Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023667 Alcaligenes faecalis strain DSM 30030 chromosome, complete genome 2 crisprs csa3,DEDDh,cas3,RT 1 0 4 0

Results visualization

1. NZ_CP023667
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023667_1 515918-516031 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023667_2 2399152-2399252 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP023667_1 1.1|515957|36|NZ_CP023667|CRISPRCasFinder 515957-515992 36 NZ_CP023667.1 3522554-3522589 0 1.0

1. spacer 1.1|515957|36|NZ_CP023667|CRISPRCasFinder matches to position: 3522554-3522589, mismatch: 0, identity: 1.0

gtcgccgggccgccccaaggcaaaaactccccctcg	CRISPR spacer
gtcgccgggccgccccaaggcaaaaactccccctcg	Protospacer
************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1533438 : 1540610 11 Pseudomonas_phage(28.57%) NA NA
DBSCAN-SWA_2 1547006 : 1570837 30 Pseudomonas_phage(31.58%) terminase,tail NA
DBSCAN-SWA_3 1937123 : 1945780 10 uncultured_Mediterranean_phage(28.57%) tRNA NA
DBSCAN-SWA_4 2064953 : 2078585 15 Pseudomonas_phage(25.0%) capsid,portal,protease,head,terminase,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage