Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP018020 Mycobacterium avium subsp. hominissuis strain OCU873s_P7_4s chromosome, complete genome 8 crisprs cas3,csa3,DinG,DEDDh,cas4,WYL,PD-DExK,PrimPol 1 10 1 0

Results visualization

1. NZ_CP018020
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018020_1 1191043-1191120 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018020_2 2069272-2069362 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018020_3 2305242-2305327 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018020_4 2317787-2317869 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018020_5 2508161-2508262 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018020_6 3499768-3499854 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018020_7 3573274-3573364 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP018020_8 4606324-4606638 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP018020_3 3.1|2305268|34|NZ_CP018020|CRISPRCasFinder 2305268-2305301 34 NZ_CP018020.1 2305298-2305331 1 0.971

1. spacer 3.1|2305268|34|NZ_CP018020|CRISPRCasFinder matches to position: 2305298-2305331, mismatch: 1, identity: 0.971 

ctcgcgcgccggcgtcacgccagcgtgacgctcg	CRISPR spacer
ctcgcgcgccggcgccacgccagcgtgacgctcg	Protospacer
**************.*******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 NZ_AP017899 Sphingopyxis sp. FD7 plasmid pSFD01, complete sequence 13604-13632 4 0.862
NZ_CP018020_8 8.4|4606468|27|NZ_CP018020|CRT 4606468-4606494 27 NC_012520 Rhodococcus opacus B4 plasmid pROB01, complete sequence 175655-175681 4 0.852
NZ_CP018020_8 8.7|4606594|27|NZ_CP018020|CRT 4606594-4606620 27 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 363455-363481 4 0.852
NZ_CP018020_8 8.2|4606378|27|NZ_CP018020|CRT 4606378-4606404 27 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 344709-344735 5 0.815
NZ_CP018020_8 8.3|4606423|27|NZ_CP018020|CRT 4606423-4606449 27 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 344709-344735 5 0.815
NZ_CP018020_8 8.4|4606468|27|NZ_CP018020|CRT 4606468-4606494 27 NZ_CP017753 Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence 143321-143347 5 0.815
NZ_CP018020_8 8.4|4606468|27|NZ_CP018020|CRT 4606468-4606494 27 NC_021909 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1e, complete sequence 563679-563705 5 0.815
NZ_CP018020_8 8.4|4606468|27|NZ_CP018020|CRT 4606468-4606494 27 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 191552-191578 5 0.815
NZ_CP018020_8 8.4|4606468|27|NZ_CP018020|CRT 4606468-4606494 27 NZ_CP030828 Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence 184455-184481 5 0.815
NZ_CP018020_8 8.4|4606468|27|NZ_CP018020|CRT 4606468-4606494 27 NZ_CP016820 Rhodococcus sp. p52 plasmid pDF02, complete sequence 169758-169784 5 0.815
NZ_CP018020_8 8.7|4606594|27|NZ_CP018020|CRT 4606594-4606620 27 NC_016592 Burkholderia sp. YI23 plasmid byi_3p, complete sequence 62666-62692 5 0.815
NZ_CP018020_8 8.7|4606594|27|NZ_CP018020|CRT 4606594-4606620 27 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 461543-461569 5 0.815
NZ_CP018020_8 8.7|4606594|27|NZ_CP018020|CRT 4606594-4606620 27 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 33328-33354 5 0.815
NZ_CP018020_8 8.7|4606594|27|NZ_CP018020|CRT 4606594-4606620 27 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 49056-49082 5 0.815
NZ_CP018020_8 8.7|4606594|27|NZ_CP018020|CRT 4606594-4606620 27 MK411746 Arthrobacter phage Sonali, complete genome 7847-7873 5 0.815
NZ_CP018020_8 8.7|4606594|27|NZ_CP018020|CRT 4606594-4606620 27 NZ_AP018829 Asticcacaulis excentricus strain M6 plasmid pASEM-1, complete sequence 219001-219027 5 0.815
NZ_CP018020_1 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder 1191067-1191096 30 NZ_CP015530 Rhodococcus sp. WB1 plasmid pWB1, complete sequence 79911-79940 6 0.8
NZ_CP018020_5 5.1|2508197|30|NZ_CP018020|CRISPRCasFinder 2508197-2508226 30 NZ_CP017759 Cupriavidus necator strain NH9 plasmid pENH92, complete sequence 173978-174007 6 0.8
NZ_CP018020_5 5.1|2508197|30|NZ_CP018020|CRISPRCasFinder 2508197-2508226 30 NC_015727 Cupriavidus necator N-1 plasmid pBB1, complete sequence 542987-543016 6 0.8
NZ_CP018020_8 8.2|4606378|27|NZ_CP018020|CRT 4606378-4606404 27 NC_016592 Burkholderia sp. YI23 plasmid byi_3p, complete sequence 62666-62692 6 0.778
NZ_CP018020_8 8.2|4606378|27|NZ_CP018020|CRT 4606378-4606404 27 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 134732-134758 6 0.778
NZ_CP018020_8 8.3|4606423|27|NZ_CP018020|CRT 4606423-4606449 27 NC_016592 Burkholderia sp. YI23 plasmid byi_3p, complete sequence 62666-62692 6 0.778
NZ_CP018020_8 8.3|4606423|27|NZ_CP018020|CRT 4606423-4606449 27 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 134732-134758 6 0.778
NZ_CP018020_8 8.4|4606468|27|NZ_CP018020|CRT 4606468-4606494 27 NZ_CP029211 Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence 218713-218739 6 0.778
NZ_CP018020_8 8.5|4606513|27|NZ_CP018020|CRT 4606513-4606539 27 NZ_CP010737 Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence 25674-25700 6 0.778
NZ_CP018020_8 8.7|4606594|27|NZ_CP018020|CRT 4606594-4606620 27 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 678281-678307 6 0.778
NZ_CP018020_8 8.7|4606594|27|NZ_CP018020|CRT 4606594-4606620 27 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 344709-344735 6 0.778
NZ_CP018020_8 8.7|4606594|27|NZ_CP018020|CRT 4606594-4606620 27 NZ_LR594663 Variovorax sp. RA8 plasmid 2 209825-209851 6 0.778
NZ_CP018020_1 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder 1191067-1191096 30 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 125440-125469 7 0.767
NZ_CP018020_1 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder 1191067-1191096 30 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 576541-576570 7 0.767
NZ_CP018020_1 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder 1191067-1191096 30 NC_013193 Candidatus Accumulibacter phosphatis clade IIA str. UW-1 plasmid pAph01, complete sequence 107046-107075 7 0.767
NZ_CP018020_1 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder 1191067-1191096 30 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 517672-517701 7 0.767
NZ_CP018020_1 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder 1191067-1191096 30 MT657333 Microbacterium phage Casend, complete genome 60372-60401 7 0.767
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_LR134456 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence 154500-154530 7 0.774
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 352345-352375 7 0.774
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 407323-407353 7 0.774
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 381791-381821 7 0.774
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 75346-75376 7 0.774
NZ_CP018020_5 5.1|2508197|30|NZ_CP018020|CRISPRCasFinder 2508197-2508226 30 NZ_AP022334 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence 34927-34956 7 0.767
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 NZ_CP041223 Porphyrobacter sp. YT40 plasmid pYT40, complete sequence 176682-176710 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MN234205 Mycobacterium phage Veliki, complete genome 28094-28122 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MH727544 Mycobacterium phage Dalmuri, complete genome 28091-28119 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 JF704105 Mycobacterium phage Adephagia, complete sequence 28057-28085 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MN234182 Mycobacterium phage Geraldini, complete genome 28068-28096 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MN234198 Mycobacterium phage Zavala, complete genome 28033-28061 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MF140412 Mycobacterium phage Jeckyll, complete genome 28091-28119 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 KY380102 Mycobacterium phage CREW, complete genome 28091-28119 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 KX585253 Mycobacterium phage HedwigODU, complete genome 28060-28088 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MN234230 Mycobacterium phage Atiba, complete genome 28020-28048 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MF140430 Mycobacterium phage Tachez, complete genome 28020-28048 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MH536822 Mycobacterium phage Joy99, complete genome 28020-28048 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MF140428 Mycobacterium phage Slimphazie, complete genome 28058-28086 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 KJ567045 Mycobacterium phage Emerson, complete genome 28051-28079 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MK460247 Mycobacterium phage YoureAdopted, complete genome 28027-28055 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 JN185608 Mycobacterium virus JAWS, complete genome 28045-28073 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MN234231 Mycobacterium phage Rapunzel97, complete genome 28058-28086 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MN908692 Mycobacterium Phage BGlluviae, complete genome 28091-28119 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 NC_023747 Mycobacterium phage BarrelRoll, complete genome 28043-28071 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MH536821 Mycobacterium phage Homura, complete genome 28091-28119 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MH697578 Mycobacterium phage Belladonna, complete genome 28091-28119 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MH077577 Mycobacterium phage AlishaPH, complete genome 28050-28078 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MH509444 Mycobacterium phage BEEST, complete genome 28091-28119 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MN369742 Mycobacterium phage Spock, complete genome 28091-28119 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MK112537 Mycobacterium Phage Capricorn, complete genome 28091-28119 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MN369746 Mycobacterium phage Inky, complete genome 28091-28119 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MH051246 Mycobacterium phage ActinUp, complete genome 28060-28088 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MH513977 Mycobacterium phage Mynx, complete genome 28074-28102 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MN234197 Mycobacterium phage Ramen, complete genome 28057-28085 7 0.759
NZ_CP018020_6 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder 3499797-3499825 29 MH371113 Mycobacterium phage Beezoo, complete genome 28068-28096 7 0.759
NZ_CP018020_8 8.7|4606594|27|NZ_CP018020|CRT 4606594-4606620 27 NZ_CP010737 Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence 25674-25700 7 0.741
NZ_CP018020_1 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder 1191067-1191096 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4993432-4993461 8 0.733
NZ_CP018020_1 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder 1191067-1191096 30 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 34530-34559 8 0.733
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 617924-617954 8 0.742
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1195145-1195175 8 0.742
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 114909-114939 8 0.742
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 347972-348002 8 0.742
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 78885-78915 8 0.742
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 627680-627710 8 0.742
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP020333 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM170, complete sequence 129286-129316 8 0.742
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 423630-423660 8 0.742
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP010957 Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence 23934-23964 8 0.742
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 261069-261099 8 0.742
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NC_015378 Burkholderia gladioli BSR3 plasmid bgla_3p, complete sequence 123169-123199 8 0.742
NZ_CP018020_5 5.1|2508197|30|NZ_CP018020|CRISPRCasFinder 2508197-2508226 30 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 724710-724739 8 0.733
NZ_CP018020_1 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder 1191067-1191096 30 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 132707-132736 9 0.7
NZ_CP018020_1 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder 1191067-1191096 30 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 326083-326112 9 0.7
NZ_CP018020_1 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder 1191067-1191096 30 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1583679-1583708 9 0.7
NZ_CP018020_1 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder 1191067-1191096 30 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 369234-369263 9 0.7
NZ_CP018020_3 3.1|2305268|34|NZ_CP018020|CRISPRCasFinder 2305268-2305301 34 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 499531-499564 9 0.735
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1765139-1765169 9 0.71
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1847934-1847964 9 0.71
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1687172-1687202 9 0.71
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1757387-1757417 9 0.71
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1686194-1686224 9 0.71
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1764137-1764167 9 0.71
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1764138-1764168 9 0.71
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1687165-1687195 9 0.71
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1686486-1686516 9 0.71
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1687154-1687184 9 0.71
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1765312-1765342 9 0.71
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1765310-1765340 9 0.71
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1765279-1765309 9 0.71
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 790445-790475 9 0.71
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 77627-77657 9 0.71
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 990514-990544 9 0.71
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2356152-2356182 9 0.71
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 225402-225432 9 0.71
NZ_CP018020_5 5.1|2508197|30|NZ_CP018020|CRISPRCasFinder 2508197-2508226 30 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 324728-324757 9 0.7
NZ_CP018020_5 5.1|2508197|30|NZ_CP018020|CRISPRCasFinder 2508197-2508226 30 NZ_CP024425 Paracoccus yeei strain TT13 plasmid pTT13-3, complete sequence 19254-19283 9 0.7
NZ_CP018020_5 5.1|2508197|30|NZ_CP018020|CRISPRCasFinder 2508197-2508226 30 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 297882-297911 9 0.7
NZ_CP018020_5 5.1|2508197|30|NZ_CP018020|CRISPRCasFinder 2508197-2508226 30 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 58083-58112 9 0.7
NZ_CP018020_3 3.1|2305268|34|NZ_CP018020|CRISPRCasFinder 2305268-2305301 34 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1183994-1184027 10 0.706
NZ_CP018020_3 3.1|2305268|34|NZ_CP018020|CRISPRCasFinder 2305268-2305301 34 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 862233-862266 10 0.706
NZ_CP018020_3 3.1|2305268|34|NZ_CP018020|CRISPRCasFinder 2305268-2305301 34 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1184130-1184163 10 0.706
NZ_CP018020_3 3.1|2305268|34|NZ_CP018020|CRISPRCasFinder 2305268-2305301 34 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 912101-912134 10 0.706
NZ_CP018020_3 3.1|2305268|34|NZ_CP018020|CRISPRCasFinder 2305268-2305301 34 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 906221-906254 10 0.706
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 326295-326325 10 0.677
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1486772-1486802 10 0.677
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 KT381864 Thiobacimonas phage vB_ThpS-P1, complete genome 38274-38304 10 0.677
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NC_011984 Agrobacterium vitis S4 plasmid pAtS4c, complete sequence 146563-146593 10 0.677
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NC_011982 Agrobacterium vitis S4 plasmid pTiS4, complete sequence 88203-88233 10 0.677
NZ_CP018020_4 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder 2317813-2317843 31 NZ_KY000031 Agrobacterium genomosp. 1 strain Tun198 plasmid pTi_Tun198, complete sequence 16591-16621 10 0.677

1. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to NZ_AP017899 (Sphingopyxis sp. FD7 plasmid pSFD01, complete sequence) position: , mismatch: 4, identity: 0.862 

ccaggc-ccgatcgcctgcgctccagctac	CRISPR spacer
-gaggcgccgatcgcctgagctgcagctac	Protospacer
  **** *********** *** *******

2. spacer 8.4|4606468|27|NZ_CP018020|CRT matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 4, identity: 0.852 

gccggagc-gtggccaccgccgcacccg	CRISPR spacer
-ccagtccggtggccaccgccgcacccg	Protospacer
 **.*  * *******************

3. spacer 8.7|4606594|27|NZ_CP018020|CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852 

--gccggggcgtggcccccgccgaagccg	CRISPR spacer
aagcc--ggcgtggcccacgccgaagcct	Protospacer
  ***  ********** **********

4. spacer 8.2|4606378|27|NZ_CP018020|CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815 

gccggggcgtggcccccgccgaacccg	CRISPR spacer
gccggggcgcggcccacgccgaacagc	Protospacer
*********.***** ********

5. spacer 8.3|4606423|27|NZ_CP018020|CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815 

gccggggcgtggcccccgccgaacccg	CRISPR spacer
gccggggcgcggcccacgccgaacagc	Protospacer
*********.***** ********

6. spacer 8.4|4606468|27|NZ_CP018020|CRT matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815 

gccggagcgtggccaccgccgcacccg	CRISPR spacer
gctccagcgtggccaccgccacaccca	Protospacer
**.  ***************.*****.

7. spacer 8.4|4606468|27|NZ_CP018020|CRT matches to NC_021909 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1e, complete sequence) position: , mismatch: 5, identity: 0.815 

gccggagcgtggccaccgccgcacccg	CRISPR spacer
gccggaccgtggtcaccgccgcagcac	Protospacer
****** *****.********** *

8. spacer 8.4|4606468|27|NZ_CP018020|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 5, identity: 0.815 

gccggagcgtggccaccgccgcacccg	CRISPR spacer
ggcacggcgtggccgccgccgcacccg	Protospacer
* *. .********.************

9. spacer 8.4|4606468|27|NZ_CP018020|CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 5, identity: 0.815 

gccggagcgtggccaccgccgcacccg	CRISPR spacer
gggcgagcgtggcgacagccgcacccg	Protospacer
*   ********* ** **********

10. spacer 8.4|4606468|27|NZ_CP018020|CRT matches to NZ_CP016820 (Rhodococcus sp. p52 plasmid pDF02, complete sequence) position: , mismatch: 5, identity: 0.815 

gccggagcgtggccaccgccgcacccg	CRISPR spacer
gatggaccgtcgccaccgccgcaccca	Protospacer
* .*** *** ***************.

11. spacer 8.7|4606594|27|NZ_CP018020|CRT matches to NC_016592 (Burkholderia sp. YI23 plasmid byi_3p, complete sequence) position: , mismatch: 5, identity: 0.815 

gccggggcgtggcccccgccgaagccg	CRISPR spacer
gccggggcgacgcccccgccgaagatc	Protospacer
*********  ************* .

12. spacer 8.7|4606594|27|NZ_CP018020|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 5, identity: 0.815 

gccggggcgtggcccccgccgaagccg	CRISPR spacer
ccgcgggcgtggccgccgccgaagcct	Protospacer
 *  ********** ***********

13. spacer 8.7|4606594|27|NZ_CP018020|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 5, identity: 0.815 

gccggggcgtggcccccgccgaagccg	CRISPR spacer
gggcgggcgtggcccgcgccgatgccg	Protospacer
*   *********** ****** ****

14. spacer 8.7|4606594|27|NZ_CP018020|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815 

gccggggcgtggcccccgccgaagccg	CRISPR spacer
acgtgggcgttgaccccgccgaagccg	Protospacer
.*  ****** * **************

15. spacer 8.7|4606594|27|NZ_CP018020|CRT matches to MK411746 (Arthrobacter phage Sonali, complete genome) position: , mismatch: 5, identity: 0.815 

gccggggcgtggcccccgccgaagccg	CRISPR spacer
gctccggcgtggcctccgccgaagcct	Protospacer
**.  *********.***********

16. spacer 8.7|4606594|27|NZ_CP018020|CRT matches to NZ_AP018829 (Asticcacaulis excentricus strain M6 plasmid pASEM-1, complete sequence) position: , mismatch: 5, identity: 0.815 

gccgg--ggcgtggcccccgccgaagccg	CRISPR spacer
--cgatcggcgtggcccccgccgaagtgg	Protospacer
  **.  *******************. *

17. spacer 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 6, identity: 0.8 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
gctcccgcggcggcggttcggtgcgcaggg	Protospacer
 * ********* **********.**.* *

18. spacer 5.1|2508197|30|NZ_CP018020|CRISPRCasFinder matches to NZ_CP017759 (Cupriavidus necator strain NH9 plasmid pENH92, complete sequence) position: , mismatch: 6, identity: 0.8 

agttcggctgcggtgctggccaattcgcgg	CRISPR spacer
agttgggttgcggtgctggccaataagtga	Protospacer
**** **.****************  *.*.

19. spacer 5.1|2508197|30|NZ_CP018020|CRISPRCasFinder matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 6, identity: 0.8 

agttcggctgcggtgctggccaattcgcgg	CRISPR spacer
agttcggctgcggtgcaggccagtgtggtg	Protospacer
**************** *****.* .*  *

20. spacer 8.2|4606378|27|NZ_CP018020|CRT matches to NC_016592 (Burkholderia sp. YI23 plasmid byi_3p, complete sequence) position: , mismatch: 6, identity: 0.778 

gccggggcgtggcccccgccgaacccg	CRISPR spacer
gccggggcgacgcccccgccgaagatc	Protospacer
*********  ************  .

21. spacer 8.2|4606378|27|NZ_CP018020|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 6, identity: 0.778 

gccggggcgtggcccccgccgaacccg	CRISPR spacer
accgggtcgtggccctcgccgaacagt	Protospacer
.***** ********.********

22. spacer 8.3|4606423|27|NZ_CP018020|CRT matches to NC_016592 (Burkholderia sp. YI23 plasmid byi_3p, complete sequence) position: , mismatch: 6, identity: 0.778 

gccggggcgtggcccccgccgaacccg	CRISPR spacer
gccggggcgacgcccccgccgaagatc	Protospacer
*********  ************  .

23. spacer 8.3|4606423|27|NZ_CP018020|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 6, identity: 0.778 

gccggggcgtggcccccgccgaacccg	CRISPR spacer
accgggtcgtggccctcgccgaacagt	Protospacer
.***** ********.********

24. spacer 8.4|4606468|27|NZ_CP018020|CRT matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 6, identity: 0.778 

gccggagcgtggccaccgccgcacccg	CRISPR spacer
caacgaccgtggccagcgccgcacccg	Protospacer
    ** ******** ***********

25. spacer 8.5|4606513|27|NZ_CP018020|CRT matches to NZ_CP010737 (Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence) position: , mismatch: 6, identity: 0.778 

gccggagcgtggccaccgccgaagccg	CRISPR spacer
aagaacgcgtggccaccgccgaagccg	Protospacer
.  .. *********************

26. spacer 8.7|4606594|27|NZ_CP018020|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 6, identity: 0.778 

gccggggcgtggcccccgccgaagccg	CRISPR spacer
agatgggcgtggccctcgacgaagccg	Protospacer
.   ***********.** ********

27. spacer 8.7|4606594|27|NZ_CP018020|CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778 

gccggggcgtggcccccgccgaagccg	CRISPR spacer
gccggggcgcggcccacgccgaacagc	Protospacer
*********.***** *******

28. spacer 8.7|4606594|27|NZ_CP018020|CRT matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.778 

gccggggcgtggcccccgccgaagccg	CRISPR spacer
aggaggacgtggcccgcgccgaagccg	Protospacer
.  .**.******** ***********

29. spacer 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
ccggtcgcgtcgccggttcggtgtgcgggc	Protospacer
.*. .**** ******************

30. spacer 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.767 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
cgggcagcggcgccggctcggtgtgcggca	Protospacer
. . * **********.************.

31. spacer 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder matches to NC_013193 (Candidatus Accumulibacter phosphatis clade IIA str. UW-1 plasmid pAph01, complete sequence) position: , mismatch: 7, identity: 0.767 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
ccggcagcggcgccggttcgctgtgccgct	Protospacer
.*. * ************** ***** **

32. spacer 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
ccgtcaccgccgccggttcggtgagcggcg	Protospacer
.*..*  ** ************* ******

33. spacer 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder matches to MT657333 (Microbacterium phage Casend, complete genome) position: , mismatch: 7, identity: 0.767 

tcacccgcggcgccggttcggtgtgcggcg----	CRISPR spacer
tctcccgcggcaccggttcggt----gacgccct	Protospacer
** ********.**********    *.**

34. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 7, identity: 0.774 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
tggcgacgatgcgggtcgggccgacggggaa	Protospacer
***************.*******.*  *...

35. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 7, identity: 0.774 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
gctcgacgatgcgggccgcgccggccagcgc	Protospacer
   *************** ******* * *

36. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 7, identity: 0.774 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
ggtcgacgatgcgggccacgccggcctcggg	Protospacer
 * **************. *******. .**

37. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 7, identity: 0.774 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
ggtcgacgatgcgggccacgccggcctcggg	Protospacer
 * **************. *******. .**

38. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 7, identity: 0.774 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
tggcgacgatgcggcccgcgccgcgctgctg	Protospacer
************** *** ****  *.*  *

39. spacer 5.1|2508197|30|NZ_CP018020|CRISPRCasFinder matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 7, identity: 0.767 

agttcggctgcggtgctggccaattcgcgg	CRISPR spacer
atgaggccttcggcgctggccaattcgcgg	Protospacer
*    * ** ***.****************

40. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to NZ_CP041223 (Porphyrobacter sp. YT40 plasmid pYT40, complete sequence) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
gtggcgccgatcgcctgagctgcagctac	Protospacer
 ..*  *********** *** *******

41. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MN234205 (Mycobacterium phage Veliki, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

42. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MH727544 (Mycobacterium phage Dalmuri, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

43. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to JF704105 (Mycobacterium phage Adephagia, complete sequence) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

44. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MN234182 (Mycobacterium phage Geraldini, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

45. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MN234198 (Mycobacterium phage Zavala, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

46. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MF140412 (Mycobacterium phage Jeckyll, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

47. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to KY380102 (Mycobacterium phage CREW, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

48. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to KX585253 (Mycobacterium phage HedwigODU, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

49. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MN234230 (Mycobacterium phage Atiba, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

50. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MF140430 (Mycobacterium phage Tachez, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

51. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MH536822 (Mycobacterium phage Joy99, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

52. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MF140428 (Mycobacterium phage Slimphazie, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

53. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to KJ567045 (Mycobacterium phage Emerson, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

54. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MK460247 (Mycobacterium phage YoureAdopted, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

55. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to JN185608 (Mycobacterium virus JAWS, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcgcgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

56. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MN234231 (Mycobacterium phage Rapunzel97, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

57. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MN908692 (Mycobacterium Phage BGlluviae, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

58. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to NC_023747 (Mycobacterium phage BarrelRoll, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

59. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MH536821 (Mycobacterium phage Homura, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

60. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MH697578 (Mycobacterium phage Belladonna, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

61. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MH077577 (Mycobacterium phage AlishaPH, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

62. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MH509444 (Mycobacterium phage BEEST, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

63. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MN369742 (Mycobacterium phage Spock, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

64. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MK112537 (Mycobacterium Phage Capricorn, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

65. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MN369746 (Mycobacterium phage Inky, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

66. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MH051246 (Mycobacterium phage ActinUp, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

67. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MH513977 (Mycobacterium phage Mynx, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

68. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MN234197 (Mycobacterium phage Ramen, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcgcgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

69. spacer 6.1|3499797|29|NZ_CP018020|CRISPRCasFinder matches to MH371113 (Mycobacterium phage Beezoo, complete genome) position: , mismatch: 7, identity: 0.759 

ccaggcccgatcgcctgcgctccagctac	CRISPR spacer
ctcggcacgatcgcctgcgctccaacgca	Protospacer
*. *** *****************.*

70. spacer 8.7|4606594|27|NZ_CP018020|CRT matches to NZ_CP010737 (Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence) position: , mismatch: 7, identity: 0.741 

gccggggcgtggcccccgccgaagccg	CRISPR spacer
aagaacgcgtggccaccgccgaagccg	Protospacer
.  .. ******** ************

71. spacer 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
ccggccgcggcgcccgttcggtgagcgagc	Protospacer
.*. ********** ******** ***.

72. spacer 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
ccttccgcgtcgccggttcggtgtgttcgg	Protospacer
.* .***** ***************.   *

73. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.742 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
cggggacgatgcgggccgcgccggccgcgta	Protospacer
.** ************** *******  . .

74. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.742 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
cggggacgatgcgggccgcgccggccgcgta	Protospacer
.** ************** *******  . .

75. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 8, identity: 0.742 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
tgtcggcgatgcgggccgggccggtgctgac	Protospacer
** **.******************. * ..

76. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
tgtcggcgatgcgggccgggccggtgctgac	Protospacer
** **.******************. * ..

77. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742 

-tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
atcac-acggtgcgggccgggccggccccgca	Protospacer
 * .* ***.****************** . .

78. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 8, identity: 0.742 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
tgtcggcgatgcgggccgggccggtgctgac	Protospacer
** **.******************. * ..

79. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP020333 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM170, complete sequence) position: , mismatch: 8, identity: 0.742 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
tggcgatgatgcgggccggggcggtcgatat	Protospacer
******.************* ***.* . .

80. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
tgtcggcgatgcgggccgggccggtgctgac	Protospacer
** **.******************. * ..

81. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 8, identity: 0.742 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
ccgcgacgatgcgggccgcggcggcggcatg	Protospacer
. **************** * ****   * *

82. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 8, identity: 0.742 

tggcgacgatgcgggccgggccgg----cccgagg	CRISPR spacer
gggcgacgatccgggcccggccggaaaactc----	Protospacer
 ********* ****** ******    *.*

83. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NC_015378 (Burkholderia gladioli BSR3 plasmid bgla_3p, complete sequence) position: , mismatch: 8, identity: 0.742 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
tcgtgacgttgcgagccgggccggccccgca	Protospacer
* *.**** ****.************* . .

84. spacer 5.1|2508197|30|NZ_CP018020|CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

agttcggctgcggtgctggccaattcgcgg	CRISPR spacer
aacagaccggcggtgctgggcaattcgcgg	Protospacer
*..  . * ********** **********

85. spacer 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.7 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
cgggtcaatgcgccggttcggtgtccggcg	Protospacer
. . .*.  *************** *****

86. spacer 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 9, identity: 0.7 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
ccacccgcggcggcagttcggtgtaataat	Protospacer
.*********** *.*********.  .

87. spacer 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.7 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
agcagagcggccccggttcggggtgcggcc	Protospacer
      ***** ********* *******

88. spacer 1.1|1191067|30|NZ_CP018020|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.7 

tcacccgcggcgccggttcggtgtgcggcg	CRISPR spacer
agcagagcggccccggttcggggtgcggcc	Protospacer
      ***** ********* *******

89. spacer 3.1|2305268|34|NZ_CP018020|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.735 

ctcgcgcgccggcgtcacgccagcgtgacgctcg	CRISPR spacer
ctcccgcgccggcgtcacgccggccccgggcagg	Protospacer
*** *****************.** . . **  *

90. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
gatggacgatgcgggccgggccgaccgcaac	Protospacer
 .  *******************.**  *.

91. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.71 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
gatggacgatgcgggccgggccgaccgcaac	Protospacer
 .  *******************.**  *.

92. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
gatggacgatgcgggccgggccgaccgcaac	Protospacer
 .  *******************.**  *.

93. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
gatggacgatgcgggccgggccgaccgcaac	Protospacer
 .  *******************.**  *.

94. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.71 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
gatggacgatgcgggccgggccgaccgcaac	Protospacer
 .  *******************.**  *.

95. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
gatggacgatgcgggccgggccgaccgcaac	Protospacer
 .  *******************.**  *.

96. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
gatggacgatgcgggccgggccgaccgcaac	Protospacer
 .  *******************.**  *.

97. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
gatggacgatgcgggccgggccgaccgcaac	Protospacer
 .  *******************.**  *.

98. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
gatggacgatgcgggccgggccgaccgcaac	Protospacer
 .  *******************.**  *.

99. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
gatggacgatgcgggccgggccgaccgcaac	Protospacer
 .  *******************.**  *.

100. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
gatggacgatgcgggccgggccgaccgcaac	Protospacer
 .  *******************.**  *.

101. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
gatggacgatgcgggccgggccgaccgcaac	Protospacer
 .  *******************.**  *.

102. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
gatggacgatgcgggccgggccgaccgcaac	Protospacer
 .  *******************.**  *.

103. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
tcgcgatgatgcgggccgagccggctgtgtt	Protospacer
* ****.***********.******.  .

104. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 9, identity: 0.71 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
tgtcgacgacgcgggccgggccgaattcggc	Protospacer
** ******.*************. .. .*

105. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.71 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
tggcgacgatgcgggccgaggcgcgggcgga	Protospacer
******************.* **     .*.

106. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.71 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
tggcgacgatgcgggccgaggcgcgggcgga	Protospacer
******************.* **     .*.

107. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 9, identity: 0.71 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
acccggcgatgcgggccgggccgccctcgga	Protospacer
   **.***************** **. .*.

108. spacer 5.1|2508197|30|NZ_CP018020|CRISPRCasFinder matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 9, identity: 0.7 

agttcggctgcggtgctggccaattcgcgg	CRISPR spacer
caggcggctgcggtgctggccagttccttc	Protospacer
 .  ******************.*** .

109. spacer 5.1|2508197|30|NZ_CP018020|CRISPRCasFinder matches to NZ_CP024425 (Paracoccus yeei strain TT13 plasmid pTT13-3, complete sequence) position: , mismatch: 9, identity: 0.7 

agttcggctgcggtgctggccaattcgcgg	CRISPR spacer
ctgtcggttgcggtgctggccaatgcttat	Protospacer
   ****.**************** * ..

110. spacer 5.1|2508197|30|NZ_CP018020|CRISPRCasFinder matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7 

agttcggctgcggtgctggccaattcgcgg	CRISPR spacer
ctgtcggttgcggtgctggccaatgcttat	Protospacer
   ****.**************** * ..

111. spacer 5.1|2508197|30|NZ_CP018020|CRISPRCasFinder matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 9, identity: 0.7 

agttcggctgcggtgctggccaattcgcgg	CRISPR spacer
ctgtcggttgcggtgctggccaatgcttat	Protospacer
   ****.**************** * ..

112. spacer 3.1|2305268|34|NZ_CP018020|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706 

ctcgcgcgccggcgtcacgccagcgtgacgctcg	CRISPR spacer
gtcgcgcgccggcggcacgcccgcgctgttcacc	Protospacer
 ************* ****** ***. .. * *

113. spacer 3.1|2305268|34|NZ_CP018020|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 10, identity: 0.706 

ctcgcgcgccggcgtcacgccagcgtgacgctcg	CRISPR spacer
gtcgcgcgccggcggcacgcccgcgctgttcacc	Protospacer
 ************* ****** ***. .. * *

114. spacer 3.1|2305268|34|NZ_CP018020|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706 

ctcgcgcgccggcgtcacgccagcgtgacgctcg	CRISPR spacer
gtcgcgcgccggcggcacgcccgcgctgttcacc	Protospacer
 ************* ****** ***. .. * *

115. spacer 3.1|2305268|34|NZ_CP018020|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706 

ctcgcgcgccggcgtcacgccagcgtgacgctcg	CRISPR spacer
gtcgcgcgccggcggcacgcccgcgctgttcacc	Protospacer
 ************* ****** ***. .. * *

116. spacer 3.1|2305268|34|NZ_CP018020|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706 

ctcgcgcgccggcgtcacgccagcgtgacgctcg	CRISPR spacer
gtcgcgcgccggcggcacgcccgcgctgttcacc	Protospacer
 ************* ****** ***. .. * *

117. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.677 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
cctcgacgatgcggtccgcgccggccgcccc	Protospacer
.  *********** *** *******

118. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.677 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
cctcgacgatgcggtccgcgccggccgcccc	Protospacer
.  *********** *** *******

119. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 10, identity: 0.677 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
gggcgacgaggcgggccgggccgcgtttcta	Protospacer
 ******** *************  ..   .

120. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NC_011984 (Agrobacterium vitis S4 plasmid pAtS4c, complete sequence) position: , mismatch: 10, identity: 0.677 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
ccgcggcgatgcgggccggaccggcgatgca	Protospacer
. ***.*************.*****   . .

121. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NC_011982 (Agrobacterium vitis S4 plasmid pTiS4, complete sequence) position: , mismatch: 10, identity: 0.677 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
ccgcggcgatgcgggccggaccggcgatgca	Protospacer
. ***.*************.*****   . .

122. spacer 4.1|2317813|31|NZ_CP018020|CRISPRCasFinder matches to NZ_KY000031 (Agrobacterium genomosp. 1 strain Tun198 plasmid pTi_Tun198, complete sequence) position: , mismatch: 10, identity: 0.677 

tggcgacgatgcgggccgggccggcccgagg	CRISPR spacer
ccgcggcgatgcgggccggaccggcgatgca	Protospacer
. ***.*************.*****   . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3665022 : 3671595 7 Bacillus_phage(33.33%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage