Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023963 Klebsiella aerogenes strain FDAARGOS_363 chromosome, complete genome 4 crisprs DEDDh,RT,WYL,DinG,cas3,csa3 1 2 3 0

Results visualization

1. NZ_CP023963
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023963_1 886389-886506 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023963_2 1825428-1825558 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023963_3 3924205-3924294 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023963_4 4469647-4469761 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP023963_1 1.1|886421|54|NZ_CP023963|CRISPRCasFinder 886421-886474 54 NZ_CP023963.1 4821139-4821192 0 1.0
NZ_CP023963_1 1.1|886421|54|NZ_CP023963|CRISPRCasFinder 886421-886474 54 NZ_CP023963.1 4821053-4821106 1 0.981
NZ_CP023963_1 1.1|886421|54|NZ_CP023963|CRISPRCasFinder 886421-886474 54 NZ_CP023963.1 4821225-4821278 1 0.981

1. spacer 1.1|886421|54|NZ_CP023963|CRISPRCasFinder matches to position: 4821139-4821192, mismatch: 0, identity: 1.0

cgaacctctccccggtggcgctgcgcttaccggggctacaaaccggagcggacc	CRISPR spacer
cgaacctctccccggtggcgctgcgcttaccggggctacaaaccggagcggacc	Protospacer
******************************************************

2. spacer 1.1|886421|54|NZ_CP023963|CRISPRCasFinder matches to position: 4821053-4821106, mismatch: 1, identity: 0.981

cgaacctctccccggtggcgctgcgcttaccggggctacaaaccggagcggacc	CRISPR spacer
cgaacctctccccggtggcgctacgcttaccggggctacaaaccggagcggacc	Protospacer
**********************.*******************************

3. spacer 1.1|886421|54|NZ_CP023963|CRISPRCasFinder matches to position: 4821225-4821278, mismatch: 1, identity: 0.981

cgaacctctccccggtggcgctgcgcttaccggggctacaaaccggagcggacc	CRISPR spacer
cgaacctctccccggtggcgctacgcttaccggggctacaaaccggagcggacc	Protospacer
**********************.*******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023963_2 2.1|1825451|28|NZ_CP023963|CRISPRCasFinder 1825451-1825478 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 238670-238697 1 0.964
NZ_CP023963_2 2.2|1825502|34|NZ_CP023963|CRISPRCasFinder 1825502-1825535 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 238613-238646 2 0.941
NZ_CP023963_2 2.1|1825451|28|NZ_CP023963|CRISPRCasFinder 1825451-1825478 28 NZ_KM406416 Bifidobacterium breve strain JCM 7017 plasmid megaplasmid pMP7017, complete sequence 3293-3320 6 0.786
NZ_CP023963_2 2.1|1825451|28|NZ_CP023963|CRISPRCasFinder 1825451-1825478 28 NZ_MF788070 Raoultella ornithinolytica strain 23141 plasmid p23141-2, complete sequence 59889-59916 6 0.786
NZ_CP023963_2 2.1|1825451|28|NZ_CP023963|CRISPRCasFinder 1825451-1825478 28 NZ_CP014802 Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence 169438-169465 7 0.75
NZ_CP023963_2 2.2|1825502|34|NZ_CP023963|CRISPRCasFinder 1825502-1825535 34 NZ_CP010865 Marinovum algicola DG 898 plasmid pMaD10, complete sequence 31936-31969 8 0.765

1. spacer 2.1|1825451|28|NZ_CP023963|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 1, identity: 0.964

attatcaacaaccggcagctgcgccaca	CRISPR spacer
attatcaacaaccggcagccgcgccaca	Protospacer
*******************.********

2. spacer 2.2|1825502|34|NZ_CP023963|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 2, identity: 0.941

cgcccgtacaccatcagccggtagcgccgcagcc	CRISPR spacer
cgcccgtacaccatcagccggtagctccgcaacc	Protospacer
************************* *****.**

3. spacer 2.1|1825451|28|NZ_CP023963|CRISPRCasFinder matches to NZ_KM406416 (Bifidobacterium breve strain JCM 7017 plasmid megaplasmid pMP7017, complete sequence) position: , mismatch: 6, identity: 0.786

attatcaacaaccggcagctgcgccaca	CRISPR spacer
agcatcaacaaccgccagctacgccaat	Protospacer
* .*********** *****.*****  

4. spacer 2.1|1825451|28|NZ_CP023963|CRISPRCasFinder matches to NZ_MF788070 (Raoultella ornithinolytica strain 23141 plasmid p23141-2, complete sequence) position: , mismatch: 6, identity: 0.786

attatcaacaaccggcagctgcgccaca	CRISPR spacer
attatcaacaacctgcagcagcggcttg	Protospacer
************* ***** *** * ..

5. spacer 2.1|1825451|28|NZ_CP023963|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 7, identity: 0.75

attatcaacaaccggcagctgcgccaca	CRISPR spacer
gacatcaccgaccggcagctgcgccagc	Protospacer
. .**** *.****************  

6. spacer 2.2|1825502|34|NZ_CP023963|CRISPRCasFinder matches to NZ_CP010865 (Marinovum algicola DG 898 plasmid pMaD10, complete sequence) position: , mismatch: 8, identity: 0.765

-cgcccgtacaccatcagccggtagcgccgcagcc	CRISPR spacer
tcgagca-gcaccatcagcggatagcgccgcagcg	Protospacer
 **  *. .********** *.************ 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1725295 : 1758454 50 Salmonella_phage(45.0%) terminase,plate,lysis NA
DBSCAN-SWA_2 3523624 : 3576765 72 Cronobacter_phage(24.14%) coat,integrase,tail,head,terminase,holin attL 3538444:3538458|attR 3574400:3574414
DBSCAN-SWA_3 3945014 : 4021789 86 Salmonella_phage(36.54%) tRNA,protease,integrase,tail,transposase,terminase,holin attL 3977422:3977438|attR 4018603:4018619
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage