Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP017263 Lacticaseibacillus paracasei strain FAM18149 plasmid pFAM18149.22, complete sequence 1 crisprs NA 0 2 0 0
NZ_CP017264 Lacticaseibacillus paracasei strain FAM18149 plasmid pFAM18149.23, complete sequence 0 crisprs PrimPol 0 0 1 0
NZ_CP017262 Lacticaseibacillus paracasei strain FAM18149 plasmid pFAM18149.21, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP017266 Lacticaseibacillus paracasei strain FAM18149 plasmid pFAM18149.25, complete sequence 1 crisprs NA 0 1 5 0
NZ_CP017261 Lacticaseibacillus paracasei strain FAM18149 chromosome, complete genome 0 crisprs csa3,cas3,DEDDh,DinG,WYL 0 0 17 0
NZ_CP017265 Lacticaseibacillus paracasei strain FAM18149 plasmid pFAM18149.24, complete sequence 1 crisprs csa3 0 1 0 0

Results visualization

1. NZ_CP017263
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017263_1 24483-24628 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017263_1 1.1|24509|40|NZ_CP017263|CRISPRCasFinder 24509-24548 40 NC_021722 Lactobacillus paracasei strain LOCK919 plasmid pLOCK919, complete sequence 527-566 0 1.0
NZ_CP017263_1 1.1|24509|40|NZ_CP017263|CRISPRCasFinder 24509-24548 40 NZ_CP035564 Lactobacillus paracasei strain SRCM103299 plasmid unnamed1 65110-65149 0 1.0
NZ_CP017263_1 1.1|24509|40|NZ_CP017263|CRISPRCasFinder 24509-24548 40 NZ_CP029537 Lactobacillus paracasei strain LC355 plasmid unnamed1, complete sequence 34561-34600 0 1.0
NZ_CP017263_1 1.1|24509|40|NZ_CP017263|CRISPRCasFinder 24509-24548 40 NZ_CP017263 Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.22, complete sequence 24509-24548 0 1.0
NZ_CP017263_1 1.2|24575|28|NZ_CP017263|CRISPRCasFinder 24575-24602 28 NZ_CP029537 Lactobacillus paracasei strain LC355 plasmid unnamed1, complete sequence 34627-34654 0 1.0
NZ_CP017263_1 1.2|24575|28|NZ_CP017263|CRISPRCasFinder 24575-24602 28 NZ_CP017263 Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.22, complete sequence 24575-24602 0 1.0
NZ_CP017263_1 1.2|24575|28|NZ_CP017263|CRISPRCasFinder 24575-24602 28 NC_021722 Lactobacillus paracasei strain LOCK919 plasmid pLOCK919, complete sequence 473-500 0 1.0
NZ_CP017263_1 1.2|24575|28|NZ_CP017263|CRISPRCasFinder 24575-24602 28 NZ_CP035564 Lactobacillus paracasei strain SRCM103299 plasmid unnamed1 65056-65083 0 1.0

1. spacer 1.1|24509|40|NZ_CP017263|CRISPRCasFinder matches to NC_021722 (Lactobacillus paracasei strain LOCK919 plasmid pLOCK919, complete sequence) position: , mismatch: 0, identity: 1.0

ctattttcaaggggtccggcttcacttgagttcttatgtc	CRISPR spacer
ctattttcaaggggtccggcttcacttgagttcttatgtc	Protospacer
****************************************

2. spacer 1.1|24509|40|NZ_CP017263|CRISPRCasFinder matches to NZ_CP035564 (Lactobacillus paracasei strain SRCM103299 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ctattttcaaggggtccggcttcacttgagttcttatgtc	CRISPR spacer
ctattttcaaggggtccggcttcacttgagttcttatgtc	Protospacer
****************************************

3. spacer 1.1|24509|40|NZ_CP017263|CRISPRCasFinder matches to NZ_CP029537 (Lactobacillus paracasei strain LC355 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctattttcaaggggtccggcttcacttgagttcttatgtc	CRISPR spacer
ctattttcaaggggtccggcttcacttgagttcttatgtc	Protospacer
****************************************

4. spacer 1.1|24509|40|NZ_CP017263|CRISPRCasFinder matches to NZ_CP017263 (Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.22, complete sequence) position: , mismatch: 0, identity: 1.0

ctattttcaaggggtccggcttcacttgagttcttatgtc	CRISPR spacer
ctattttcaaggggtccggcttcacttgagttcttatgtc	Protospacer
****************************************

5. spacer 1.2|24575|28|NZ_CP017263|CRISPRCasFinder matches to NZ_CP029537 (Lactobacillus paracasei strain LC355 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgttttcggtagtttgaacggtctctt	CRISPR spacer
ctgttttcggtagtttgaacggtctctt	Protospacer
****************************

6. spacer 1.2|24575|28|NZ_CP017263|CRISPRCasFinder matches to NZ_CP017263 (Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.22, complete sequence) position: , mismatch: 0, identity: 1.0

ctgttttcggtagtttgaacggtctctt	CRISPR spacer
ctgttttcggtagtttgaacggtctctt	Protospacer
****************************

7. spacer 1.2|24575|28|NZ_CP017263|CRISPRCasFinder matches to NC_021722 (Lactobacillus paracasei strain LOCK919 plasmid pLOCK919, complete sequence) position: , mismatch: 0, identity: 1.0

ctgttttcggtagtttgaacggtctctt	CRISPR spacer
ctgttttcggtagtttgaacggtctctt	Protospacer
****************************

8. spacer 1.2|24575|28|NZ_CP017263|CRISPRCasFinder matches to NZ_CP035564 (Lactobacillus paracasei strain SRCM103299 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ctgttttcggtagtttgaacggtctctt	CRISPR spacer
ctgttttcggtagtttgaacggtctctt	Protospacer
****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP017264
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8997 : 68399 53 Staphylococcus_phage(25.0%) transposase,holin,bacteriocin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP017262
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 9251 : 41531 36 Staphylococcus_phage(25.0%) holin,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP017266
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017266_1 28699-28792 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017266_1 1.1|28722|48|NZ_CP017266|CRISPRCasFinder 28722-28769 48 NZ_CP044366 Lactobacillus paracasei strain TD 062 plasmid unnamed5, complete sequence 6480-6527 0 1.0
NZ_CP017266_1 1.1|28722|48|NZ_CP017266|CRISPRCasFinder 28722-28769 48 NZ_CP017266 Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.25, complete sequence 28722-28769 0 1.0
NZ_CP017266_1 1.1|28722|48|NZ_CP017266|CRISPRCasFinder 28722-28769 48 NZ_CP012189 Lactobacillus paracasei strain CAUH35 plasmid unnamed2, complete sequence 18322-18369 0 1.0
NZ_CP017266_1 1.1|28722|48|NZ_CP017266|CRISPRCasFinder 28722-28769 48 NZ_CP014986 Lactobacillus paracasei strain IIA plasmid unnamed1, complete sequence 9096-9143 1 0.979
NZ_CP017266_1 1.1|28722|48|NZ_CP017266|CRISPRCasFinder 28722-28769 48 NZ_CP031786 Lactobacillus paracasei strain 10266 plasmid pLP10266, complete sequence 17784-17831 1 0.979
NZ_CP017266_1 1.1|28722|48|NZ_CP017266|CRISPRCasFinder 28722-28769 48 NZ_CP039709 Lactobacillus paracasei strain Lp02 plasmid pLp02-2, complete sequence 42802-42849 1 0.979

1. spacer 1.1|28722|48|NZ_CP017266|CRISPRCasFinder matches to NZ_CP044366 (Lactobacillus paracasei strain TD 062 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

acacatttgtacatttacatatatgtaaatgtgtaaaaatatccgcat	CRISPR spacer
acacatttgtacatttacatatatgtaaatgtgtaaaaatatccgcat	Protospacer
************************************************

2. spacer 1.1|28722|48|NZ_CP017266|CRISPRCasFinder matches to NZ_CP017266 (Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.25, complete sequence) position: , mismatch: 0, identity: 1.0

acacatttgtacatttacatatatgtaaatgtgtaaaaatatccgcat	CRISPR spacer
acacatttgtacatttacatatatgtaaatgtgtaaaaatatccgcat	Protospacer
************************************************

3. spacer 1.1|28722|48|NZ_CP017266|CRISPRCasFinder matches to NZ_CP012189 (Lactobacillus paracasei strain CAUH35 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acacatttgtacatttacatatatgtaaatgtgtaaaaatatccgcat	CRISPR spacer
acacatttgtacatttacatatatgtaaatgtgtaaaaatatccgcat	Protospacer
************************************************

4. spacer 1.1|28722|48|NZ_CP017266|CRISPRCasFinder matches to NZ_CP014986 (Lactobacillus paracasei strain IIA plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.979

acacatttgtacatttacatatatgtaaatgtgtaaaaatatccgcat	CRISPR spacer
acacatttgtacatttacatatatgtaaatgtgtaaaaatatccgcag	Protospacer
*********************************************** 

5. spacer 1.1|28722|48|NZ_CP017266|CRISPRCasFinder matches to NZ_CP031786 (Lactobacillus paracasei strain 10266 plasmid pLP10266, complete sequence) position: , mismatch: 1, identity: 0.979

acacatttgtacatttacatatatgtaaatgtgtaaaaatatccgcat	CRISPR spacer
acacatttgtacatttacatatatgtaaatgtgtaaaaatatccgcag	Protospacer
*********************************************** 

6. spacer 1.1|28722|48|NZ_CP017266|CRISPRCasFinder matches to NZ_CP039709 (Lactobacillus paracasei strain Lp02 plasmid pLp02-2, complete sequence) position: , mismatch: 1, identity: 0.979

acacatttgtacatttacatatatgtaaatgtgtaaaaatatccgcat	CRISPR spacer
acacatttgtacatttacatatatgtaaatgtgtaaaaatatccgcag	Protospacer
*********************************************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 10662 5 Lactobacillus_phage(66.67%) transposase NA
DBSCAN-SWA_2 15524 : 17978 2 Lactococcus_phage(50.0%) transposase NA
DBSCAN-SWA_3 28966 : 29848 1 Enterococcus_phage(100.0%) NA NA
DBSCAN-SWA_4 33621 : 39755 5 Staphylococcus_prophage(50.0%) transposase NA
DBSCAN-SWA_5 44212 : 45388 1 Staphylococcus_phage(100.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_CP017261
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2729 : 45605 38 Burkholderia_virus(20.0%) protease,transposase,holin NA
DBSCAN-SWA_2 114968 : 220543 105 Lactobacillus_phage(55.36%) protease,transposase,portal,integrase,holin,terminase,capsid,tail attL 122080:122102|attR 176031:176053
DBSCAN-SWA_3 409422 : 515002 105 Lactobacillus_phage(81.13%) protease,transposase,portal,integrase,holin,terminase,tRNA,capsid,tail,head attL 420704:420722|attR 498762:498780
DBSCAN-SWA_4 536900 : 611229 58 Streptococcus_phage(27.27%) tRNA,transposase,holin NA
DBSCAN-SWA_5 621073 : 665249 47 Staphylococcus_phage(16.67%) transposase,portal,integrase,terminase,capsid,tail,head attL 619481:619497|attR 668090:668106
DBSCAN-SWA_6 682307 : 743822 50 Cafeteria_roenbergensis_virus(15.38%) protease,tRNA,transposase NA
DBSCAN-SWA_7 1114548 : 1211929 92 Lactobacillus_phage(30.3%) transposase,portal,integrase,holin,terminase,tRNA,capsid,tail,head attL 1143671:1143730|attR 1176490:1176649
DBSCAN-SWA_8 1417010 : 1427286 9 Aichi_virus(16.67%) protease,transposase NA
DBSCAN-SWA_9 1497933 : 1588385 111 Lactobacillus_phage(64.91%) transposase,portal,integrase,holin,terminase,tRNA,capsid,tail,head attL 1543525:1543551|attR 1586826:1586852
DBSCAN-SWA_10 1645358 : 1680061 24 Pectobacterium_phage(14.29%) protease,tRNA,transposase NA
DBSCAN-SWA_11 1794671 : 1832367 28 Staphylococcus_phage(40.0%) bacteriocin,transposase NA
DBSCAN-SWA_12 1944362 : 2011167 55 Bacillus_phage(16.67%) protease,bacteriocin,tRNA,transposase NA
DBSCAN-SWA_13 2017889 : 2062123 43 Staphylococcus_phage(28.57%) protease,bacteriocin,transposase NA
DBSCAN-SWA_14 2201193 : 2267263 57 unidentified_phage(27.27%) protease,tRNA,transposase NA
DBSCAN-SWA_15 2403418 : 2464217 52 unidentified_phage(16.67%) protease,tRNA,transposase,holin NA
DBSCAN-SWA_16 2472365 : 2525802 52 unidentified_phage(33.33%) transposase NA
DBSCAN-SWA_17 2544818 : 2602836 47 Acanthamoeba_polyphaga_mimivirus(11.11%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_CP017265
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP017265_1 26468-26569 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NZ_CP014913 Lactobacillus paracollinoides strain TMW 1.1979 plasmid pL11979-1, complete sequence 22508-22537 0 1.0
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NZ_CP017358 Lactobacillus plantarum strain TMW 1.25 plasmid pL125-4, complete sequence 4830-4859 0 1.0
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NZ_CP017368 Lactobacillus plantarum strain TMW 1.277 plasmid pL1277-5, complete sequence 5770-5799 0 1.0
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NZ_CP017265 Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.24, complete sequence 26504-26533 0 1.0
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NZ_CP017960 Lactobacillus plantarum strain C410L1 plasmid unnamed6, complete sequence 6891-6920 0 1.0
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NZ_CP017960 Lactobacillus plantarum strain C410L1 plasmid unnamed6, complete sequence 20910-20939 0 1.0
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NZ_CP014934 Pediococcus claussenii strain TMW 2.53 plasmid pL253-1, complete sequence 5933-5962 0 1.0
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NZ_CP014937 Pediococcus claussenii strain TMW 2.54 plasmid pL254-1, complete sequence 5934-5963 0 1.0
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 MK994179 Lactobacillus plantarum strain PC518 plasmid plp75TA, complete sequence 4885-4914 0 1.0
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NC_014386 Lactobacillus helveticus R0052 plasmid pIR52-1, complete sequence 1748-1777 1 0.967
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NZ_CP019583 Lactobacillus helveticus strain LH5 plasmid pCBTLH5_2, complete sequence 4638-4667 1 0.967
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NC_006529 Lactobacillus salivarius UCC118 plasmid pSF118-20, complete sequence 4742-4771 1 0.967
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NZ_CP019033 Lactobacillus fermentum strain SNUV175 plasmid pSNU175-4, complete sequence 21083-21112 2 0.933
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NC_017468 Lactobacillus helveticus H10 plasmid pH10, complete sequence 15844-15873 2 0.933
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NZ_CP033891 Lactobacillus plantarum strain LMT1-48 plasmid p_3, complete sequence 3330-3359 2 0.933
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NZ_CP011537 Lactobacillus fermentum 3872 plasmid pLF3872, complete sequence 7181-7210 2 0.933
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NC_017017 Pediococcus claussenii ATCC BAA-344 plasmid pPECL-6, complete sequence 5387-5416 3 0.9
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NZ_CP014928 Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-4, complete sequence 6824-6853 3 0.9
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NZ_CP014920 Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-5, complete sequence 12632-12661 3 0.9
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NZ_CP047125 Lactobacillus hilgardii strain FLUB plasmid unnamed4 5237-5266 3 0.9
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NZ_CP031200 Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_B, complete sequence 39624-39653 3 0.9
NZ_CP017265_1 1.1|26504|30|NZ_CP017265|CRISPRCasFinder 26504-26533 30 NC_008498 Lactobacillus brevis ATCC 367 plasmid 1, complete sequence 8762-8791 4 0.867

1. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NZ_CP014913 (Lactobacillus paracollinoides strain TMW 1.1979 plasmid pL11979-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
******************************

2. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NZ_CP017358 (Lactobacillus plantarum strain TMW 1.25 plasmid pL125-4, complete sequence) position: , mismatch: 0, identity: 1.0

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
******************************

3. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NZ_CP017368 (Lactobacillus plantarum strain TMW 1.277 plasmid pL1277-5, complete sequence) position: , mismatch: 0, identity: 1.0

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
******************************

4. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NZ_CP017265 (Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.24, complete sequence) position: , mismatch: 0, identity: 1.0

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
******************************

5. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NZ_CP017960 (Lactobacillus plantarum strain C410L1 plasmid unnamed6, complete sequence) position: , mismatch: 0, identity: 1.0

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
******************************

6. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NZ_CP017960 (Lactobacillus plantarum strain C410L1 plasmid unnamed6, complete sequence) position: , mismatch: 0, identity: 1.0

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
******************************

7. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NZ_CP014934 (Pediococcus claussenii strain TMW 2.53 plasmid pL253-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
******************************

8. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NZ_CP014937 (Pediococcus claussenii strain TMW 2.54 plasmid pL254-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
******************************

9. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to MK994179 (Lactobacillus plantarum strain PC518 plasmid plp75TA, complete sequence) position: , mismatch: 0, identity: 1.0

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggggtgtcatcaacggactttcgcgaag	Protospacer
******************************

10. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NC_014386 (Lactobacillus helveticus R0052 plasmid pIR52-1, complete sequence) position: , mismatch: 1, identity: 0.967

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcgggttgtcatcaacggactttcgcgaag	Protospacer
***** ************************

11. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NZ_CP019583 (Lactobacillus helveticus strain LH5 plasmid pCBTLH5_2, complete sequence) position: , mismatch: 1, identity: 0.967

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcgggttgtcatcaacggactttcgcgaag	Protospacer
***** ************************

12. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NC_006529 (Lactobacillus salivarius UCC118 plasmid pSF118-20, complete sequence) position: , mismatch: 1, identity: 0.967

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggggtgtcgtcaacggactttcgcgaag	Protospacer
**********.*******************

13. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NZ_CP019033 (Lactobacillus fermentum strain SNUV175 plasmid pSNU175-4, complete sequence) position: , mismatch: 2, identity: 0.933

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggagtgtcgtcaacggactttcgcgaag	Protospacer
****.*****.*******************

14. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NC_017468 (Lactobacillus helveticus H10 plasmid pH10, complete sequence) position: , mismatch: 2, identity: 0.933

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaag	Protospacer
**********.******.************

15. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NZ_CP033891 (Lactobacillus plantarum strain LMT1-48 plasmid p_3, complete sequence) position: , mismatch: 2, identity: 0.933

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaag	Protospacer
**********.******.************

16. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NZ_CP011537 (Lactobacillus fermentum 3872 plasmid pLF3872, complete sequence) position: , mismatch: 2, identity: 0.933

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggagtgtcgtcaacggactttcgcgaag	Protospacer
****.*****.*******************

17. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NC_017017 (Pediococcus claussenii ATCC BAA-344 plasmid pPECL-6, complete sequence) position: , mismatch: 3, identity: 0.9

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaac	Protospacer
**********.******.*********** 

18. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NZ_CP014928 (Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-4, complete sequence) position: , mismatch: 3, identity: 0.9

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaac	Protospacer
**********.******.*********** 

19. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NZ_CP014920 (Lactobacillus paracollinoides strain TMW 1.1994 plasmid pL11994-5, complete sequence) position: , mismatch: 3, identity: 0.9

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaat	Protospacer
**********.******.*********** 

20. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NZ_CP047125 (Lactobacillus hilgardii strain FLUB plasmid unnamed4) position: , mismatch: 3, identity: 0.9

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaac	Protospacer
**********.******.*********** 

21. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NZ_CP031200 (Lactobacillus brevis strain UCCLBBS449 plasmid pUCCLBBS449_B, complete sequence) position: , mismatch: 3, identity: 0.9

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gcggggtgtcgtcaacgaactttcgcgaat	Protospacer
**********.******.*********** 

22. spacer 1.1|26504|30|NZ_CP017265|CRISPRCasFinder matches to NC_008498 (Lactobacillus brevis ATCC 367 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.867

gcggggtgtcatcaacggactttcgcgaag	CRISPR spacer
gtggggtgtcgtcaacgaactttcgcgaac	Protospacer
*.********.******.*********** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage