Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP024389 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-lp6-1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP024380 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-5 0 crisprs NA 0 0 0 0
NZ_CP024371 Borrelia miyamotoi strain Izh-14 chromosome, complete genome 0 crisprs NA 0 0 1 0
NZ_CP024374 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-lp41, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP024372 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-lp72, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP024373 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-1 0 crisprs NA 0 0 0 0
NZ_CP024386 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-11 0 crisprs NA 0 0 0 0
NZ_CP024385 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-10 1 crisprs NA 1 1 0 0
NZ_CP024382 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-7 0 crisprs NA 0 0 0 0
NZ_CP024383 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-8 0 crisprs NA 0 0 0 0
NZ_CP024379 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-4 0 crisprs NA 0 0 0 0
NZ_CP024388 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-13 0 crisprs NA 0 0 0 0
NZ_CP024378 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-3, complete sequence 1 crisprs NA 0 1 0 0
NZ_CP024375 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-2 0 crisprs NA 0 0 0 0
NZ_CP024376 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-lp26, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP024381 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-6 0 crisprs NA 0 0 0 0
NZ_CP024387 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-12 0 crisprs NA 0 0 0 0
NZ_CP024384 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-9 0 crisprs NA 0 0 0 0
NZ_CP024377 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-lp23, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP024378
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024378_1 22174-22256 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP024378_1 1.1|22203|25|NZ_CP024378|CRISPRCasFinder 22203-22227 25 NZ_CP024338 Borrelia miyamotoi strain Yekat-1 plasmid pYkt1-3 5575-5599 0 1.0
NZ_CP024378_1 1.1|22203|25|NZ_CP024378|CRISPRCasFinder 22203-22227 25 NZ_CP024378 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-3, complete sequence 22203-22227 0 1.0

1. spacer 1.1|22203|25|NZ_CP024378|CRISPRCasFinder matches to NZ_CP024338 (Borrelia miyamotoi strain Yekat-1 plasmid pYkt1-3) position: , mismatch: 0, identity: 1.0

ttcggctcttaatcctgcatctact	CRISPR spacer
ttcggctcttaatcctgcatctact	Protospacer
*************************

2. spacer 1.1|22203|25|NZ_CP024378|CRISPRCasFinder matches to NZ_CP024378 (Borrelia miyamotoi strain Izh-14 plasmid pIzh14-3, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggctcttaatcctgcatctact	CRISPR spacer
ttcggctcttaatcctgcatctact	Protospacer
*************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP024371
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 446050 : 455290 9 Streptococcus_phage(42.86%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP024385
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP024385_1 765-879 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024380.1 22781-22839 0 1.0

1. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to position: 22781-22839, mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024394 Borrelia miyamotoi strain Izh-4 plasmid pIzh4-2 2392-2450 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024319 Borrelia miyamotoi strain Yekat-6 plasmid pYkt6-lp23, complete sequence 2348-2406 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024396 Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp29, complete sequence 2441-2499 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024212 Borrelia miyamotoi strain Izh-5 plasmid pIzh5-5 2391-2449 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024215 Borrelia miyamotoi strain Izh-5 plasmid pIzh5-8 1699-1757 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024399 Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp24, complete sequence 2486-2544 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024354 Borrelia miyamotoi strain Izh-16 plasmid pIzh16-lp41-1, complete sequence 2439-2497 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024359 Borrelia miyamotoi strain Izh-16 plasmid pIzh16-5 2448-2506 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024362 Borrelia miyamotoi strain Izh-16 plasmid pIzh16-lp23, complete sequence 20919-20977 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024362 Borrelia miyamotoi strain Izh-16 plasmid pIzh16-lp23, complete sequence 16099-16157 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024385 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-10 793-851 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024403 Borrelia miyamotoi strain Izh-4 plasmid pIzh4-10 10956-11014 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024324 Borrelia miyamotoi strain Yekat-6 plasmid pYkt6-5 21493-21551 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024393 Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp41, complete sequence 38695-38753 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024397 Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp23, complete sequence 25222-25280 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024208 Borrelia miyamotoi strain Izh-5 plasmid pIzh5-lp41, complete sequence 37689-37747 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024216 Borrelia miyamotoi strain Izh-5 plasmid pIzh5-lp23, complete sequence 20606-20664 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024355 Borrelia miyamotoi strain Izh-16 plasmid pIzh16-lp41-2, complete sequence 37689-37747 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024361 Borrelia miyamotoi strain Izh-16 plasmid pIzh16-7 21519-21577 0 1.0
NZ_CP024385_1 1.1|793|59|NZ_CP024385|CRISPRCasFinder 793-851 59 NZ_CP024380 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-5 22781-22839 0 1.0

1. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024394 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-2) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

2. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024319 (Borrelia miyamotoi strain Yekat-6 plasmid pYkt6-lp23, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

3. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024396 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp29, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

4. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024212 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-5) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

5. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024215 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-8) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

6. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024399 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp24, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

7. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024354 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-lp41-1, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

8. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024359 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-5) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

9. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024362 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-lp23, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

10. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024362 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-lp23, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

11. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024385 (Borrelia miyamotoi strain Izh-14 plasmid pIzh14-10) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

12. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024403 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-10) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

13. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024324 (Borrelia miyamotoi strain Yekat-6 plasmid pYkt6-5) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

14. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024393 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp41, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

15. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024397 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp23, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

16. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024208 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-lp41, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

17. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024216 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-lp23, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

18. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024355 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-lp41-2, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

19. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024361 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-7) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

20. spacer 1.1|793|59|NZ_CP024385|CRISPRCasFinder matches to NZ_CP024380 (Borrelia miyamotoi strain Izh-14 plasmid pIzh14-5) position: , mismatch: 0, identity: 1.0

tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	CRISPR spacer
tcttttgaatcatcatcttctattacttcttttctaacagactcttctttgactgctgg	Protospacer
***********************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP024380
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage