgcacgtttcattgc	CRISPR spacer
acttacctggatcatttcacgtttcattga	Protospacer
  **.  .******** ************ 

87. spacer 2.23|374263|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP024447 (Moraxella osloensis strain NP7 plasmid pNP7-4, complete sequence) position: , mismatch: 8, identity: 0.733

aaatagcatatatttgtattgtacaaccct	CRISPR spacer
aaatacaatatatttgtattgtatttatat	Protospacer
*****  ****************.   . *

88. spacer 2.23|374263|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP047228 (Moraxella osloensis strain YV1 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733

aaatagcatatatttgtattgtacaaccct	CRISPR spacer
aaatacaatatatttgtattgtatttatat	Protospacer
*****  ****************.   . *

89. spacer 2.26|374491|30|NZ_CP024598|CRISPRCasFinder matches to NZ_AP017562 (Pseudanabaena sp. ABRG5-3 plasmid ABRG53b, complete sequence) position: , mismatch: 8, identity: 0.733

atatttcgaaataagtctttcataaagact	CRISPR spacer
ctatttctaaaaaagtctttcatattaatc	Protospacer
 ****** *** ************  .*..

90. spacer 2.27|374567|29|NZ_CP024598|CRISPRCasFinder,PILER-CR matches to MN693085 (Marine virus AFVG_25M85, complete genome) position: , mismatch: 8, identity: 0.724

tcaagtatataatctatcacttgttgtgc	CRISPR spacer
ggtgacataaaatctgtcacttgttgtgc	Protospacer
   ...*** *****.*************

91. spacer 2.28|374642|30|NZ_CP024598|CRISPRCasFinder,PILER-CR matches to NZ_AP019745 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA5, complete sequence) position: , mismatch: 8, identity: 0.733

acttccatcagttttaattcctgtatggtg	CRISPR spacer
ctgtgcatccgttttaattcctatatggat	Protospacer
 . * **** ************.*****  

92. spacer 2.28|374642|30|NZ_CP024598|CRISPRCasFinder,PILER-CR matches to AP014094 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C31A-MedDCM-OCT-S30-C133, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733

acttccatcagttttaattcctgtatggtg	CRISPR spacer
agttccatcagtttttattcctgctggacc	Protospacer
* ************* *******.  *.. 

93. spacer 2.28|374642|30|NZ_CP024598|CRISPRCasFinder,PILER-CR matches to AP014488 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C31A-MedDCM-OCT-S45-C60, *** SEQUENCING IN PROGRESS ***, 7 ordered pieces) position: , mismatch: 8, identity: 0.733

acttccatcagttttaattcctgtatggtg	CRISPR spacer
agttccatcagtttttattcctgctggacc	Protospacer
* ************* *******.  *.. 

94. spacer 2.28|374642|30|NZ_CP024598|CRISPRCasFinder,PILER-CR matches to AP014487 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C31A-MedDCM-OCT-S34-C76, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 8, identity: 0.733

acttccatcagttttaattcctgtatggtg	CRISPR spacer
agttccatcagtttttattcctgctggacc	Protospacer
* ************* *******.  *.. 

95. spacer 2.28|374642|30|NZ_CP024598|CRISPRCasFinder,PILER-CR matches to AP014096 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C31A-MedDCM-OCT-S41-C267, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733

acttccatcagttttaattcctgtatggtg	CRISPR spacer
agttccatcagtttttattcctgctggacc	Protospacer
* ************* *******.  *.. 

96. spacer 2.28|374642|30|NZ_CP024598|CRISPRCasFinder,PILER-CR matches to AP014092 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C31A-MedDCM-OCT-S29-C108, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733

acttccatcagttttaattcctgtatggtg	CRISPR spacer
agttccatcagtttttattcctgctggacc	Protospacer
* ************* *******.  *.. 

97. spacer 2.28|374642|30|NZ_CP024598|CRISPRCasFinder,PILER-CR matches to AP014095 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C31A-MedDCM-OCT-S38-C149, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733

acttccatcagttttaattcctgtatggtg	CRISPR spacer
agttccatcagtttttattcctgctggacc	Protospacer
* ************* *******.  *.. 

98. spacer 2.30|374794|30|NZ_CP024598|CRISPRCasFinder,PILER-CR matches to MT701590 (Klebsiella phage Miami, complete genome) position: , mismatch: 8, identity: 0.733

agtgccgacagtctgtaacaacatagaggt	CRISPR spacer
gggcgatacagtctttaacaacatcgaggt	Protospacer
.*     ******* ********* *****

99. spacer 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028594 (Escherichia coli strain 150 plasmid pTA150-2, complete sequence) position: , mismatch: 8, identity: 0.733

aaccttttgcttgttttcgttgtttgtctc	CRISPR spacer
tttttgttgcttattctcgttgtttgtctt	Protospacer
  ..* ******.**.*************.

100. spacer 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020924 (Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

aaccttttgcttgttttcgttgtttgtctc	CRISPR spacer
tttttgttgcttattctcgttgtttgtctt	Protospacer
  ..* ******.**.*************.

101. spacer 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020924 (Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

aaccttttgcttgttttcgttgtttgtctc	CRISPR spacer
tttttgttgcttattctcgttgtttgtctt	Protospacer
  ..* ******.**.*************.

102. spacer 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028605 (Escherichia coli strain 144 plasmid pTA144-2, complete sequence) position: , mismatch: 8, identity: 0.733

aaccttttgcttgttttcgttgtttgtctc	CRISPR spacer
tttttgttgcttattctcgttgtttgtctt	Protospacer
  ..* ******.**.*************.

103. spacer 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038311 (Escherichia coli O157:H7 strain Show KS 470-1 plasmid pKS470-3, complete sequence) position: , mismatch: 8, identity: 0.733

aaccttttgcttgttttcgttgtttgtctc	CRISPR spacer
tttttgttgcttattctcgttgtttgtctt	Protospacer
  ..* ******.**.*************.

104. spacer 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038303 (Escherichia coli O157:H7 strain SS TX 313-1 plasmid pTX313-2, complete sequence) position: , mismatch: 8, identity: 0.733

aaccttttgcttgttttcgttgtttgtctc	CRISPR spacer
tttttgttgcttattctcgttgtttgtctt	Protospacer
  ..* ******.**.*************.

105. spacer 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018807 (Escherichia coli strain E2863 plasmid pE2863-5, complete sequence) position: , mismatch: 8, identity: 0.733

aaccttttgcttgttttcgttgtttgtctc	CRISPR spacer
tttttgttgcttattctcgttgtttgtctt	Protospacer
  ..* ******.**.*************.

106. spacer 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022051 (Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

aaccttttgcttgttttcgttgtttgtctc	CRISPR spacer
tttttgttgcttattctcgttgtttgtctt	Protospacer
  ..* ******.**.*************.

107. spacer 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038317 (Escherichia coli O157:H7 strain NE92 plasmid pNE92-2, complete sequence) position: , mismatch: 8, identity: 0.733

aaccttttgcttgttttcgttgtttgtctc	CRISPR spacer
tttttgttgcttattctcgttgtttgtctt	Protospacer
  ..* ******.**.*************.

108. spacer 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038367 (Escherichia coli O157:H7 strain F6667 plasmid pF6667-2, complete sequence) position: , mismatch: 8, identity: 0.733

aaccttttgcttgttttcgttgtttgtctc	CRISPR spacer
tttttgttgcttattctcgttgtttgtctt	Protospacer
  ..* ******.**.*************.

109. spacer 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040110 (Escherichia coli O157:H7 strain MB9-1 plasmid pMB9_3, complete sequence) position: , mismatch: 8, identity: 0.733

aaccttttgcttgttttcgttgtttgtctc	CRISPR spacer
tttttgttgcttattctcgttgtttgtctt	Protospacer
  ..* ******.**.*************.

110. spacer 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007599 (Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 plasmid pCFSAN000111_01, complete sequence) position: , mismatch: 8, identity: 0.733

aaccttttgcttgttttcgttgtttgtctc	CRISPR spacer
tttttgttgcttattctcgttgtttgtctt	Protospacer
  ..* ******.**.*************.

111. spacer 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 8, identity: 0.733

aaccttttgcttgttttcgttgtttgtctc	CRISPR spacer
tttttgttgcttattctcgttgtttgtctt	Protospacer
  ..* ******.**.*************.

112. spacer 4.9|1489512|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to MH697589 (Microbacterium phage Neferthena, complete genome) position: , mismatch: 8, identity: 0.733

ccggagctggttctggatcaggagcaccag	CRISPR spacer
gtggagctggttctggaggaggagctcgcc	Protospacer
 .***************  ****** *   

113. spacer 4.14|1489844|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to CP025923 (Escherichia phage sp. chromosome, complete genome) position: , mismatch: 8, identity: 0.733

cgattgtattgcttccacgcacctcttctt	CRISPR spacer
atattttattgcttacacgcacctctgtaa	Protospacer
  *** ******** *********** .  

114. spacer 4.14|1489844|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NC_049344 (Escherichia phage 520873, complete genome) position: , mismatch: 8, identity: 0.733

cgattgtattgcttccacgcacctcttctt	CRISPR spacer
atattttattgcttacacgcacctctgtaa	Protospacer
  *** ******** *********** .  

115. spacer 4.15|1489910|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NC_010679 (Paraburkholderia phytofirmans PsJN plasmid pBPHYT01, complete sequence) position: , mismatch: 8, identity: 0.733

tccaatgcgtgtttgagcgctttccacttt	CRISPR spacer
atgaatgggtctttgagcgctttccatgct	Protospacer
 . **** ** ***************. .*

116. spacer 6.1|2129579|33|NZ_CP024598|CRISPRCasFinder matches to NZ_CP016459 (Blastomonas sp. RAC04 plasmid pBSY18_3, complete sequence) position: , mismatch: 8, identity: 0.758

tcctccacgatctcggtgtctgatctgcttttt	CRISPR spacer
tgttccgcgatctgggtgtctgatctgcagggt	Protospacer
* .***.****** **************    *

117. spacer 2.2|372668|30|NZ_CP024598|CRISPRCasFinder matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 9, identity: 0.7

tgtctcttaataataaaaaaagagaccaaa	CRISPR spacer
atattcctaataataaaaaaagagaagagc	Protospacer
   .**.******************  *. 

118. spacer 2.22|374187|30|NZ_CP024598|CRISPRCasFinder matches to LR606149 (Rhizobium sp. Q54 genome assembly, plasmid: 6) position: , mismatch: 9, identity: 0.7

cattgagcggatcattgcacgtttcattgc	CRISPR spacer
ttttgagcggatccttgcacgtgtcggctg	Protospacer
. *********** ******** **. .  

119. spacer 2.28|374642|30|NZ_CP024598|CRISPRCasFinder,PILER-CR matches to MN856097 (Myoviridae sp. isolate 497, complete genome) position: , mismatch: 9, identity: 0.7

acttccatcagttttaattcctgtatggtg	CRISPR spacer
ttctgggacagttttaatttctgtatggta	Protospacer
 ..*  . ***********.*********.

120. spacer 4.1|1488984|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049041 (Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_4, complete sequence) position: , mismatch: 9, identity: 0.7

ggtattcctgatccccgatgcggatttttt	CRISPR spacer
gacggcgctgatccccgatgcggcttttca	Protospacer
*... . **************** ****. 

121. spacer 4.7|1489380|30|NZ_CP024598|PILER-CR,CRISPRCasFinder,CRT matches to NC_020867 (Synechococcus phage S-RIP1 genomic sequence) position: , mismatch: 9, identity: 0.7

aaccttttgcttgttttcgttgtttgtctc	CRISPR spacer
taccttttgcttgttgtcgttgctctaaat	Protospacer
 ************** ******.*.    .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 3012 3 Orpheovirus(100.0%) NA NA
DBSCAN-SWA_2 7261 : 8386 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_3 13308 : 14643 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_4 40356 : 41389 2 Salmonella_phage(50.0%) NA NA
DBSCAN-SWA_5 48044 : 49235 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_6 59306 : 68185 5 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_7 73697 : 74786 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_8 83061 : 85788 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_9 92992 : 93820 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_10 108213 : 110175 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_11 120255 : 122246 2 Mollivirus(50.0%) NA NA
DBSCAN-SWA_12 132815 : 134297 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_13 143414 : 150186 8 Tunisvirus(33.33%) NA NA
DBSCAN-SWA_14 154409 : 165703 7 Acanthocystis_turfacea_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_15 170083 : 174018 5 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_16 184808 : 185369 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_17 192641 : 198795 3 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_18 212517 : 213540 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_19 217414 : 220234 3 Streptococcus_phage(50.0%) transposase NA
DBSCAN-SWA_20 223777 : 231553 4 Erwinia_phage(33.33%) integrase,transposase attL 225100:225113|attR 234795:234808
DBSCAN-SWA_21 237490 : 237958 1 Klebsiella_phage(100.0%) NA NA
DBSCAN-SWA_22 262578 : 263307 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_23 279043 : 283271 3 Enterobacteria_phage(50.0%) protease NA
DBSCAN-SWA_24 298187 : 300281 1 Aureococcus_anophage(100.0%) NA NA
DBSCAN-SWA_25 305234 : 308840 1 Klebsiella_phage(100.0%) NA NA
DBSCAN-SWA_26 322220 : 323648 1 Gordonia_phage(100.0%) NA NA
DBSCAN-SWA_27 339104 : 342392 4 Phage_TP(50.0%) NA NA
DBSCAN-SWA_28 348556 : 350497 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_29 358717 : 362117 4 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_30 396154 : 398634 2 Acinetobacter_phage(50.0%) transposase NA
DBSCAN-SWA_31 405633 : 409047 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_32 413255 : 418660 4 Ugandan_cassava_brown_streak_virus(33.33%) NA NA
DBSCAN-SWA_33 429327 : 437431 5 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_34 448615 : 451312 1 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_35 473026 : 473686 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_36 479773 : 480859 1 Ralstonia_phage(100.0%) transposase NA
DBSCAN-SWA_37 489372 : 490980 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_38 494159 : 494861 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_39 503668 : 504328 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_40 515020 : 516985 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_41 532388 : 547035 14 Bacillus_phage(16.67%) tRNA NA
DBSCAN-SWA_42 553742 : 554561 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_43 558671 : 582247 19 Tenacibaculum_phage(12.5%) transposase,tRNA NA
DBSCAN-SWA_44 587676 : 588378 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_45 592252 : 602614 7 Leporid_alphaherpesvirus(25.0%) NA NA
DBSCAN-SWA_46 609028 : 609520 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_47 624003 : 627976 6 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_48 631627 : 634453 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_49 639440 : 640205 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_50 673067 : 675110 1 Megavirus(100.0%) tRNA NA
DBSCAN-SWA_51 701231 : 703451 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_52 714979 : 723735 7 Klebsiella_phage(50.0%) integrase attL 699325:699340|attR 729161:729176
DBSCAN-SWA_53 730261 : 732331 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_54 735649 : 736642 1 Indivirus(100.0%) NA NA
DBSCAN-SWA_55 740388 : 741342 1 uncultured_phage(100.0%) NA NA
DBSCAN-SWA_56 747214 : 751005 4 Acanthocystis_turfacea_Chlorella_virus(25.0%) NA NA
DBSCAN-SWA_57 762214 : 762961 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_58 766864 : 771832 6 Pigeonpox_virus(25.0%) NA NA
DBSCAN-SWA_59 779669 : 785625 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_60 796266 : 800263 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_61 805153 : 805573 1 Cellulophaga_phage(100.0%) NA NA
DBSCAN-SWA_62 824060 : 826472 2 Hokovirus(50.0%) NA NA
DBSCAN-SWA_63 849680 : 850490 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_64 877351 : 878689 1 environmental_Halophage(100.0%) NA NA
DBSCAN-SWA_65 892025 : 900459 7 Orpheovirus(33.33%) transposase,tRNA NA
DBSCAN-SWA_66 914901 : 926494 8 Yellowstone_lake_phycodnavirus(20.0%) NA NA
DBSCAN-SWA_67 929645 : 936855 5 Aeromonas_phage(33.33%) NA NA
DBSCAN-SWA_68 952511 : 954188 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_69 962232 : 963261 1 Pacmanvirus(100.0%) NA NA
DBSCAN-SWA_70 966459 : 969039 1 Cronobacter_phage(100.0%) protease NA
DBSCAN-SWA_71 972625 : 973330 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_72 996064 : 1002362 4 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_73 1010092 : 1022001 8 Synechococcus_phage(25.0%) transposase NA
DBSCAN-SWA_74 1028869 : 1035325 3 unidentified_phage(50.0%) NA NA
DBSCAN-SWA_75 1045567 : 1046509 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_76 1055720 : 1058301 2 Diachasmimorpha_longicaudata_entomopoxvirus(50.0%) NA NA
DBSCAN-SWA_77 1067144 : 1069820 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_78 1092146 : 1094900 3 Tupanvirus(33.33%) tRNA NA
DBSCAN-SWA_79 1106398 : 1108684 1 unidentified_phage(100.0%) NA NA
DBSCAN-SWA_80 1116186 : 1117834 3 Haemophilus_phage(50.0%) NA NA
DBSCAN-SWA_81 1129991 : 1131077 1 Ralstonia_phage(100.0%) transposase NA
DBSCAN-SWA_82 1138708 : 1139680 1 Prochlorococcus_phage(100.0%) tRNA NA
DBSCAN-SWA_83 1146166 : 1151796 3 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_84 1177730 : 1178306 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_85 1189302 : 1194294 4 Escherichia_phage(50.0%) transposase,tRNA NA
DBSCAN-SWA_86 1206464 : 1208588 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_87 1233899 : 1235189 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_88 1247050 : 1251684 5 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_89 1257600 : 1258236 1 Ralstonia_phage(100.0%) transposase NA
DBSCAN-SWA_90 1268959 : 1275880 3 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_91 1285885 : 1288174 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_92 1291541 : 1293563 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_93 1301087 : 1302365 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_94 1306385 : 1308509 1 Diadromus_pulchellus_ascovirus(100.0%) NA NA
DBSCAN-SWA_95 1328134 : 1328770 1 Ralstonia_phage(100.0%) transposase NA
DBSCAN-SWA_96 1332898 : 1334918 2 Methanothermobacter_phage(50.0%) NA NA
DBSCAN-SWA_97 1338428 : 1341279 4 Cyanophage(50.0%) NA NA
DBSCAN-SWA_98 1355095 : 1359127 3 uncultured_Caudovirales_phage(33.33%) tRNA NA
DBSCAN-SWA_99 1374411 : 1375641 1 unidentified_phage(100.0%) integrase attL 1362537:1362555|attR 1378847:1378865
DBSCAN-SWA_100 1383711 : 1388893 6 Catovirus(25.0%) NA NA
DBSCAN-SWA_101 1395304 : 1396327 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_102 1400366 : 1407870 7 Synechococcus_phage(20.0%) NA NA
DBSCAN-SWA_103 1422082 : 1422520 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_104 1428317 : 1428989 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_105 1433577 : 1435053 1 Microcystis_virus(100.0%) NA NA
DBSCAN-SWA_106 1440165 : 1447065 5 Sulfitobacter_phage(33.33%) NA NA
DBSCAN-SWA_107 1457625 : 1461816 6 Salmonella_phage(50.0%) tRNA NA
DBSCAN-SWA_108 1469647 : 1471141 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_109 1481872 : 1482832 1 Shigella_phage(100.0%) NA NA
DBSCAN-SWA_110 1494931 : 1498869 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_111 1505101 : 1507734 4 Paramecium_bursaria_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_112 1512021 : 1516816 4 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_113 1533260 : 1547439 10 Brevibacillus_phage(20.0%) NA NA
DBSCAN-SWA_114 1559893 : 1561750 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_115 1565442 : 1569639 3 Acanthamoeba_polyphaga_mimivirus(33.33%) protease NA
DBSCAN-SWA_116 1600241 : 1600949 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_117 1614468 : 1615740 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_118 1628285 : 1634700 7 Emiliania_huxleyi_virus(33.33%) NA NA
DBSCAN-SWA_119 1644860 : 1647584 3 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_120 1656999 : 1657566 1 Abalone_herpesvirus(100.0%) NA NA
DBSCAN-SWA_121 1669272 : 1680095 8 uncultured_virus(40.0%) tRNA NA
DBSCAN-SWA_122 1698728 : 1706495 6 uncultured_virus(66.67%) NA NA
DBSCAN-SWA_123 1721346 : 1722168 1 Grouper_iridovirus(100.0%) NA NA
DBSCAN-SWA_124 1754504 : 1759764 5 Acinetobacter_phage(33.33%) protease NA
DBSCAN-SWA_125 1763287 : 1764505 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_126 1777962 : 1782254 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_127 1785446 : 1788349 3 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_128 1797122 : 1798910 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_129 1803809 : 1804811 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_130 1813522 : 1814044 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_131 1817528 : 1825458 3 Herpes_simplex_virus(50.0%) NA NA
DBSCAN-SWA_132 1828735 : 1829494 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_133 1846369 : 1847029 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_134 1867292 : 1869839 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_135 1873359 : 1873956 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_136 1897523 : 1902933 8 Bodo_saltans_virus(25.0%) NA NA
DBSCAN-SWA_137 1910792 : 1911539 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_138 1915839 : 1918206 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_139 1921313 : 1926901 3 Klosneuvirus(50.0%) transposase NA
DBSCAN-SWA_140 1942547 : 1943501 1 Bathycoccus_sp._RCC1105_virus(100.0%) NA NA
DBSCAN-SWA_141 1968757 : 2052887 56 unidentified_phage(30.0%) integrase,transposase,tRNA,protease attL 1975842:1975878|attR 2051234:2051270
DBSCAN-SWA_142 2062790 : 2065370 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_143 2069725 : 2075155 6 Bacillus_virus(66.67%) NA NA
DBSCAN-SWA_144 2083829 : 2085566 1 Klosneuvirus(100.0%) tRNA NA
DBSCAN-SWA_145 2102228 : 2105340 5 Prochlorococcus_phage(50.0%) NA NA
DBSCAN-SWA_146 2113280 : 2115012 2 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_147 2130263 : 2134728 3 Vibrio_phage(50.0%) transposase NA
DBSCAN-SWA_148 2138060 : 2139167 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_149 2142350 : 2153112 9 Staphylococcus_phage(25.0%) NA NA
DBSCAN-SWA_150 2165498 : 2167662 2 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_151 2173076 : 2179815 6 Aeromonas_phage(25.0%) NA NA
DBSCAN-SWA_152 2195726 : 2198647 2 Clostridium_phage(50.0%) NA NA
DBSCAN-SWA_153 2202013 : 2204023 1 Ralstonia_phage(100.0%) NA NA
DBSCAN-SWA_154 2209219 : 2218733 5 Tupanvirus(50.0%) tRNA NA
DBSCAN-SWA_155 2226998 : 2229582 2 Aureococcus_anophage(50.0%) NA NA
DBSCAN-SWA_156 2240147 : 2250514 8 Acinetobacter_phage(25.0%) integrase attL 2238683:2238695|attR 2255647:2255659
DBSCAN-SWA_157 2256255 : 2267600 9 unidentified_phage(33.33%) integrase attL 2252394:2252410|attR 2276555:2276571
DBSCAN-SWA_158 2275253 : 2277464 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_159 2297455 : 2297965 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_160 2312370 : 2313324 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_161 2318573 : 2320091 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_162 2326528 : 2333375 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_163 2364649 : 2369303 4 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_164 2381993 : 2383313 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_165 2388925 : 2408039 13 Enterococcus_phage(14.29%) tRNA NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_CP024598.1|WP_004584358.1|677469_677883_+|PcfK-like-protein 677469_677883_+ 137 aa aa 40 NA NA No NA
NZ_CP024598.1|WP_099840728.1|2302673_2303090_-|PcfK-like-protein 2302673_2303090_- 138 aa aa 40 NA NA No NA
NZ_CP024598.1|WP_099841339.1|1146166_1147915_-|phospho-sugar-mutase 1146166_1147915_- 582 aa aa NA NA NA 1146166-1151796 yes