Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023816 Escherichia coli strain IMT16316 plasmid pEcIMT16316, complete sequence 0 crisprs RT 0 0 2 0
NZ_CP023815 Escherichia coli strain IMT16316 chromosome, complete genome 6 crisprs DEDDh,cas3,WYL,RT,csa3,PD-DExK,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DinG 2 26 5 0

Results visualization

1. NZ_CP023816
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 20085 : 85767 60 Macacine_betaherpesvirus(26.09%) protease,integrase,transposase attL 29700:29716|attR 54880:54896
DBSCAN-SWA_2 92540 : 99030 7 Escherichia_phage(50.0%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP023815
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023815_1 79941-80088 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023815_2 1232504-1232653 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023815_3 2992302-2993736 Unclear I-E
23 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023815_4 3019283-3020105 TypeI-E I-E
13 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023815_5 4173947-4174070 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023815_6 4869241-4869332 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP023815_3 3.17|2993308|33|NZ_CP023815|PILER-CR 2993308-2993340 33 NZ_CP023815.1 2972470-2972502 1 0.97
NZ_CP023815_3 3.40|2993309|32|NZ_CP023815|CRISPRCasFinder,CRT 2993309-2993340 32 NZ_CP023815.1 2972470-2972501 1 0.969

1. spacer 3.17|2993308|33|NZ_CP023815|PILER-CR matches to position: 2972470-2972502, mismatch: 1, identity: 0.97 

attccggctacttttgttgctccctgctcatcc	CRISPR spacer
attccagctacttttgttgctccctgctcatcc	Protospacer
*****.***************************

2. spacer 3.40|2993309|32|NZ_CP023815|CRISPRCasFinder,CRT matches to position: 2972470-2972501, mismatch: 1, identity: 0.969 

ttccggctacttttgttgctccctgctcatcc	CRISPR spacer
ttccagctacttttgttgctccctgctcatcc	Protospacer
****.***************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023815_6 6.1|4869267|40|NZ_CP023815|CRISPRCasFinder 4869267-4869306 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP023815_5 5.1|4173990|38|NZ_CP023815|CRISPRCasFinder 4173990-4174027 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP023815_4 4.10|3019861|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019861-3019892 32 MF547662 Clostridioides phage LIBA6276, complete genome 37369-37400 4 0.875
NZ_CP023815_4 4.10|3019861|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019861-3019892 32 MF547663 Clostridioides phage LIBA2945, complete genome 37369-37400 4 0.875
NZ_CP023815_4 4.2|3019373|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019373-3019404 32 MK972713 Salmonella phage SW5, complete genome 27687-27718 5 0.844
NZ_CP023815_4 4.2|3019373|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019373-3019404 32 MK972714 Salmonella phage SW3, complete genome 27909-27940 5 0.844
NZ_CP023815_4 4.2|3019373|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019373-3019404 32 NC_049460 Salmonella phage SI7, complete genome 18129-18160 5 0.844
NZ_CP023815_4 4.10|3019861|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019861-3019892 32 NZ_CP029155 Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence 83504-83535 5 0.844
NZ_CP023815_4 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019434-3019465 32 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1203814-1203845 6 0.812
NZ_CP023815_4 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019434-3019465 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1167510-1167541 6 0.812
NZ_CP023815_3 3.27|2992514|32|NZ_CP023815|CRISPRCasFinder,CRT 2992514-2992545 32 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 373536-373567 7 0.781
NZ_CP023815_4 4.1|3019312|32|NZ_CP023815|CRISPRCasFinder,CRT 3019312-3019343 32 LR597649 Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1 17850-17881 7 0.781
NZ_CP023815_4 4.1|3019312|32|NZ_CP023815|CRISPRCasFinder,CRT 3019312-3019343 32 NC_049393 Escherichia phage ESSI2_ev040 genome assembly, chromosome: 1 17628-17659 7 0.781
NZ_CP023815_4 4.1|3019312|32|NZ_CP023815|CRISPRCasFinder,CRT 3019312-3019343 32 NC_049394 Escherichia phage ESSI2_ev129 genome assembly, chromosome: 1 17890-17921 7 0.781
NZ_CP023815_4 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019434-3019465 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1175642-1175673 7 0.781
NZ_CP023815_3 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT 2992758-2992789 32 NZ_CP053709 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence 405764-405795 8 0.75
NZ_CP023815_3 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT 2992758-2992789 32 NZ_CP053710 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence 354033-354064 8 0.75
NZ_CP023815_3 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT 2992758-2992789 32 NZ_CP053712 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed5, complete sequence 91487-91518 8 0.75
NZ_CP023815_3 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT 2992819-2992850 32 NZ_CP053709 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence 405764-405795 8 0.75
NZ_CP023815_3 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT 2992819-2992850 32 NZ_CP053710 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence 354033-354064 8 0.75
NZ_CP023815_3 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT 2992819-2992850 32 NZ_CP053712 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed5, complete sequence 91487-91518 8 0.75
NZ_CP023815_3 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT 2992880-2992911 32 NZ_CP053709 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence 405764-405795 8 0.75
NZ_CP023815_3 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT 2992880-2992911 32 NZ_CP053710 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence 354033-354064 8 0.75
NZ_CP023815_3 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT 2992880-2992911 32 NZ_CP053712 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed5, complete sequence 91487-91518 8 0.75
NZ_CP023815_3 3.34|2992941|32|NZ_CP023815|CRISPRCasFinder,CRT 2992941-2992972 32 NC_013085 Synechococcus phage S-RSM4, complete genome 75536-75567 8 0.75
NZ_CP023815_3 3.34|2992941|32|NZ_CP023815|CRISPRCasFinder,CRT 2992941-2992972 32 FM207411 Synechococcus phage S-RSM4 complete genome 75536-75567 8 0.75
NZ_CP023815_3 3.38|2993186|33|NZ_CP023815|CRISPRCasFinder,CRT 2993186-2993218 33 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 413541-413573 8 0.758
NZ_CP023815_3 3.43|2993492|32|NZ_CP023815|CRISPRCasFinder,CRT 2993492-2993523 32 MN855615 Siphoviridae sp. isolate 320, complete genome 7076-7107 8 0.75
NZ_CP023815_3 3.43|2993492|32|NZ_CP023815|CRISPRCasFinder,CRT 2993492-2993523 32 NC_034248 Rhizobium phage RHEph10, complete genome 31444-31475 8 0.75
NZ_CP023815_4 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019434-3019465 32 NC_031109 Gordonia phage Jumbo, complete genome 25391-25422 8 0.75
NZ_CP023815_4 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019434-3019465 32 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 398774-398805 8 0.75
NZ_CP023815_4 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019434-3019465 32 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 565533-565564 8 0.75
NZ_CP023815_4 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019434-3019465 32 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 63515-63546 8 0.75
NZ_CP023815_4 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019434-3019465 32 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 350647-350678 8 0.75
NZ_CP023815_4 4.4|3019495|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019495-3019526 32 CP022610 Escherichia coli strain ATCC 700415 plasmid unnamed, complete sequence 10541-10572 8 0.75
NZ_CP023815_4 4.5|3019556|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019556-3019587 32 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 57083-57114 8 0.75
NZ_CP023815_4 4.6|3019617|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019617-3019648 32 MN694482 Marine virus AFVG_250M11, complete genome 1728-1759 8 0.75
NZ_CP023815_4 4.8|3019739|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019739-3019770 32 NZ_CP008818 Ochrobactrum anthropi strain OAB plasmid 2, complete sequence 52227-52258 8 0.75
NZ_CP023815_4 4.8|3019739|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019739-3019770 32 NC_009671 Ochrobactrum anthropi ATCC 49188 plasmid pOANT03, complete sequence 23638-23669 8 0.75
NZ_CP023815_1 1.1|79969|32|NZ_CP023815|CRISPRCasFinder 79969-80000 32 NZ_CP045060 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence 9736-9767 9 0.719
NZ_CP023815_1 1.1|79969|32|NZ_CP023815|CRISPRCasFinder 79969-80000 32 NZ_CP045053 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence 9737-9768 9 0.719
NZ_CP023815_1 1.1|79969|32|NZ_CP023815|CRISPRCasFinder 79969-80000 32 NZ_CP045057 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence 9736-9767 9 0.719
NZ_CP023815_1 1.3|79977|32|NZ_CP023815|PILER-CR 79977-80008 32 NZ_CP045060 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence 9736-9767 9 0.719
NZ_CP023815_1 1.3|79977|32|NZ_CP023815|PILER-CR 79977-80008 32 NZ_CP045053 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence 9737-9768 9 0.719
NZ_CP023815_1 1.3|79977|32|NZ_CP023815|PILER-CR 79977-80008 32 NZ_CP045057 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence 9736-9767 9 0.719
NZ_CP023815_3 3.15|2993185|34|NZ_CP023815|PILER-CR 2993185-2993218 34 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 413540-413573 9 0.735
NZ_CP023815_3 3.20|2993491|33|NZ_CP023815|PILER-CR 2993491-2993523 33 MN855615 Siphoviridae sp. isolate 320, complete genome 7075-7107 9 0.727
NZ_CP023815_3 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT 2992758-2992789 32 JX469828 Uncultured bacterium plasmid pRSB223, complete sequence 47585-47616 9 0.719
NZ_CP023815_3 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT 2992758-2992789 32 JX469829 Uncultured bacterium plasmid pB1, complete sequence 23183-23214 9 0.719
NZ_CP023815_3 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT 2992758-2992789 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 393203-393234 9 0.719
NZ_CP023815_3 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT 2992758-2992789 32 NC_008766 Acidovorax sp. JS42 plasmid pAOVO02, complete sequence 3158-3189 9 0.719
NZ_CP023815_3 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT 2992758-2992789 32 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 569059-569090 9 0.719
NZ_CP023815_3 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT 2992758-2992789 32 NZ_MN366361 Bacterium plasmid pALTS33, complete sequence 54575-54606 9 0.719
NZ_CP023815_3 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT 2992819-2992850 32 JX469828 Uncultured bacterium plasmid pRSB223, complete sequence 47585-47616 9 0.719
NZ_CP023815_3 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT 2992819-2992850 32 JX469829 Uncultured bacterium plasmid pB1, complete sequence 23183-23214 9 0.719
NZ_CP023815_3 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT 2992819-2992850 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 393203-393234 9 0.719
NZ_CP023815_3 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT 2992819-2992850 32 NC_008766 Acidovorax sp. JS42 plasmid pAOVO02, complete sequence 3158-3189 9 0.719
NZ_CP023815_3 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT 2992819-2992850 32 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 569059-569090 9 0.719
NZ_CP023815_3 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT 2992819-2992850 32 NZ_MN366361 Bacterium plasmid pALTS33, complete sequence 54575-54606 9 0.719
NZ_CP023815_3 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT 2992880-2992911 32 JX469828 Uncultured bacterium plasmid pRSB223, complete sequence 47585-47616 9 0.719
NZ_CP023815_3 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT 2992880-2992911 32 JX469829 Uncultured bacterium plasmid pB1, complete sequence 23183-23214 9 0.719
NZ_CP023815_3 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT 2992880-2992911 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 393203-393234 9 0.719
NZ_CP023815_3 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT 2992880-2992911 32 NC_008766 Acidovorax sp. JS42 plasmid pAOVO02, complete sequence 3158-3189 9 0.719
NZ_CP023815_3 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT 2992880-2992911 32 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 569059-569090 9 0.719
NZ_CP023815_3 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT 2992880-2992911 32 NZ_MN366361 Bacterium plasmid pALTS33, complete sequence 54575-54606 9 0.719
NZ_CP023815_3 3.35|2993002|32|NZ_CP023815|CRISPRCasFinder,CRT 2993002-2993033 32 MW084976 Bacillus phage Kirov, complete genome 56770-56801 9 0.719
NZ_CP023815_3 3.41|2993370|32|NZ_CP023815|CRISPRCasFinder,CRT 2993370-2993401 32 NZ_CP016721 Lactococcus lactis subsp. lactis strain UC11 plasmid pUC11B, complete sequence 30466-30497 9 0.719
NZ_CP023815_3 3.41|2993370|32|NZ_CP023815|CRISPRCasFinder,CRT 2993370-2993401 32 NZ_CP016727 Lactococcus lactis subsp. lactis strain UC08 plasmid pUC08B, complete sequence 30464-30495 9 0.719
NZ_CP023815_3 3.45|2993614|32|NZ_CP023815|CRISPRCasFinder,CRT 2993614-2993645 32 MK448690 Streptococcus phage Javan169, complete genome 9831-9862 9 0.719
NZ_CP023815_3 3.45|2993614|32|NZ_CP023815|CRISPRCasFinder,CRT 2993614-2993645 32 MK448854 Streptococcus phage Javan146, complete genome 11811-11842 9 0.719
NZ_CP023815_4 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019434-3019465 32 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 555186-555217 9 0.719
NZ_CP023815_4 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019434-3019465 32 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 471692-471723 9 0.719
NZ_CP023815_4 4.5|3019556|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019556-3019587 32 NZ_CP053709 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence 137043-137074 9 0.719
NZ_CP023815_4 4.7|3019678|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019678-3019709 32 MT446414 UNVERIFIED: Escherichia virus TH43, complete genome 38100-38131 9 0.719
NZ_CP023815_4 4.9|3019800|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019800-3019831 32 MN812211 Flavobacterium phage vB_FspS_laban6-1, complete genome 21752-21783 9 0.719
NZ_CP023815_4 4.9|3019800|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019800-3019831 32 NZ_CP012534 Psychrobacter sp. P11G5 plasmid pPspP11G5a, complete sequence 26937-26968 9 0.719
NZ_CP023815_4 4.10|3019861|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019861-3019892 32 MN693584 Marine virus AFVG_25M163, complete genome 29591-29622 9 0.719
NZ_CP023815_4 4.10|3019861|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019861-3019892 32 MN103543 Pseudomonas phage vB_PaeM_PS119XW, complete genome 258501-258532 9 0.719
NZ_CP023815_4 4.10|3019861|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019861-3019892 32 MK599315 Pseudomonas phage PA1C, complete genome 257887-257918 9 0.719
NZ_CP023815_3 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT 2992758-2992789 32 NC_004929 Ruegeria sp. PR1b plasmid pSD20, complete sequence 67373-67404 10 0.688
NZ_CP023815_3 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT 2992819-2992850 32 NC_004929 Ruegeria sp. PR1b plasmid pSD20, complete sequence 67373-67404 10 0.688
NZ_CP023815_3 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT 2992880-2992911 32 NC_004929 Ruegeria sp. PR1b plasmid pSD20, complete sequence 67373-67404 10 0.688
NZ_CP023815_4 4.9|3019800|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019800-3019831 32 NZ_KX711616 Bacillus subtilis strain 72 plasmid pBS72, complete sequence 1474-1505 10 0.688
NZ_CP023815_4 4.9|3019800|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR 3019800-3019831 32 NC_023026 Francisella novicida strain PA10-7858 plasmid pFNPA10, complete sequence 2981-3012 11 0.656

1. spacer 6.1|4869267|40|NZ_CP023815|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 5.1|4173990|38|NZ_CP023815|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 4.10|3019861|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to MF547662 (Clostridioides phage LIBA6276, complete genome) position: , mismatch: 4, identity: 0.875 

tacagtttccataaattcacctcgtttatata-	CRISPR spacer
tactgtttccataaattcacctc-cttataaaa	Protospacer
*** ******************* .***** *

4. spacer 4.10|3019861|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to MF547663 (Clostridioides phage LIBA2945, complete genome) position: , mismatch: 4, identity: 0.875 

tacagtttccataaattcacctcgtttatata-	CRISPR spacer
tactgtttccataaattcacctc-cttataaaa	Protospacer
*** ******************* .***** *

5. spacer 4.2|3019373|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to MK972713 (Salmonella phage SW5, complete genome) position: , mismatch: 5, identity: 0.844 

gaccagtcgggccagacatcggggacgcagaa	CRISPR spacer
gaccagtcgggccagacatcgagcacggccaa	Protospacer
*********************.* ***   **

6. spacer 4.2|3019373|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to MK972714 (Salmonella phage SW3, complete genome) position: , mismatch: 5, identity: 0.844 

gaccagtcgggccagacatcggggacgcagaa	CRISPR spacer
gaccagtcgggccagacatcgagcacggccaa	Protospacer
*********************.* ***   **

7. spacer 4.2|3019373|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to NC_049460 (Salmonella phage SI7, complete genome) position: , mismatch: 5, identity: 0.844 

gaccagtcgggccagacatcggggacgcagaa	CRISPR spacer
gaccagtcgggccagacatcgagcacggccaa	Protospacer
*********************.* ***   **

8. spacer 4.10|3019861|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029155 (Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844 

tacagtttccataaattcacctcgtttatata-	CRISPR spacer
tactgtttccataaattcacctc-cctataaaa	Protospacer
*** ******************* ..**** *

9. spacer 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.812 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
cacgcggccatcgcgcagttcgtcgaacgccg	Protospacer
*  .* *********** ***********.**

10. spacer 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 6, identity: 0.812 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
gcgttcgccatcgcgcatttcgtccatcgttg	Protospacer
 ** .******************* * ***.*

11. spacer 3.27|2992514|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 7, identity: 0.781 

aatggcgctgccgatcgacaaatgggacctgg-	CRISPR spacer
gatggcgatgccgatggacaaat-gcacatgct	Protospacer
.****** ******* ******* * ** **

12. spacer 4.1|3019312|32|NZ_CP023815|CRISPRCasFinder,CRT matches to LR597649 (Escherichia phage ESSI2_ev015 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.781 

caaacgtcaggcggaagtgttccggtcatata	CRISPR spacer
aaaggctcaggctgaagtgttccggtcttaca	Protospacer
 **.  ****** ************** **.*

13. spacer 4.1|3019312|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NC_049393 (Escherichia phage ESSI2_ev040 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.781 

caaacgtcaggcggaagtgttccggtcatata	CRISPR spacer
aaaggctcaggctgaagtgttccggtcttaca	Protospacer
 **.  ****** ************** **.*

14. spacer 4.1|3019312|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NC_049394 (Escherichia phage ESSI2_ev129 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.781 

caaacgtcaggcggaagtgttccggtcatata	CRISPR spacer
aaaggctcaggctgaagtgttccggtcttaca	Protospacer
 **.  ****** ************** **.*

15. spacer 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.781 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
gcgttcgccatcgcgcatttcgtccatcgctg	Protospacer
 ** .******************* * **..*

16. spacer 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_CP053709 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ccccgccagcgccccgcgcgcctgcttcgtcc	Protospacer
*** ********** ******** .** ..*.

17. spacer 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_CP053710 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ccccgccagcgccccgcgcgcctgcttcgtcc	Protospacer
*** ********** ******** .** ..*.

18. spacer 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_CP053712 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ccccgccagcgccccgcgcgcctgcttcgtcc	Protospacer
*** ********** ******** .** ..*.

19. spacer 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_CP053709 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ccccgccagcgccccgcgcgcctgcttcgtcc	Protospacer
*** ********** ******** .** ..*.

20. spacer 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_CP053710 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ccccgccagcgccccgcgcgcctgcttcgtcc	Protospacer
*** ********** ******** .** ..*.

21. spacer 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_CP053712 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ccccgccagcgccccgcgcgcctgcttcgtcc	Protospacer
*** ********** ******** .** ..*.

22. spacer 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_CP053709 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ccccgccagcgccccgcgcgcctgcttcgtcc	Protospacer
*** ********** ******** .** ..*.

23. spacer 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_CP053710 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ccccgccagcgccccgcgcgcctgcttcgtcc	Protospacer
*** ********** ******** .** ..*.

24. spacer 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_CP053712 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ccccgccagcgccccgcgcgcctgcttcgtcc	Protospacer
*** ********** ******** .** ..*.

25. spacer 3.34|2992941|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NC_013085 (Synechococcus phage S-RSM4, complete genome) position: , mismatch: 8, identity: 0.75 

-----tccttaattacaacgacaccactggaaaaatt	CRISPR spacer
gtagctcc-----tacaacgacagcattggaaaaatc	Protospacer
     ***     ********** **.*********.

26. spacer 3.34|2992941|32|NZ_CP023815|CRISPRCasFinder,CRT matches to FM207411 (Synechococcus phage S-RSM4 complete genome) position: , mismatch: 8, identity: 0.75 

-----tccttaattacaacgacaccactggaaaaatt	CRISPR spacer
gtagctcc-----tacaacgacagcattggaaaaatc	Protospacer
     ***     ********** **.*********.

27. spacer 3.38|2993186|33|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 8, identity: 0.758 

cgggagccagtgctaacgatatcgcggccgcgc	CRISPR spacer
ggcgcggcagcgcgaacgatatcgcggccgccg	Protospacer
 * * * ***.** *****************

28. spacer 3.43|2993492|32|NZ_CP023815|CRISPRCasFinder,CRT matches to MN855615 (Siphoviridae sp. isolate 320, complete genome) position: , mismatch: 8, identity: 0.75 

gccgcgtacatcaacgcagcagcaagcgcata	CRISPR spacer
ccactgcccatcaaagcaccagcaagcgcata	Protospacer
 *  .*. ****** *** *************

29. spacer 3.43|2993492|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NC_034248 (Rhizobium phage RHEph10, complete genome) position: , mismatch: 8, identity: 0.75 

gccgcgtacatcaacgcagcagcaagcgcata	CRISPR spacer
accgcggccatcaacgcagcagcataaggaga	Protospacer
.*****  **************** . * * *

30. spacer 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to NC_031109 (Gordonia phage Jumbo, complete genome) position: , mismatch: 8, identity: 0.75 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
gacaataccatcgcggattttgtcgaacgtcg	Protospacer
   * ..******** ****.***********

31. spacer 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
tctgacggcatcgcgcatttcggcgaacgcct	Protospacer
.* . ** ************** ******.*

32. spacer 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
tctgacggcatcgcgcatttcggcgaacgcct	Protospacer
.* . ** ************** ******.*

33. spacer 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 8, identity: 0.75 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
cacgacgccgtcgcgcatttcgtcgaccgcct	Protospacer
*  . ****.**************** **.*

34. spacer 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.75 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
gccgccgccatcgcgcaattcggcgaatatgg	Protospacer
 * .************* **** ****..* *

35. spacer 4.4|3019495|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to CP022610 (Escherichia coli strain ATCC 700415 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

caaaaaaataatatccggcagtctgtacggta	CRISPR spacer
aagaaaaatcatatccggcagtctttagcgag	Protospacer
 *.****** ************** **  * .

36. spacer 4.5|3019556|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75 

-caacattttccaatatcacccagcaatcaatt	CRISPR spacer
gtaac-ttttctaatatcacccagcactccggg	Protospacer
 .*** *****.************** ** .

37. spacer 4.6|3019617|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to MN694482 (Marine virus AFVG_250M11, complete genome) position: , mismatch: 8, identity: 0.75 

tcatgaaggcttcgattatttcttgatacctg	CRISPR spacer
tcattaaggcttcgattttttctagtttagtt	Protospacer
**** ************ ***** * *   *

38. spacer 4.8|3019739|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP008818 (Ochrobactrum anthropi strain OAB plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75 

-caataacaccggcatttgtccacgacaatatt	CRISPR spacer
tcggcgacg-cggcatttgtccacgacacaatt	Protospacer
 *....**. ******************  ***

39. spacer 4.8|3019739|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to NC_009671 (Ochrobactrum anthropi ATCC 49188 plasmid pOANT03, complete sequence) position: , mismatch: 8, identity: 0.75 

-caataacaccggcatttgtccacgacaatatt	CRISPR spacer
tcggcgacg-cggcatttgtccacgacacaatt	Protospacer
 *....**. ******************  ***

40. spacer 1.1|79969|32|NZ_CP023815|CRISPRCasFinder matches to NZ_CP045060 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence) position: , mismatch: 9, identity: 0.719 

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

41. spacer 1.1|79969|32|NZ_CP023815|CRISPRCasFinder matches to NZ_CP045053 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence) position: , mismatch: 9, identity: 0.719 

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

42. spacer 1.1|79969|32|NZ_CP023815|CRISPRCasFinder matches to NZ_CP045057 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence) position: , mismatch: 9, identity: 0.719 

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

43. spacer 1.3|79977|32|NZ_CP023815|PILER-CR matches to NZ_CP045060 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence) position: , mismatch: 9, identity: 0.719 

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

44. spacer 1.3|79977|32|NZ_CP023815|PILER-CR matches to NZ_CP045053 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence) position: , mismatch: 9, identity: 0.719 

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

45. spacer 1.3|79977|32|NZ_CP023815|PILER-CR matches to NZ_CP045057 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence) position: , mismatch: 9, identity: 0.719 

atggtgggcgggtggagtatgttaccagtgaa	CRISPR spacer
acaccgggcgggtggaacatgttaccaggaca	Protospacer
*.. .***********..********** . *

46. spacer 3.15|2993185|34|NZ_CP023815|PILER-CR matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 9, identity: 0.735 

gcgggagccagtgctaacgatatcgcggccgcgc	CRISPR spacer
cggcgcggcagcgcgaacgatatcgcggccgccg	Protospacer
  * * * ***.** *****************

47. spacer 3.20|2993491|33|NZ_CP023815|PILER-CR matches to MN855615 (Siphoviridae sp. isolate 320, complete genome) position: , mismatch: 9, identity: 0.727 

ggccgcgtacatcaacgcagcagcaagcgcata	CRISPR spacer
accactgcccatcaaagcaccagcaagcgcata	Protospacer
. *  .*. ****** *** *************

48. spacer 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 9, identity: 0.719 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg	Protospacer
  *  ********. *************.*

49. spacer 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 9, identity: 0.719 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg	Protospacer
  *  ********. *************.*

50. spacer 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
gccgggcagcgcccggcgcgcctcagccatca	Protospacer
 **.* ******************  . *.*

51. spacer 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 9, identity: 0.719 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg	Protospacer
  *  ********. *************.*

52. spacer 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 9, identity: 0.719 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
cggagcccgcgcccggcgcgccgcttcacatg	Protospacer
*  **** ************** ***.*  .

53. spacer 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_MN366361 (Bacterium plasmid pALTS33, complete sequence) position: , mismatch: 9, identity: 0.719 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg	Protospacer
  *  ********. *************.*

54. spacer 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 9, identity: 0.719 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg	Protospacer
  *  ********. *************.*

55. spacer 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 9, identity: 0.719 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg	Protospacer
  *  ********. *************.*

56. spacer 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
gccgggcagcgcccggcgcgcctcagccatca	Protospacer
 **.* ******************  . *.*

57. spacer 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 9, identity: 0.719 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg	Protospacer
  *  ********. *************.*

58. spacer 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 9, identity: 0.719 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
cggagcccgcgcccggcgcgccgcttcacatg	Protospacer
*  **** ************** ***.*  .

59. spacer 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_MN366361 (Bacterium plasmid pALTS33, complete sequence) position: , mismatch: 9, identity: 0.719 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg	Protospacer
  *  ********. *************.*

60. spacer 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 9, identity: 0.719 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg	Protospacer
  *  ********. *************.*

61. spacer 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 9, identity: 0.719 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg	Protospacer
  *  ********. *************.*

62. spacer 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
gccgggcagcgcccggcgcgcctcagccatca	Protospacer
 **.* ******************  . *.*

63. spacer 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 9, identity: 0.719 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg	Protospacer
  *  ********. *************.*

64. spacer 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 9, identity: 0.719 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
cggagcccgcgcccggcgcgccgcttcacatg	Protospacer
*  **** ************** ***.*  .

65. spacer 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_MN366361 (Bacterium plasmid pALTS33, complete sequence) position: , mismatch: 9, identity: 0.719 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ggcctccagcgccttgcgcgcctctttagcgg	Protospacer
  *  ********. *************.*

66. spacer 3.35|2993002|32|NZ_CP023815|CRISPRCasFinder,CRT matches to MW084976 (Bacillus phage Kirov, complete genome) position: , mismatch: 9, identity: 0.719 

ttcgccaggtgttttcttttcccggtcagtca	CRISPR spacer
aattccaagtgttttcttttcccagtctataa	Protospacer
  . ***.***************.*** .* *

67. spacer 3.41|2993370|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_CP016721 (Lactococcus lactis subsp. lactis strain UC11 plasmid pUC11B, complete sequence) position: , mismatch: 9, identity: 0.719 

aatatttacttggatgcgtcggacattgaatc	CRISPR spacer
tttcatgacttgaatgcgtaggacattgaaag	Protospacer
  *  * *****.****** **********

68. spacer 3.41|2993370|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NZ_CP016727 (Lactococcus lactis subsp. lactis strain UC08 plasmid pUC08B, complete sequence) position: , mismatch: 9, identity: 0.719 

aatatttacttggatgcgtcggacattgaatc	CRISPR spacer
tttcatgacttgaatgcgtaggacattgaaag	Protospacer
  *  * *****.****** **********

69. spacer 3.45|2993614|32|NZ_CP023815|CRISPRCasFinder,CRT matches to MK448690 (Streptococcus phage Javan169, complete genome) position: , mismatch: 9, identity: 0.719 

tcaacgaaaacgcagagcgaggaacggatatt	CRISPR spacer
aagagcaaaacggagagcgagaaacggatttc	Protospacer
  .*  ****** ********.******* *.

70. spacer 3.45|2993614|32|NZ_CP023815|CRISPRCasFinder,CRT matches to MK448854 (Streptococcus phage Javan146, complete genome) position: , mismatch: 9, identity: 0.719 

tcaacgaaaacgcagagcgaggaacggatatt	CRISPR spacer
aagagcaaaacggagagcgagaaacggatttc	Protospacer
  .*  ****** ********.******* *.

71. spacer 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
tcgaccggcatcgcgcagttcgtcgctgagag	Protospacer
.****** ********* *******   .  *

72. spacer 4.3|3019434|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgaccgccatcgcgcatttcgtcgaacgtcg	CRISPR spacer
gagaccggcatcgcgcatttcctcgagcacat	Protospacer
  ***** ************* ****.*..

73. spacer 4.5|3019556|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053709 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

caacattttccaatatcacccagcaatcaatt	CRISPR spacer
gattgccttccaatatcagccagctatcaaat	Protospacer
 * ....*********** ***** ***** *

74. spacer 4.7|3019678|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to MT446414 (UNVERIFIED: Escherichia virus TH43, complete genome) position: , mismatch: 9, identity: 0.719 

atttcattaattttgcagagaagtgtctcgaa	CRISPR spacer
atttcatcaactttgcagagaaggaaatttat	Protospacer
*******.**.************ .  *. *

75. spacer 4.9|3019800|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to MN812211 (Flavobacterium phage vB_FspS_laban6-1, complete genome) position: , mismatch: 9, identity: 0.719 

gcgtaagaaaacaattttttcagaaaactaac	CRISPR spacer
aaataagaaaacaattttttcttaaaaaagat	Protospacer
. .******************  ****  .*.

76. spacer 4.9|3019800|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012534 (Psychrobacter sp. P11G5 plasmid pPspP11G5a, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgtaagaaaacaattttttcag---aaaactaac	CRISPR spacer
gcgtaagaaaacagtttttccagttccagatg---	Protospacer
*************.*****.***    *.*.

77. spacer 4.10|3019861|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to MN693584 (Marine virus AFVG_25M163, complete genome) position: , mismatch: 9, identity: 0.719 

tacagtttccataaattcacctcgtttatata	CRISPR spacer
ggggatatctataaactcacctcgtttatatt	Protospacer
 . ..* **.*****.***************

78. spacer 4.10|3019861|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to MN103543 (Pseudomonas phage vB_PaeM_PS119XW, complete genome) position: , mismatch: 9, identity: 0.719 

tacagtttccataaattcacctcgtttatata	CRISPR spacer
cgcttcttccatacattcacctcggttatgga	Protospacer
..*  .******* ********** ****. *

79. spacer 4.10|3019861|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 9, identity: 0.719 

tacagtttccataaattcacctcgtttatata	CRISPR spacer
cgcttcttccatacattcacctcggttatgga	Protospacer
..*  .******* ********** ****. *

80. spacer 3.31|2992758|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NC_004929 (Ruegeria sp. PR1b plasmid pSD20, complete sequence) position: , mismatch: 10, identity: 0.688 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ccccgcctgcgcccggcgcgcctgccagaggg	Protospacer
*** *** *************** .. .*

81. spacer 3.32|2992819|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NC_004929 (Ruegeria sp. PR1b plasmid pSD20, complete sequence) position: , mismatch: 10, identity: 0.688 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ccccgcctgcgcccggcgcgcctgccagaggg	Protospacer
*** *** *************** .. .*

82. spacer 3.33|2992880|32|NZ_CP023815|CRISPRCasFinder,CRT matches to NC_004929 (Ruegeria sp. PR1b plasmid pSD20, complete sequence) position: , mismatch: 10, identity: 0.688 

cccagccagcgcccggcgcgcctctttaacct	CRISPR spacer
ccccgcctgcgcccggcgcgcctgccagaggg	Protospacer
*** *** *************** .. .*

83. spacer 4.9|3019800|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX711616 (Bacillus subtilis strain 72 plasmid pBS72, complete sequence) position: , mismatch: 10, identity: 0.688 

gcgtaagaaaacaattttttcagaaaactaac	CRISPR spacer
gacaaagaaaacaatcttttaagaaaagcttt	Protospacer
*   ***********.**** ****** .  .

84. spacer 4.9|3019800|32|NZ_CP023815|CRISPRCasFinder,CRT,PILER-CR matches to NC_023026 (Francisella novicida strain PA10-7858 plasmid pFNPA10, complete sequence) position: , mismatch: 11, identity: 0.656 

gcgtaagaaaacaattttttcagaaaactaac	CRISPR spacer
acgaaagaaaacaactttttcagagtggcgtt	Protospacer
.** **********.*********. . .. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 64979 : 153435 86 Salmonella_phage(61.82%) tRNA,protease,portal,tail,terminase,capsid,head,lysis,plate,integrase attL 119131:119157|attR 153510:153536
DBSCAN-SWA_2 1455719 : 1501914 46 Burkholderia_phage(31.58%) tRNA,tail,plate NA
DBSCAN-SWA_3 3253874 : 3288329 35 Escherichia_phage(51.52%) terminase,tail,integrase attL 3236776:3236791|attR 3275256:3275271
DBSCAN-SWA_4 3689514 : 3698956 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_5 4255689 : 4323564 81 Enterobacteria_phage(43.4%) protease,portal,tail,lysis,integrase attL 4250979:4250995|attR 4281720:4281736

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage