Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP024608 Massilia violaceinigra strain B2 chromosome 6 crisprs RT,csa3,DEDDh,DinG,WYL,cas3 2 1 8 0
NZ_CP024609 Massilia violaceinigra strain B2 plasmid unnamed, complete sequence 0 crisprs PD-DExK,WYL 0 0 0 0

Results visualization

1. NZ_CP024608
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024608_1 182596-182701 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024608_2 2130610-2131369 Orphan NA
18 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024608_3 2697941-2698032 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024608_4 2737721-2737917 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024608_5 4929947-4930036 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024608_6 5342282-5342391 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP024608_2 2.11|2131019|20|NZ_CP024608|CRT 2131019-2131038 20 NZ_CP024608.1 5178446-5178465 2 0.9
NZ_CP024608_2 2.13|2131097|20|NZ_CP024608|CRT 2131097-2131116 20 NZ_CP024608.1 4287762-4287781 2 0.9

1. spacer 2.11|2131019|20|NZ_CP024608|CRT matches to position: 5178446-5178465, mismatch: 2, identity: 0.9

cgctgtcggcactggtcctc	CRISPR spacer
cgctgtcggcactgatcgtc	Protospacer
**************.** **

2. spacer 2.13|2131097|20|NZ_CP024608|CRT matches to position: 4287762-4287781, mismatch: 2, identity: 0.9

cgctgtcggcgctggtcctc	CRISPR spacer
cgctttcggcgctggtgctc	Protospacer
**** *********** ***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP024608_2 2.13|2131097|20|NZ_CP024608|CRT 2131097-2131116 20 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 184490-184509 1 0.95
NZ_CP024608_2 2.13|2131097|20|NZ_CP024608|CRT 2131097-2131116 20 NZ_CP015419 Rhodovulum sulfidophilum DSM 1374 plasmid unnamed1, complete sequence 51602-51621 1 0.95
NZ_CP024608_2 2.13|2131097|20|NZ_CP024608|CRT 2131097-2131116 20 NZ_CP025431 Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence 115061-115080 1 0.95
NZ_CP024608_2 2.13|2131097|20|NZ_CP024608|CRT 2131097-2131116 20 NZ_CP015422 Rhodovulum sulfidophilum strain SNK001 plasmid, complete sequence 51502-51521 1 0.95
NZ_CP024608_2 2.13|2131097|20|NZ_CP024608|CRT 2131097-2131116 20 NZ_AP014802 Rhodovulum sulfidophilum plasmid Plasmid2 DNA, complete genome, strain: DSM 2351 17290-17309 1 0.95

1. spacer 2.13|2131097|20|NZ_CP024608|CRT matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 1, identity: 0.95

cgctgtcggcgctggtcctc	CRISPR spacer
cgctgtcggcgctggtcctg	Protospacer
******************* 

2. spacer 2.13|2131097|20|NZ_CP024608|CRT matches to NZ_CP015419 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.95

cgctgtcggcgctggtcctc	CRISPR spacer
cgctgtcggcgctggtcctg	Protospacer
******************* 

3. spacer 2.13|2131097|20|NZ_CP024608|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 1, identity: 0.95

cgctgtcggcgctggtcctc	CRISPR spacer
cgctgtcggcgctggtcctg	Protospacer
******************* 

4. spacer 2.13|2131097|20|NZ_CP024608|CRT matches to NZ_CP015422 (Rhodovulum sulfidophilum strain SNK001 plasmid, complete sequence) position: , mismatch: 1, identity: 0.95

cgctgtcggcgctggtcctc	CRISPR spacer
cgctgtcggcgctggtcctg	Protospacer
******************* 

5. spacer 2.13|2131097|20|NZ_CP024608|CRT matches to NZ_AP014802 (Rhodovulum sulfidophilum plasmid Plasmid2 DNA, complete genome, strain: DSM 2351) position: , mismatch: 1, identity: 0.95

cgctgtcggcgctggtcctc	CRISPR spacer
cgctgtcggcgctggtcctg	Protospacer
******************* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1540848 : 1552954 8 Dickeya_phage(16.67%) tRNA NA
DBSCAN-SWA_2 2391788 : 2453860 50 Bacillus_phage(22.22%) transposase NA
DBSCAN-SWA_3 2531172 : 2557492 33 Pseudomonas_phage(38.46%) portal,protease,tail,capsid,transposase,head,terminase NA
DBSCAN-SWA_4 3481632 : 3539336 41 Bacillus_phage(33.33%) transposase,integrase attL 3474916:3474932|attR 3523031:3523047
DBSCAN-SWA_5 6251748 : 6304895 43 Organic_Lake_phycodnavirus(11.11%) holin,transposase NA
DBSCAN-SWA_6 6470571 : 6501090 53 Pseudomonas_phage(19.05%) portal,protease,capsid,head,integrase,terminase attL 6461649:6461666|attR 6503370:6503387
DBSCAN-SWA_7 6933157 : 6987637 53 Burkholderia_virus(30.77%) portal,protease,tail,capsid,terminase,head,integrase,transposase attL 6937080:6937097|attR 6991267:6991284
DBSCAN-SWA_8 7413302 : 7435771 27 Burkholderia_virus(30.0%) portal,protease,tail,capsid,terminase,head,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage