Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023753 Listeria monocytogenes strain AT3E plasmid pLM58, complete sequence 0 crisprs csa3 0 0 1 0
NZ_CP023752 Listeria monocytogenes strain AT3E chromosome, complete genome 4 crisprs DinG,cas3,WYL,casR,DEDDh,csa3 0 1 8 0

Results visualization

1. NZ_CP023753
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 40551 : 49634 9 Streptococcus_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP023752
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023752_1 209979-210130 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023752_2 497257-497841 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023752_3 542806-543094 Orphan I-A
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023752_4 2893083-2893193 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023752_3 3.3|542965|35|NZ_CP023752|PILER-CR,CRISPRCasFinder,CRT 542965-542999 35 MH341453 Listeria phage PSU-VKH-LP041, complete genome 10139-10173 1 0.971
NZ_CP023752_3 3.3|542965|35|NZ_CP023752|PILER-CR,CRISPRCasFinder,CRT 542965-542999 35 NC_009813 Listeria phage B054, complete genome 10139-10173 2 0.943

1. spacer 3.3|542965|35|NZ_CP023752|PILER-CR,CRISPRCasFinder,CRT matches to MH341453 (Listeria phage PSU-VKH-LP041, complete genome) position: , mismatch: 1, identity: 0.971

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacagcgatgggttacaa	Protospacer
*****************.*****************

2. spacer 3.3|542965|35|NZ_CP023752|PILER-CR,CRISPRCasFinder,CRT matches to NC_009813 (Listeria phage B054, complete genome) position: , mismatch: 2, identity: 0.943

gcgatttttgtcaaagggacagcgatgggttacaa	CRISPR spacer
gcgatttttgtcaaaggaacggcgatgggttacaa	Protospacer
*****************.**.**************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 120335 : 126860 10 Listeria_phage(33.33%) tail NA
DBSCAN-SWA_2 675994 : 731207 65 Listeria_phage(41.18%) protease,tail,head,transposase,terminase,portal,capsid,integrase,holin attL 685182:685199|attR 720209:720226
DBSCAN-SWA_3 1154483 : 1161906 8 Hokovirus(33.33%) NA NA
DBSCAN-SWA_4 1275955 : 1356258 95 Listeria_phage(78.95%) protease,tail,terminase,tRNA,portal,capsid,integrase,holin attL 1275839:1275859|attR 1318556:1318576
DBSCAN-SWA_5 1827724 : 1860590 38 Erysipelothrix_phage(67.74%) protease,tail,head,terminase,portal,capsid,holin NA
DBSCAN-SWA_6 1944773 : 1953059 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_7 2467947 : 2505866 55 Listeria_phage(92.0%) terminase,holin,tail NA
DBSCAN-SWA_8 2649158 : 2657002 7 Streptococcus_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage