Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 1 crisprs csa3,RT,casR,DinG 0 12 1 0
NZ_CP023497 Staphylococcus simulans strain FDAARGOS_383 chromosome, complete genome 2 crisprs csa3,WYL,cas2,cas1,cas9,RT,cas3,DEDDh,DinG 0 19 8 0

Results visualization

1. NZ_CP023496
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023496_1 82474-83045 Orphan NA
12 spacers
casR

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023496_1 1.1|82500|22|NZ_CP023496|CRT 82500-82521 22 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82500-82521 0 1.0
NZ_CP023496_1 1.2|82548|19|NZ_CP023496|CRT 82548-82566 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 42929-42947 0 1.0
NZ_CP023496_1 1.2|82548|19|NZ_CP023496|CRT 82548-82566 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 42974-42992 0 1.0
NZ_CP023496_1 1.2|82548|19|NZ_CP023496|CRT 82548-82566 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43109-43127 0 1.0
NZ_CP023496_1 1.2|82548|19|NZ_CP023496|CRT 82548-82566 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43154-43172 0 1.0
NZ_CP023496_1 1.2|82548|19|NZ_CP023496|CRT 82548-82566 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43199-43217 0 1.0
NZ_CP023496_1 1.2|82548|19|NZ_CP023496|CRT 82548-82566 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43244-43262 0 1.0
NZ_CP023496_1 1.2|82548|19|NZ_CP023496|CRT 82548-82566 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43334-43352 0 1.0
NZ_CP023496_1 1.2|82548|19|NZ_CP023496|CRT 82548-82566 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43379-43397 0 1.0
NZ_CP023496_1 1.2|82548|19|NZ_CP023496|CRT 82548-82566 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43424-43442 0 1.0
NZ_CP023496_1 1.2|82548|19|NZ_CP023496|CRT 82548-82566 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82548-82566 0 1.0
NZ_CP023496_1 1.2|82548|19|NZ_CP023496|CRT 82548-82566 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82638-82656 0 1.0
NZ_CP023496_1 1.2|82548|19|NZ_CP023496|CRT 82548-82566 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82683-82701 0 1.0
NZ_CP023496_1 1.2|82548|19|NZ_CP023496|CRT 82548-82566 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82728-82746 0 1.0
NZ_CP023496_1 1.2|82548|19|NZ_CP023496|CRT 82548-82566 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82773-82791 0 1.0
NZ_CP023496_1 1.2|82548|19|NZ_CP023496|CRT 82548-82566 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82818-82836 0 1.0
NZ_CP023496_1 1.2|82548|19|NZ_CP023496|CRT 82548-82566 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82863-82881 0 1.0
NZ_CP023496_1 1.2|82548|19|NZ_CP023496|CRT 82548-82566 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82908-82926 0 1.0
NZ_CP023496_1 1.3|82593|19|NZ_CP023496|CRT 82593-82611 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43019-43037 0 1.0
NZ_CP023496_1 1.3|82593|19|NZ_CP023496|CRT 82593-82611 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43064-43082 0 1.0
NZ_CP023496_1 1.3|82593|19|NZ_CP023496|CRT 82593-82611 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82593-82611 0 1.0
NZ_CP023496_1 1.4|82638|19|NZ_CP023496|CRT 82638-82656 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 42929-42947 0 1.0
NZ_CP023496_1 1.4|82638|19|NZ_CP023496|CRT 82638-82656 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 42974-42992 0 1.0
NZ_CP023496_1 1.4|82638|19|NZ_CP023496|CRT 82638-82656 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43109-43127 0 1.0
NZ_CP023496_1 1.4|82638|19|NZ_CP023496|CRT 82638-82656 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43154-43172 0 1.0
NZ_CP023496_1 1.4|82638|19|NZ_CP023496|CRT 82638-82656 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43199-43217 0 1.0
NZ_CP023496_1 1.4|82638|19|NZ_CP023496|CRT 82638-82656 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43244-43262 0 1.0
NZ_CP023496_1 1.4|82638|19|NZ_CP023496|CRT 82638-82656 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43334-43352 0 1.0
NZ_CP023496_1 1.4|82638|19|NZ_CP023496|CRT 82638-82656 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43379-43397 0 1.0
NZ_CP023496_1 1.4|82638|19|NZ_CP023496|CRT 82638-82656 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43424-43442 0 1.0
NZ_CP023496_1 1.4|82638|19|NZ_CP023496|CRT 82638-82656 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82548-82566 0 1.0
NZ_CP023496_1 1.4|82638|19|NZ_CP023496|CRT 82638-82656 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82638-82656 0 1.0
NZ_CP023496_1 1.4|82638|19|NZ_CP023496|CRT 82638-82656 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82683-82701 0 1.0
NZ_CP023496_1 1.4|82638|19|NZ_CP023496|CRT 82638-82656 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82728-82746 0 1.0
NZ_CP023496_1 1.4|82638|19|NZ_CP023496|CRT 82638-82656 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82773-82791 0 1.0
NZ_CP023496_1 1.4|82638|19|NZ_CP023496|CRT 82638-82656 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82818-82836 0 1.0
NZ_CP023496_1 1.4|82638|19|NZ_CP023496|CRT 82638-82656 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82863-82881 0 1.0
NZ_CP023496_1 1.4|82638|19|NZ_CP023496|CRT 82638-82656 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82908-82926 0 1.0
NZ_CP023496_1 1.5|82683|19|NZ_CP023496|CRT 82683-82701 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 42929-42947 0 1.0
NZ_CP023496_1 1.5|82683|19|NZ_CP023496|CRT 82683-82701 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 42974-42992 0 1.0
NZ_CP023496_1 1.5|82683|19|NZ_CP023496|CRT 82683-82701 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43109-43127 0 1.0
NZ_CP023496_1 1.5|82683|19|NZ_CP023496|CRT 82683-82701 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43154-43172 0 1.0
NZ_CP023496_1 1.5|82683|19|NZ_CP023496|CRT 82683-82701 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43199-43217 0 1.0
NZ_CP023496_1 1.5|82683|19|NZ_CP023496|CRT 82683-82701 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43244-43262 0 1.0
NZ_CP023496_1 1.5|82683|19|NZ_CP023496|CRT 82683-82701 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43334-43352 0 1.0
NZ_CP023496_1 1.5|82683|19|NZ_CP023496|CRT 82683-82701 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43379-43397 0 1.0
NZ_CP023496_1 1.5|82683|19|NZ_CP023496|CRT 82683-82701 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43424-43442 0 1.0
NZ_CP023496_1 1.5|82683|19|NZ_CP023496|CRT 82683-82701 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82548-82566 0 1.0
NZ_CP023496_1 1.5|82683|19|NZ_CP023496|CRT 82683-82701 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82638-82656 0 1.0
NZ_CP023496_1 1.5|82683|19|NZ_CP023496|CRT 82683-82701 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82683-82701 0 1.0
NZ_CP023496_1 1.5|82683|19|NZ_CP023496|CRT 82683-82701 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82728-82746 0 1.0
NZ_CP023496_1 1.5|82683|19|NZ_CP023496|CRT 82683-82701 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82773-82791 0 1.0
NZ_CP023496_1 1.5|82683|19|NZ_CP023496|CRT 82683-82701 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82818-82836 0 1.0
NZ_CP023496_1 1.5|82683|19|NZ_CP023496|CRT 82683-82701 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82863-82881 0 1.0
NZ_CP023496_1 1.5|82683|19|NZ_CP023496|CRT 82683-82701 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82908-82926 0 1.0
NZ_CP023496_1 1.6|82728|19|NZ_CP023496|CRT 82728-82746 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 42929-42947 0 1.0
NZ_CP023496_1 1.6|82728|19|NZ_CP023496|CRT 82728-82746 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 42974-42992 0 1.0
NZ_CP023496_1 1.6|82728|19|NZ_CP023496|CRT 82728-82746 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43109-43127 0 1.0
NZ_CP023496_1 1.6|82728|19|NZ_CP023496|CRT 82728-82746 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43154-43172 0 1.0
NZ_CP023496_1 1.6|82728|19|NZ_CP023496|CRT 82728-82746 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43199-43217 0 1.0
NZ_CP023496_1 1.6|82728|19|NZ_CP023496|CRT 82728-82746 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43244-43262 0 1.0
NZ_CP023496_1 1.6|82728|19|NZ_CP023496|CRT 82728-82746 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43334-43352 0 1.0
NZ_CP023496_1 1.6|82728|19|NZ_CP023496|CRT 82728-82746 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43379-43397 0 1.0
NZ_CP023496_1 1.6|82728|19|NZ_CP023496|CRT 82728-82746 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43424-43442 0 1.0
NZ_CP023496_1 1.6|82728|19|NZ_CP023496|CRT 82728-82746 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82548-82566 0 1.0
NZ_CP023496_1 1.6|82728|19|NZ_CP023496|CRT 82728-82746 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82638-82656 0 1.0
NZ_CP023496_1 1.6|82728|19|NZ_CP023496|CRT 82728-82746 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82683-82701 0 1.0
NZ_CP023496_1 1.6|82728|19|NZ_CP023496|CRT 82728-82746 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82728-82746 0 1.0
NZ_CP023496_1 1.6|82728|19|NZ_CP023496|CRT 82728-82746 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82773-82791 0 1.0
NZ_CP023496_1 1.6|82728|19|NZ_CP023496|CRT 82728-82746 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82818-82836 0 1.0
NZ_CP023496_1 1.6|82728|19|NZ_CP023496|CRT 82728-82746 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82863-82881 0 1.0
NZ_CP023496_1 1.6|82728|19|NZ_CP023496|CRT 82728-82746 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82908-82926 0 1.0
NZ_CP023496_1 1.7|82773|19|NZ_CP023496|CRT 82773-82791 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 42929-42947 0 1.0
NZ_CP023496_1 1.7|82773|19|NZ_CP023496|CRT 82773-82791 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 42974-42992 0 1.0
NZ_CP023496_1 1.7|82773|19|NZ_CP023496|CRT 82773-82791 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43109-43127 0 1.0
NZ_CP023496_1 1.7|82773|19|NZ_CP023496|CRT 82773-82791 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43154-43172 0 1.0
NZ_CP023496_1 1.7|82773|19|NZ_CP023496|CRT 82773-82791 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43199-43217 0 1.0
NZ_CP023496_1 1.7|82773|19|NZ_CP023496|CRT 82773-82791 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43244-43262 0 1.0
NZ_CP023496_1 1.7|82773|19|NZ_CP023496|CRT 82773-82791 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43334-43352 0 1.0
NZ_CP023496_1 1.7|82773|19|NZ_CP023496|CRT 82773-82791 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43379-43397 0 1.0
NZ_CP023496_1 1.7|82773|19|NZ_CP023496|CRT 82773-82791 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43424-43442 0 1.0
NZ_CP023496_1 1.7|82773|19|NZ_CP023496|CRT 82773-82791 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82548-82566 0 1.0
NZ_CP023496_1 1.7|82773|19|NZ_CP023496|CRT 82773-82791 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82638-82656 0 1.0
NZ_CP023496_1 1.7|82773|19|NZ_CP023496|CRT 82773-82791 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82683-82701 0 1.0
NZ_CP023496_1 1.7|82773|19|NZ_CP023496|CRT 82773-82791 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82728-82746 0 1.0
NZ_CP023496_1 1.7|82773|19|NZ_CP023496|CRT 82773-82791 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82773-82791 0 1.0
NZ_CP023496_1 1.7|82773|19|NZ_CP023496|CRT 82773-82791 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82818-82836 0 1.0
NZ_CP023496_1 1.7|82773|19|NZ_CP023496|CRT 82773-82791 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82863-82881 0 1.0
NZ_CP023496_1 1.7|82773|19|NZ_CP023496|CRT 82773-82791 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82908-82926 0 1.0
NZ_CP023496_1 1.8|82818|19|NZ_CP023496|CRT 82818-82836 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 42929-42947 0 1.0
NZ_CP023496_1 1.8|82818|19|NZ_CP023496|CRT 82818-82836 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 42974-42992 0 1.0
NZ_CP023496_1 1.8|82818|19|NZ_CP023496|CRT 82818-82836 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43109-43127 0 1.0
NZ_CP023496_1 1.8|82818|19|NZ_CP023496|CRT 82818-82836 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43154-43172 0 1.0
NZ_CP023496_1 1.8|82818|19|NZ_CP023496|CRT 82818-82836 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43199-43217 0 1.0
NZ_CP023496_1 1.8|82818|19|NZ_CP023496|CRT 82818-82836 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43244-43262 0 1.0
NZ_CP023496_1 1.8|82818|19|NZ_CP023496|CRT 82818-82836 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43334-43352 0 1.0
NZ_CP023496_1 1.8|82818|19|NZ_CP023496|CRT 82818-82836 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43379-43397 0 1.0
NZ_CP023496_1 1.8|82818|19|NZ_CP023496|CRT 82818-82836 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43424-43442 0 1.0
NZ_CP023496_1 1.8|82818|19|NZ_CP023496|CRT 82818-82836 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82548-82566 0 1.0
NZ_CP023496_1 1.8|82818|19|NZ_CP023496|CRT 82818-82836 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82638-82656 0 1.0
NZ_CP023496_1 1.8|82818|19|NZ_CP023496|CRT 82818-82836 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82683-82701 0 1.0
NZ_CP023496_1 1.8|82818|19|NZ_CP023496|CRT 82818-82836 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82728-82746 0 1.0
NZ_CP023496_1 1.8|82818|19|NZ_CP023496|CRT 82818-82836 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82773-82791 0 1.0
NZ_CP023496_1 1.8|82818|19|NZ_CP023496|CRT 82818-82836 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82818-82836 0 1.0
NZ_CP023496_1 1.8|82818|19|NZ_CP023496|CRT 82818-82836 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82863-82881 0 1.0
NZ_CP023496_1 1.8|82818|19|NZ_CP023496|CRT 82818-82836 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82908-82926 0 1.0
NZ_CP023496_1 1.9|82863|19|NZ_CP023496|CRT 82863-82881 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 42929-42947 0 1.0
NZ_CP023496_1 1.9|82863|19|NZ_CP023496|CRT 82863-82881 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 42974-42992 0 1.0
NZ_CP023496_1 1.9|82863|19|NZ_CP023496|CRT 82863-82881 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43109-43127 0 1.0
NZ_CP023496_1 1.9|82863|19|NZ_CP023496|CRT 82863-82881 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43154-43172 0 1.0
NZ_CP023496_1 1.9|82863|19|NZ_CP023496|CRT 82863-82881 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43199-43217 0 1.0
NZ_CP023496_1 1.9|82863|19|NZ_CP023496|CRT 82863-82881 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43244-43262 0 1.0
NZ_CP023496_1 1.9|82863|19|NZ_CP023496|CRT 82863-82881 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43334-43352 0 1.0
NZ_CP023496_1 1.9|82863|19|NZ_CP023496|CRT 82863-82881 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43379-43397 0 1.0
NZ_CP023496_1 1.9|82863|19|NZ_CP023496|CRT 82863-82881 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43424-43442 0 1.0
NZ_CP023496_1 1.9|82863|19|NZ_CP023496|CRT 82863-82881 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82548-82566 0 1.0
NZ_CP023496_1 1.9|82863|19|NZ_CP023496|CRT 82863-82881 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82638-82656 0 1.0
NZ_CP023496_1 1.9|82863|19|NZ_CP023496|CRT 82863-82881 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82683-82701 0 1.0
NZ_CP023496_1 1.9|82863|19|NZ_CP023496|CRT 82863-82881 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82728-82746 0 1.0
NZ_CP023496_1 1.9|82863|19|NZ_CP023496|CRT 82863-82881 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82773-82791 0 1.0
NZ_CP023496_1 1.9|82863|19|NZ_CP023496|CRT 82863-82881 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82818-82836 0 1.0
NZ_CP023496_1 1.9|82863|19|NZ_CP023496|CRT 82863-82881 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82863-82881 0 1.0
NZ_CP023496_1 1.9|82863|19|NZ_CP023496|CRT 82863-82881 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82908-82926 0 1.0
NZ_CP023496_1 1.10|82908|19|NZ_CP023496|CRT 82908-82926 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 42929-42947 0 1.0
NZ_CP023496_1 1.10|82908|19|NZ_CP023496|CRT 82908-82926 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 42974-42992 0 1.0
NZ_CP023496_1 1.10|82908|19|NZ_CP023496|CRT 82908-82926 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43109-43127 0 1.0
NZ_CP023496_1 1.10|82908|19|NZ_CP023496|CRT 82908-82926 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43154-43172 0 1.0
NZ_CP023496_1 1.10|82908|19|NZ_CP023496|CRT 82908-82926 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43199-43217 0 1.0
NZ_CP023496_1 1.10|82908|19|NZ_CP023496|CRT 82908-82926 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43244-43262 0 1.0
NZ_CP023496_1 1.10|82908|19|NZ_CP023496|CRT 82908-82926 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43334-43352 0 1.0
NZ_CP023496_1 1.10|82908|19|NZ_CP023496|CRT 82908-82926 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43379-43397 0 1.0
NZ_CP023496_1 1.10|82908|19|NZ_CP023496|CRT 82908-82926 19 NZ_CP046302 Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence 43424-43442 0 1.0
NZ_CP023496_1 1.10|82908|19|NZ_CP023496|CRT 82908-82926 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82548-82566 0 1.0
NZ_CP023496_1 1.10|82908|19|NZ_CP023496|CRT 82908-82926 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82638-82656 0 1.0
NZ_CP023496_1 1.10|82908|19|NZ_CP023496|CRT 82908-82926 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82683-82701 0 1.0
NZ_CP023496_1 1.10|82908|19|NZ_CP023496|CRT 82908-82926 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82728-82746 0 1.0
NZ_CP023496_1 1.10|82908|19|NZ_CP023496|CRT 82908-82926 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82773-82791 0 1.0
NZ_CP023496_1 1.10|82908|19|NZ_CP023496|CRT 82908-82926 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82818-82836 0 1.0
NZ_CP023496_1 1.10|82908|19|NZ_CP023496|CRT 82908-82926 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82863-82881 0 1.0
NZ_CP023496_1 1.10|82908|19|NZ_CP023496|CRT 82908-82926 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82908-82926 0 1.0
NZ_CP023496_1 1.11|82953|22|NZ_CP023496|CRT 82953-82974 22 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 82953-82974 0 1.0
NZ_CP023496_1 1.12|83001|19|NZ_CP023496|CRT 83001-83019 19 NZ_CP023496 Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence 83001-83019 0 1.0

1. spacer 1.1|82500|22|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

aaaagtaacaagtgaaggtgca	CRISPR spacer
aaaagtaacaagtgaaggtgca	Protospacer
**********************

2. spacer 1.2|82548|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

3. spacer 1.2|82548|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

4. spacer 1.2|82548|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

5. spacer 1.2|82548|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

6. spacer 1.2|82548|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

7. spacer 1.2|82548|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

8. spacer 1.2|82548|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

9. spacer 1.2|82548|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

10. spacer 1.2|82548|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

11. spacer 1.2|82548|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

12. spacer 1.2|82548|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

13. spacer 1.2|82548|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

14. spacer 1.2|82548|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

15. spacer 1.2|82548|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

16. spacer 1.2|82548|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

17. spacer 1.2|82548|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

18. spacer 1.2|82548|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

19. spacer 1.3|82593|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagt	CRISPR spacer
gaaggcaactgaagaaagt	Protospacer
*******************

20. spacer 1.3|82593|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagt	CRISPR spacer
gaaggcaactgaagaaagt	Protospacer
*******************

21. spacer 1.3|82593|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagt	CRISPR spacer
gaaggcaactgaagaaagt	Protospacer
*******************

22. spacer 1.4|82638|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

23. spacer 1.4|82638|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

24. spacer 1.4|82638|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

25. spacer 1.4|82638|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

26. spacer 1.4|82638|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

27. spacer 1.4|82638|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

28. spacer 1.4|82638|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

29. spacer 1.4|82638|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

30. spacer 1.4|82638|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

31. spacer 1.4|82638|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

32. spacer 1.4|82638|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

33. spacer 1.4|82638|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

34. spacer 1.4|82638|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

35. spacer 1.4|82638|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

36. spacer 1.4|82638|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

37. spacer 1.4|82638|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

38. spacer 1.4|82638|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

39. spacer 1.5|82683|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

40. spacer 1.5|82683|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

41. spacer 1.5|82683|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

42. spacer 1.5|82683|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

43. spacer 1.5|82683|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

44. spacer 1.5|82683|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

45. spacer 1.5|82683|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

46. spacer 1.5|82683|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

47. spacer 1.5|82683|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

48. spacer 1.5|82683|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

49. spacer 1.5|82683|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

50. spacer 1.5|82683|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

51. spacer 1.5|82683|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

52. spacer 1.5|82683|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

53. spacer 1.5|82683|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

54. spacer 1.5|82683|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

55. spacer 1.5|82683|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

56. spacer 1.6|82728|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

57. spacer 1.6|82728|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

58. spacer 1.6|82728|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

59. spacer 1.6|82728|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

60. spacer 1.6|82728|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

61. spacer 1.6|82728|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

62. spacer 1.6|82728|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

63. spacer 1.6|82728|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

64. spacer 1.6|82728|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

65. spacer 1.6|82728|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

66. spacer 1.6|82728|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

67. spacer 1.6|82728|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

68. spacer 1.6|82728|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

69. spacer 1.6|82728|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

70. spacer 1.6|82728|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

71. spacer 1.6|82728|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

72. spacer 1.6|82728|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

73. spacer 1.7|82773|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

74. spacer 1.7|82773|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

75. spacer 1.7|82773|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

76. spacer 1.7|82773|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

77. spacer 1.7|82773|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

78. spacer 1.7|82773|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

79. spacer 1.7|82773|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

80. spacer 1.7|82773|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

81. spacer 1.7|82773|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

82. spacer 1.7|82773|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

83. spacer 1.7|82773|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

84. spacer 1.7|82773|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

85. spacer 1.7|82773|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

86. spacer 1.7|82773|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

87. spacer 1.7|82773|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

88. spacer 1.7|82773|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

89. spacer 1.7|82773|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

90. spacer 1.8|82818|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

91. spacer 1.8|82818|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

92. spacer 1.8|82818|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

93. spacer 1.8|82818|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

94. spacer 1.8|82818|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

95. spacer 1.8|82818|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

96. spacer 1.8|82818|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

97. spacer 1.8|82818|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

98. spacer 1.8|82818|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

99. spacer 1.8|82818|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

100. spacer 1.8|82818|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

101. spacer 1.8|82818|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

102. spacer 1.8|82818|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

103. spacer 1.8|82818|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

104. spacer 1.8|82818|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

105. spacer 1.8|82818|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

106. spacer 1.8|82818|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

107. spacer 1.9|82863|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

108. spacer 1.9|82863|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

109. spacer 1.9|82863|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

110. spacer 1.9|82863|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

111. spacer 1.9|82863|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

112. spacer 1.9|82863|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

113. spacer 1.9|82863|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

114. spacer 1.9|82863|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

115. spacer 1.9|82863|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

116. spacer 1.9|82863|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

117. spacer 1.9|82863|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

118. spacer 1.9|82863|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

119. spacer 1.9|82863|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

120. spacer 1.9|82863|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

121. spacer 1.9|82863|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

122. spacer 1.9|82863|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

123. spacer 1.9|82863|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

124. spacer 1.10|82908|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

125. spacer 1.10|82908|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

126. spacer 1.10|82908|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

127. spacer 1.10|82908|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

128. spacer 1.10|82908|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

129. spacer 1.10|82908|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

130. spacer 1.10|82908|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

131. spacer 1.10|82908|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

132. spacer 1.10|82908|19|NZ_CP023496|CRT matches to NZ_CP046302 (Staphylococcus hominis strain FDAARGOS_747 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

133. spacer 1.10|82908|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

134. spacer 1.10|82908|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

135. spacer 1.10|82908|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

136. spacer 1.10|82908|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

137. spacer 1.10|82908|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

138. spacer 1.10|82908|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

139. spacer 1.10|82908|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

140. spacer 1.10|82908|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaactgaagaaagc	CRISPR spacer
gaaggcaactgaagaaagc	Protospacer
*******************

141. spacer 1.11|82953|22|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

aaaagcaacaagtgaaggtaca	CRISPR spacer
aaaagcaacaagtgaaggtaca	Protospacer
**********************

142. spacer 1.12|83001|19|NZ_CP023496|CRT matches to NZ_CP023496 (Staphylococcus simulans strain FDAARGOS_383 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggcaagtaaagaaagt	CRISPR spacer
gaaggcaagtaaagaaagt	Protospacer
*******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 35661 : 104076 52 Staphylococcus_phage(26.67%) tRNA,integrase,transposase attL 77252:77311|attR 107080:108648
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP023497
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023497_1 742445-743798 orTypeII NA
20 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023497_2 2160941-2161370 Unclear NA
6 spacers
cas2,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023497_1 1.13|743272|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743272-743301 30 NC_007055 Staphylococcus phage 37, complete genome 251-280 0 1.0
NZ_CP023497_1 1.13|743272|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743272-743301 30 AY954958 Bacteriophage 37, complete genome 251-280 0 1.0
NZ_CP023497_1 1.14|743338|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743338-743367 30 NC_007055 Staphylococcus phage 37, complete genome 37903-37932 0 1.0
NZ_CP023497_1 1.14|743338|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743338-743367 30 AY954958 Bacteriophage 37, complete genome 37903-37932 0 1.0
NZ_CP023497_1 1.19|743667|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743667-743695 29 NC_007051 Staphylococcus phage 2638A, complete genome 15473-15501 0 1.0
NZ_CP023497_1 1.19|743667|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743667-743695 29 MK450538 Staphylococcus phage vB_SpsS_QT1, complete genome 15551-15579 0 1.0
NZ_CP023497_1 1.19|743667|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743667-743695 29 AY954954 Bacteriophage 2638A, complete genome 15473-15501 0 1.0
NZ_CP023497_1 1.6|742811|30|NZ_CP023497|CRT,CRISPRCasFinder 742811-742840 30 NC_007055 Staphylococcus phage 37, complete genome 6017-6046 1 0.967
NZ_CP023497_1 1.6|742811|30|NZ_CP023497|CRT,CRISPRCasFinder 742811-742840 30 AY954958 Bacteriophage 37, complete genome 6017-6046 1 0.967
NZ_CP023497_1 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743404-743433 30 NC_007055 Staphylococcus phage 37, complete genome 13291-13320 1 0.967
NZ_CP023497_1 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743404-743433 30 AY954958 Bacteriophage 37, complete genome 13291-13320 1 0.967
NZ_CP023497_1 1.16|743470|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743470-743499 30 MF417895 Uncultured Caudovirales phage clone 10AX_1, partial genome 38365-38394 3 0.9
NZ_CP023497_1 1.16|743470|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743470-743499 30 NC_028821 Staphylococcus phage StB20-like, complete genome 21489-21518 3 0.9
NZ_CP023497_1 1.16|743470|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743470-743499 30 MF417909 Uncultured Caudovirales phage clone 10F_7, partial genome 29388-29417 3 0.9
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 KX827371 Staphylococcus phage SpT99F3, complete genome 37592-37620 3 0.897
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 MK075001 Staphylococcus phage phiSP15-1, complete genome 41559-41587 3 0.897
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 MK450538 Staphylococcus phage vB_SpsS_QT1, complete genome 21504-21532 3 0.897
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 MK075004 Staphylococcus phage phiSP119-1, complete genome 47091-47119 3 0.897
NZ_CP023497_2 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161108-2161137 30 KU598975 Staphylococcus phage CNPx, complete genome 21952-21981 4 0.867
NZ_CP023497_2 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161108-2161137 30 DQ831957 Staphylococcus phage CNPH82, complete genome 21943-21972 4 0.867
NZ_CP023497_1 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743536-743565 30 MT774393 CrAssphage cr127_1, complete genome 36799-36828 5 0.833
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 NZ_CP039278 Salmonella enterica subsp. enterica strain 12-0523 plasmid p12-0523.1, complete sequence 8057-8085 5 0.828
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 589918-589946 5 0.828
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 NZ_AP014865 Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK1, complete sequence 15769-15797 5 0.828
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 MN694034 Marine virus AFVG_250M807, complete genome 11202-11230 5 0.828
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 AP013500 Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C94-MedDCM-OCT-S26-C69 11191-11219 5 0.828
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 MK893987 Staphylococcus phage PMBT8, complete genome 85948-85976 5 0.828
NZ_CP023497_2 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161108-2161137 30 JN192400 Staphylococcus phage vB_SepiS-phiIPLA5, complete genome 22598-22627 5 0.833
NZ_CP023497_2 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161108-2161137 30 MK448341 Streptococcus satellite phage Javan16, complete genome 8474-8503 5 0.833
NZ_CP023497_2 2.4|2161174|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161174-2161203 30 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 331219-331248 5 0.833
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 GU943056 Uncultured phage MedDCM-OCT-S04-C348 genomic sequence 2439-2468 6 0.8
NZ_CP023497_1 1.9|743009|30|NZ_CP023497|CRT,CRISPRCasFinder 743009-743038 30 NC_041879 Bacillus phage Mgbh1, complete genome 24430-24459 6 0.8
NZ_CP023497_1 1.10|743075|29|NZ_CP023497|CRT,CRISPRCasFinder 743075-743103 29 NZ_CP015232 Epibacterium mobile F1926 plasmid unnamed2, complete sequence 15015-15043 6 0.793
NZ_CP023497_1 1.10|743075|29|NZ_CP023497|CRT,CRISPRCasFinder 743075-743103 29 NZ_LR027555 Epibacterium mobile isolate EPIB1 plasmid 3, complete sequence 40399-40427 6 0.793
NZ_CP023497_1 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743140-743169 30 MN693421 Marine virus AFVG_25M197, complete genome 16627-16656 6 0.8
NZ_CP023497_1 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743140-743169 30 MN693283 Marine virus AFVG_25M198, complete genome 16672-16701 6 0.8
NZ_CP023497_1 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743140-743169 30 NZ_LR214998 Mycoplasma conjunctivae strain NCTC10147 plasmid 2 7262-7291 6 0.8
NZ_CP023497_1 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743536-743565 30 NC_012654 Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence 46105-46134 6 0.8
NZ_CP023497_1 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743536-743565 30 NZ_CP031095 Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence 66025-66054 6 0.8
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 NZ_CP018751 Borreliella garinii strain CIP 103362 isolate 20047 plasmid unnamed4 8467-8495 6 0.793
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 NZ_CP028866 Borreliella garinii strain 20047 plasmid lp17, complete sequence 12395-12423 6 0.793
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 NZ_CP028876 Borreliella bavariensis PBi plasmid lp17, complete sequence 8507-8535 6 0.793
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 KY653116 Staphylococcus phage IME1318_01, complete genome 20998-21026 6 0.793
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 NZ_AP019828 Leptotrichia shahii strain JCM16776 plasmid JCM16776p1, complete sequence 10971-10999 6 0.793
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 NZ_AP019824 Leptotrichia hofstadii strain JCM16775 plasmid pJCM16775-1, complete sequence 18102-18130 6 0.793
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 NZ_AP019836 Leptotrichia wadei strain JMUB3934 plasmid pJMUB3934p1, complete sequence 3958-3986 6 0.793
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 MN693898 Marine virus AFVG_250M937, complete genome 47137-47165 6 0.793
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 MT787017 UNVERIFIED: Staphylococcus phage WV, complete genome 46301-46329 6 0.793
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 KY794643 Staphylococcus phage vB_Sau_S24, complete genome 56078-56106 6 0.793
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 LR215720 Staphylococcus phage Stab23 genome assembly, chromosome: I 96440-96468 6 0.793
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 MH552526 Siphoviridae sp. isolate ctfj46, complete genome 76056-76084 6 0.793
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 KY794642 Staphylococcus phage vB_Sau_Clo6, complete genome 56606-56634 6 0.793
NZ_CP023497_2 2.1|2160977|29|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2160977-2161005 29 NZ_CP011053 Halomonas sp. KO116 plasmid unnamed1, complete sequence 283849-283877 6 0.793
NZ_CP023497_2 2.2|2161042|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161042-2161071 30 NZ_CP021407 Celeribacter manganoxidans strain DY25 plasmid pDY25-C, complete sequence 58780-58809 6 0.8
NZ_CP023497_2 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161108-2161137 30 KY653120 Staphylococcus phage IME1348_01, complete genome 37543-37572 6 0.8
NZ_CP023497_2 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161108-2161137 30 JN192401 Staphylococcus phage vB_SepiS-phiIPLA7, complete genome 21487-21516 6 0.8
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 NC_049455 Shigella phage MK-13, complete genome 93411-93440 7 0.767
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 NC_049509 Salmonella phage P46FS4, complete genome 24777-24806 7 0.767
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 JX181829 Salmonella phage SKML-39, complete genome 21952-21981 7 0.767
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 FJ373894 Shigella phage phiSboM-AG3, complete genome 106053-106082 7 0.767
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 AP014109 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C35-MedDCM-OCT-S34-C78, *** SEQUENCING IN PROGRESS *** 9415-9444 7 0.767
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 MN698240 Pelagibacter phage HTVC026P, complete genome 19235-19264 7 0.767
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 AP014442 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C27A-MedDCM-OCT-S26-C72, *** SEQUENCING IN PROGRESS ***, 7 ordered pieces 27842-27871 7 0.767
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 AP013761 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C27A-MedDCM-OCT-S46-C247, *** SEQUENCING IN PROGRESS *** 770-799 7 0.767
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 MN693267 Marine virus AFVG_25M289, complete genome 33104-33133 7 0.767
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 MN693230 Marine virus AFVG_25M453, complete genome 3618-3647 7 0.767
NZ_CP023497_1 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743140-743169 30 MW057858 Providencia phage PSTCR6, complete genome 12688-12717 7 0.767
NZ_CP023497_1 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743140-743169 30 NC_020909 Octadecabacter arcticus 238 plasmid pOA238_118, complete sequence 15541-15570 7 0.767
NZ_CP023497_1 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743140-743169 30 NC_024208 Lactococcus phage P118, complete genome 28046-28075 7 0.767
NZ_CP023497_1 1.14|743338|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743338-743367 30 NZ_CP014926 Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-2, complete sequence 31766-31795 7 0.767
NZ_CP023497_1 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743404-743433 30 MN480763 Streptococcus salivarius strain YU10 plasmid pSsal-YU10, complete sequence 115970-115999 7 0.767
NZ_CP023497_1 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743404-743433 30 MN693783 Marine virus AFVG_250M207, complete genome 8147-8176 7 0.767
NZ_CP023497_1 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743536-743565 30 MN850571 Escherichia phage nepoznato, complete genome 53713-53742 7 0.767
NZ_CP023497_1 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743536-743565 30 MH160766 Escherichia phage vB_EcoM-Ro121lw, complete genome 12432-12461 7 0.767
NZ_CP023497_1 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743536-743565 30 LR746310 Klebsiella phage vB_KpnM_05F genome assembly, chromosome: 1 49087-49116 7 0.767
NZ_CP023497_1 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743536-743565 30 MN101223 Klebsiella phage KOX10, complete genome 88036-88065 7 0.767
NZ_CP023497_1 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743536-743565 30 MH616963 CrAssphage sp. isolate ctbg_1, complete genome 53225-53254 7 0.767
NZ_CP023497_1 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743536-743565 30 MN693326 Marine virus AFVG_25M108, complete genome 10904-10933 7 0.767
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 MF417889 Uncultured Caudovirales phage clone 10S_14, partial genome 21044-21072 7 0.759
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 MK288021 Bacillus phage pW2, complete genome 42529-42557 7 0.759
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 NZ_CP022984 Bacillus kochii strain BDGP4 plasmid pBkBDGP4A, complete sequence 86716-86744 7 0.759
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 NZ_CP023971 Staphylococcus lugdunensis strain FDAARGOS_381 plasmid unnamed1, complete sequence 9374-9402 7 0.759
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 86641-86669 7 0.759
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 NZ_CP044365 Lactobacillus paracasei strain TD 062 plasmid unnamed4, complete sequence 10310-10338 7 0.759
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 NC_009927 Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence 198565-198593 7 0.759
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 AP013634 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C28-MedDCM-OCT-S42-C185, *** SEQUENCING IN PROGRESS *** 2743-2771 7 0.759
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 AP013632 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C28-MedDCM-OCT-S36-C291, *** SEQUENCING IN PROGRESS *** 3124-3152 7 0.759
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 AP013620 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C28-MedDCM-OCT-S24-C131, *** SEQUENCING IN PROGRESS *** 7798-7826 7 0.759
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 MN693979 Marine virus AFVG_250M571, complete genome 28504-28532 7 0.759
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 MN694171 Marine virus AFVG_250M572, complete genome 25230-25258 7 0.759
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 AP013630 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C28-MedDCM-OCT-S34-C146, *** SEQUENCING IN PROGRESS *** 6099-6127 7 0.759
NZ_CP023497_2 2.1|2160977|29|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2160977-2161005 29 AP019515 Halomonas sulfidaeris ATCC BAA-803 plasmid pBAA-803-A DNA, complete genome 233265-233293 7 0.759
NZ_CP023497_2 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161108-2161137 30 NZ_CP039285 Leptospira interrogans strain FMAS_AW1 plasmid pLiSL2, complete sequence 121390-121419 7 0.767
NZ_CP023497_2 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161108-2161137 30 NZ_CP043040 Leptospira interrogans serovar Hardjo strain L53 plasmid p1 33955-33984 7 0.767
NZ_CP023497_2 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161108-2161137 30 NZ_CP044516 Leptospira interrogans serovar Canicola strain 611 plasmid p2, complete sequence 2550-2579 7 0.767
NZ_CP023497_2 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161108-2161137 30 NC_025197 Leptospira interrogans serovar Canicola strain Gui44 plasmid pGui2, complete sequence 2550-2579 7 0.767
NZ_CP023497_2 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161108-2161137 30 NZ_CP044512 Leptospira interrogans serovar Canicola strain LJ178 plasmid p2, complete sequence 2550-2579 7 0.767
NZ_CP023497_2 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161108-2161137 30 NZ_CP039260 Leptospira interrogans strain FMAS_KW1 plasmid pLiLS1, complete sequence 9824-9853 7 0.767
NZ_CP023497_2 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161108-2161137 30 NZ_CP039286 Leptospira interrogans strain FMAS_AW1 plasmid pLiSL3, complete sequence 4083-4112 7 0.767
NZ_CP023497_2 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161108-2161137 30 NZ_CP039286 Leptospira interrogans strain FMAS_AW1 plasmid pLiSL3, complete sequence 82536-82565 7 0.767
NZ_CP023497_2 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161108-2161137 30 NC_025151 Leptospira interrogans serovar Lai str. 56601 plasmid Laicp, complete sequence 53448-53477 7 0.767
NZ_CP023497_2 2.6|2161306|29|NZ_CP023497|CRISPRCasFinder,CRT 2161306-2161334 29 AP018320 Nostoc sp. HK-01 plasmid plasmid2 DNA, complete genome 307485-307513 7 0.759
NZ_CP023497_1 1.1|742481|30|NZ_CP023497|CRT 742481-742510 30 NZ_LR134427 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 18 15911-15940 8 0.733
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 NC_018141 Legionella pneumophila subsp. pneumophila plasmid pLELO, complete sequence 144461-144490 8 0.733
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 NZ_CP045305 Legionella longbeachae strain B1445CHC plasmid pB1445CHC_150k, complete sequence 9593-9622 8 0.733
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 NZ_CP025492 Legionella sainthelensi strain LA01-117 plasmid pLA01-117_150k, complete sequence 66491-66520 8 0.733
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 NZ_CP021284 Legionella pneumophila subsp. pneumophila strain Allentown 1 (D-7475) plasmid unnamed1, complete sequence 137795-137824 8 0.733
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 NZ_CP042253 Legionella longbeachae strain B3526CHC plasmid pB3526CHC_150k, complete sequence 11781-11810 8 0.733
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 NZ_CP011106 Legionella pneumophila strain L10-023 isolate Ulm plasmid unnamed, complete sequence 134675-134704 8 0.733
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 MT757399 Enterococcus phage AE4_17, complete genome 8821-8850 8 0.733
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 JQ309827 Enterococcus phage vB_Efae230P-4, complete genome 9529-9558 8 0.733
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 MK721198 Enterococcus phage vB_EfaP_Ef7.4, complete genome 8597-8626 8 0.733
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 NC_049939 Enterococcus phage vB_EfaP_Ef7.3, complete genome 9023-9052 8 0.733
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 MT747434 Enterococcus phage ZEF1, complete genome 8816-8845 8 0.733
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 NC_049932 Enterococcus phage vB_EfaP_Ef6.2, complete genome 8476-8505 8 0.733
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 MK721183 Enterococcus phage vB_EfaP_Ef7.2, complete genome 8838-8867 8 0.733
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 NC_049933 Enterococcus phage vB_EfaP_Ef6.3, complete genome 8536-8565 8 0.733
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 LT630001 Enterococcus phage Idefix genome assembly, chromosome: IDF 8604-8633 8 0.733
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 NC_049935 Enterococcus phage vB_EfaP_Efmus4, complete genome 8391-8420 8 0.733
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 MK721195 Enterococcus phage vB_EfaP_Efmus1, complete genome 8588-8617 8 0.733
NZ_CP023497_1 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743140-743169 30 MN694190 Marine virus AFVG_250M608, complete genome 28251-28280 8 0.733
NZ_CP023497_1 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743140-743169 30 MT446392 UNVERIFIED: Escherichia virus TH15, complete genome 126443-126472 8 0.733
NZ_CP023497_1 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743140-743169 30 NC_028957 Enterobacteria phage vB_EcoM_VR26, complete genome 50089-50118 8 0.733
NZ_CP023497_1 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743404-743433 30 MN694108 Marine virus AFVG_250M1116, complete genome 7363-7392 8 0.733
NZ_CP023497_1 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743404-743433 30 MN694607 Marine virus AFVG_250M465, complete genome 7649-7678 8 0.733
NZ_CP023497_1 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743404-743433 30 MN617835 Enterobacter phage prasa_myo, complete genome 116208-116237 8 0.733
NZ_CP023497_1 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743404-743433 30 MG999954 Enterobacter phage myPSH1140, complete genome 116208-116237 8 0.733
NZ_CP023497_1 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743404-743433 30 MN694734 Marine virus AFVG_250M466, complete genome 7723-7752 8 0.733
NZ_CP023497_1 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743404-743433 30 MN694237 Marine virus AFVG_250M414, complete genome 31058-31087 8 0.733
NZ_CP023497_1 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743404-743433 30 MN694635 Marine virus AFVG_250M372, complete genome 31649-31678 8 0.733
NZ_CP023497_1 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743404-743433 30 MN694004 Marine virus AFVG_250M467, complete genome 30880-30909 8 0.733
NZ_CP023497_1 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743536-743565 30 NC_047776 Escherichia phage ESCO5, complete genome 11856-11885 8 0.733
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 NZ_CP042329 Euhalothece natronophila Z-M001 plasmid pEu3, complete sequence 12827-12855 8 0.724
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 NZ_LR215032 Mycoplasma gallopavonis strain NCTC10186 plasmid 2 91015-91043 8 0.724
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 MN693341 Marine virus AFVG_25M304, complete genome 16877-16905 8 0.724
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 KY653124 Staphylococcus phage IME1367_01, complete genome 38857-38885 8 0.724
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 MN693607 Marine virus AFVG_25M305, complete genome 17264-17292 8 0.724
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 MN693326 Marine virus AFVG_25M108, complete genome 490-518 8 0.724
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 MN693326 Marine virus AFVG_25M108, complete genome 28804-28832 8 0.724
NZ_CP023497_1 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743602-743630 29 MH552499 Podoviridae sp. isolate ctcf755, complete genome 6609-6637 8 0.724
NZ_CP023497_1 1.19|743667|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743667-743695 29 MH059636 Erwinia phage Cronus, complete genome 93070-93098 8 0.724
NZ_CP023497_1 1.19|743667|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743667-743695 29 NC_012473 Bacillus cereus 03BB102 plasmid p03BB102_179, complete sequence 11798-11826 8 0.724
NZ_CP023497_1 1.19|743667|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743667-743695 29 NZ_CP009317 Bacillus cereus 03BB102 plasmid unnamed, complete sequence 125097-125125 8 0.724
NZ_CP023497_2 2.2|2161042|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161042-2161071 30 NZ_CP023039 Komagataeibacter saccharivorans strain CV1 plasmid unnamed3, complete sequence 10349-10378 8 0.733
NZ_CP023497_2 2.4|2161174|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT 2161174-2161203 30 NZ_CP016746 Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence 70460-70489 8 0.733
NZ_CP023497_1 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder 742745-742774 30 NZ_CP011513 Paenibacillus peoriae strain HS311 plasmid unnamed, complete sequence 185353-185382 9 0.7
NZ_CP023497_1 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743140-743169 30 MK867354 Synechococcus phage S-SCSM1, complete genome 62652-62681 9 0.7
NZ_CP023497_1 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743404-743433 30 NC_017296 Clostridium acetobutylicum EA 2018 plasmid pEA2018, complete sequence 149126-149155 9 0.7
NZ_CP023497_1 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743404-743433 30 NC_015686 Clostridium acetobutylicum DSM 1731 plasmid pSMBa, complete sequence 149126-149155 9 0.7
NZ_CP023497_1 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743404-743433 30 NC_001988 Clostridium acetobutylicum ATCC 824 plasmid pSOL1, complete sequence 149126-149155 9 0.7
NZ_CP023497_1 1.20|743732|31|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743732-743762 31 NZ_CP010864 Marinovum algicola DG 898 plasmid pMaD9, complete sequence 21785-21815 9 0.71
NZ_CP023497_1 1.20|743732|31|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR 743732-743762 31 NC_029094 Pseudoalteromonas phage H101, complete genome 120532-120562 9 0.71

1. spacer 1.13|743272|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NC_007055 (Staphylococcus phage 37, complete genome) position: , mismatch: 0, identity: 1.0

ttatgcgaggggaagtaactgatcaagagt	CRISPR spacer
ttatgcgaggggaagtaactgatcaagagt	Protospacer
******************************

2. spacer 1.13|743272|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to AY954958 (Bacteriophage 37, complete genome) position: , mismatch: 0, identity: 1.0

ttatgcgaggggaagtaactgatcaagagt	CRISPR spacer
ttatgcgaggggaagtaactgatcaagagt	Protospacer
******************************

3. spacer 1.14|743338|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NC_007055 (Staphylococcus phage 37, complete genome) position: , mismatch: 0, identity: 1.0

aaatcatgatcactattgctaacacctatg	CRISPR spacer
aaatcatgatcactattgctaacacctatg	Protospacer
******************************

4. spacer 1.14|743338|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to AY954958 (Bacteriophage 37, complete genome) position: , mismatch: 0, identity: 1.0

aaatcatgatcactattgctaacacctatg	CRISPR spacer
aaatcatgatcactattgctaacacctatg	Protospacer
******************************

5. spacer 1.19|743667|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NC_007051 (Staphylococcus phage 2638A, complete genome) position: , mismatch: 0, identity: 1.0

ccccgctttggttaaacaagttgaatatg	CRISPR spacer
ccccgctttggttaaacaagttgaatatg	Protospacer
*****************************

6. spacer 1.19|743667|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MK450538 (Staphylococcus phage vB_SpsS_QT1, complete genome) position: , mismatch: 0, identity: 1.0

ccccgctttggttaaacaagttgaatatg	CRISPR spacer
ccccgctttggttaaacaagttgaatatg	Protospacer
*****************************

7. spacer 1.19|743667|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to AY954954 (Bacteriophage 2638A, complete genome) position: , mismatch: 0, identity: 1.0

ccccgctttggttaaacaagttgaatatg	CRISPR spacer
ccccgctttggttaaacaagttgaatatg	Protospacer
*****************************

8. spacer 1.6|742811|30|NZ_CP023497|CRT,CRISPRCasFinder matches to NC_007055 (Staphylococcus phage 37, complete genome) position: , mismatch: 1, identity: 0.967

tacaccaaacgggtagggcgcttcaaatgt	CRISPR spacer
taccccaaacgggtagggcgcttcaaatgt	Protospacer
*** **************************

9. spacer 1.6|742811|30|NZ_CP023497|CRT,CRISPRCasFinder matches to AY954958 (Bacteriophage 37, complete genome) position: , mismatch: 1, identity: 0.967

tacaccaaacgggtagggcgcttcaaatgt	CRISPR spacer
taccccaaacgggtagggcgcttcaaatgt	Protospacer
*** **************************

10. spacer 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NC_007055 (Staphylococcus phage 37, complete genome) position: , mismatch: 1, identity: 0.967

gcttgaaccatttgtagaaaagaaaacttg	CRISPR spacer
gcttgaaccatttgtagaaaagaaaacttc	Protospacer
***************************** 

11. spacer 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to AY954958 (Bacteriophage 37, complete genome) position: , mismatch: 1, identity: 0.967

gcttgaaccatttgtagaaaagaaaacttg	CRISPR spacer
gcttgaaccatttgtagaaaagaaaacttc	Protospacer
***************************** 

12. spacer 1.16|743470|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MF417895 (Uncultured Caudovirales phage clone 10AX_1, partial genome) position: , mismatch: 3, identity: 0.9

acaagtcgtaataccatcctcgacgttcca	CRISPR spacer
ataaatcgtaataccattctcgacgttcca	Protospacer
*.**.************.************

13. spacer 1.16|743470|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NC_028821 (Staphylococcus phage StB20-like, complete genome) position: , mismatch: 3, identity: 0.9

acaagtcgtaataccatcctcgacgttcca	CRISPR spacer
ataaatcgtaataccattctcgacgttcca	Protospacer
*.**.************.************

14. spacer 1.16|743470|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MF417909 (Uncultured Caudovirales phage clone 10F_7, partial genome) position: , mismatch: 3, identity: 0.9

acaagtcgtaataccatcctcgacgttcca	CRISPR spacer
ataaatcgtaataccattctcgacgttcca	Protospacer
*.**.************.************

15. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to KX827371 (Staphylococcus phage SpT99F3, complete genome) position: , mismatch: 3, identity: 0.897

tcctttctcttttaaatattcttcttgat	CRISPR spacer
tcctttctgttttaaatattcttcctgtt	Protospacer
******** ***************.** *

16. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MK075001 (Staphylococcus phage phiSP15-1, complete genome) position: , mismatch: 3, identity: 0.897

tcctttctcttttaaatattcttcttgat	CRISPR spacer
tcctttctgttttaaatattcttcctgtt	Protospacer
******** ***************.** *

17. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MK450538 (Staphylococcus phage vB_SpsS_QT1, complete genome) position: , mismatch: 3, identity: 0.897

tcctttctcttttaaatattcttcttgat	CRISPR spacer
tcctttctgttttaaatattcttcctgtt	Protospacer
******** ***************.** *

18. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MK075004 (Staphylococcus phage phiSP119-1, complete genome) position: , mismatch: 3, identity: 0.897

tcctttctcttttaaatattcttcttgat	CRISPR spacer
tcctttctgttttaaatattcttcctgtt	Protospacer
******** ***************.** *

19. spacer 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to KU598975 (Staphylococcus phage CNPx, complete genome) position: , mismatch: 4, identity: 0.867

atatcaaatgttagatttaggtaagtcaca	CRISPR spacer
gtatcaaatgttggatttaggtaagtatca	Protospacer
.***********.*************  **

20. spacer 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to DQ831957 (Staphylococcus phage CNPH82, complete genome) position: , mismatch: 4, identity: 0.867

atatcaaatgttagatttaggtaagtcaca	CRISPR spacer
gtatcaaatgttggatttaggtaagtatca	Protospacer
.***********.*************  **

21. spacer 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MT774393 (CrAssphage cr127_1, complete genome) position: , mismatch: 5, identity: 0.833

catctatactatcaattaaagttttagata	CRISPR spacer
tatctatactattaattaaagttttaattt	Protospacer
.***********.*************. * 

22. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP039278 (Salmonella enterica subsp. enterica strain 12-0523 plasmid p12-0523.1, complete sequence) position: , mismatch: 5, identity: 0.828

tcctttctcttttaaatattcttcttgat	CRISPR spacer
aactttatcttttaaattttcttcttggt	Protospacer
  **** ********** *********.*

23. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 5, identity: 0.828

tcctttctcttttaaatattcttcttgat	CRISPR spacer
taatttttcttttgaatattcttcttggt	Protospacer
*  ***.******.*************.*

24. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP014865 (Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK1, complete sequence) position: , mismatch: 5, identity: 0.828

tcctttctcttttaaatattcttcttgat	CRISPR spacer
tacattctcttttgaatattcttcttttt	Protospacer
* * *********.************  *

25. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN694034 (Marine virus AFVG_250M807, complete genome) position: , mismatch: 5, identity: 0.828

tcctttctcttttaaatattcttcttgat	CRISPR spacer
ttctatttcttttaaatattcttctttag	Protospacer
*.** *.******************* * 

26. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to AP013500 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C94-MedDCM-OCT-S26-C69) position: , mismatch: 5, identity: 0.828

tcctttctcttttaaatattcttcttgat	CRISPR spacer
ttctttctctattaaatattcttcatcag	Protospacer
*.******** ************* * * 

27. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MK893987 (Staphylococcus phage PMBT8, complete genome) position: , mismatch: 5, identity: 0.828

tcctttctcttttaaatattcttcttgat	CRISPR spacer
tacattctctttcaaatattcttctaaat	Protospacer
* * ********.************ .**

28. spacer 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to JN192400 (Staphylococcus phage vB_SepiS-phiIPLA5, complete genome) position: , mismatch: 5, identity: 0.833

atatcaaatgttagatttaggtaagtcaca	CRISPR spacer
ttatcaaatgctagatttaggtaaatatca	Protospacer
 *********.*************.*  **

29. spacer 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to MK448341 (Streptococcus satellite phage Javan16, complete genome) position: , mismatch: 5, identity: 0.833

atatcaaa-tgttagatttaggtaagtcaca	CRISPR spacer
-tagcgaactgttagatttagataagtcaga	Protospacer
 ** *.** ************.******* *

30. spacer 2.4|2161174|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 5, identity: 0.833

tgaattgggcgtaaaaacatttgatgcatc	CRISPR spacer
tgaattgggcgtaaaaatatttgatagaaa	Protospacer
*****************.*******. *  

31. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to GU943056 (Uncultured phage MedDCM-OCT-S04-C348 genomic sequence) position: , mismatch: 6, identity: 0.8

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
taacattagaaaacacgtagaagataacgg	Protospacer
 **   *********  *************

32. spacer 1.9|743009|30|NZ_CP023497|CRT,CRISPRCasFinder matches to NC_041879 (Bacillus phage Mgbh1, complete genome) position: , mismatch: 6, identity: 0.8

ctttttgttcggataaacacgctcaccttg	CRISPR spacer
ctatcatttcggataaactcgctgaccttg	Protospacer
** *.  *********** **** ******

33. spacer 1.10|743075|29|NZ_CP023497|CRT,CRISPRCasFinder matches to NZ_CP015232 (Epibacterium mobile F1926 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793

aaatcgcttatcactgatattgagttcat	CRISPR spacer
ttatattttatcactgatattgatttcat	Protospacer
  **  .**************** *****

34. spacer 1.10|743075|29|NZ_CP023497|CRT,CRISPRCasFinder matches to NZ_LR027555 (Epibacterium mobile isolate EPIB1 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.793

aaatcgcttatcactgatattgagttcat	CRISPR spacer
ttatattttatcactgatattgatttcat	Protospacer
  **  .**************** *****

35. spacer 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN693421 (Marine virus AFVG_25M197, complete genome) position: , mismatch: 6, identity: 0.8

aaagcactttctttagaagcatttaaaaca	CRISPR spacer
aaaacaatttctttagaagcatttcgagta	Protospacer
***.** ***************** .*..*

36. spacer 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN693283 (Marine virus AFVG_25M198, complete genome) position: , mismatch: 6, identity: 0.8

aaagcactttctttagaagcatttaaaaca	CRISPR spacer
aaaacaatttctttagaagcatttcgagta	Protospacer
***.** ***************** .*..*

37. spacer 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LR214998 (Mycoplasma conjunctivae strain NCTC10147 plasmid 2) position: , mismatch: 6, identity: 0.8

aaagcactttctttagaagcatttaaaaca	CRISPR spacer
aaaaatttctctttagaaacatttaaaaca	Protospacer
***.  .*.*********.***********

38. spacer 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NC_012654 (Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence) position: , mismatch: 6, identity: 0.8

catctatactatcaattaaagttttagata	CRISPR spacer
tttctttactatcaattaaagtttgtgcta	Protospacer
. *** ******************  * **

39. spacer 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP031095 (Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence) position: , mismatch: 6, identity: 0.8

catctatactatcaattaaagttttagata	CRISPR spacer
tttctttactatcaattaaagtttgtgcta	Protospacer
. *** ******************  * **

40. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP018751 (Borreliella garinii strain CIP 103362 isolate 20047 plasmid unnamed4) position: , mismatch: 6, identity: 0.793

tcctttctcttttaaatattcttcttgat	CRISPR spacer
ttttttgtcttttaaatattcttctattt	Protospacer
*..*** ******************   *

41. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP028866 (Borreliella garinii strain 20047 plasmid lp17, complete sequence) position: , mismatch: 6, identity: 0.793

tcctttctcttttaaatattcttcttgat	CRISPR spacer
ttttttgtcttttaaatattcttctattt	Protospacer
*..*** ******************   *

42. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP028876 (Borreliella bavariensis PBi plasmid lp17, complete sequence) position: , mismatch: 6, identity: 0.793

tcctttctcttttaaatattcttcttgat	CRISPR spacer
ttttttgtcttttaaatattcttctattt	Protospacer
*..*** ******************   *

43. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to KY653116 (Staphylococcus phage IME1318_01, complete genome) position: , mismatch: 6, identity: 0.793

tcctttctcttttaaatattcttcttgat	CRISPR spacer
agcaatttcttttaaatattgttcttgat	Protospacer
  *  *.************* ********

44. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP019828 (Leptotrichia shahii strain JCM16776 plasmid JCM16776p1, complete sequence) position: , mismatch: 6, identity: 0.793

tcctttctcttttaaatattcttcttgat	CRISPR spacer
ttttttctcttttaaattttcttcaaaat	Protospacer
*..************** ******  .**

45. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP019824 (Leptotrichia hofstadii strain JCM16775 plasmid pJCM16775-1, complete sequence) position: , mismatch: 6, identity: 0.793

tcctttctcttttaaatattcttcttgat	CRISPR spacer
ttttttctcttttaaattttcttccaaat	Protospacer
*..************** ******. .**

46. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP019836 (Leptotrichia wadei strain JMUB3934 plasmid pJMUB3934p1, complete sequence) position: , mismatch: 6, identity: 0.793

tcctttctcttttaaatattcttcttgat	CRISPR spacer
ttttttctcttttaaattttcttccaaat	Protospacer
*..************** ******. .**

47. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN693898 (Marine virus AFVG_250M937, complete genome) position: , mismatch: 6, identity: 0.793

tcctttctcttttaaatattcttcttgat	CRISPR spacer
tcctttctcttttatataatctttaacat	Protospacer
************** *** ****.   **

48. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MT787017 (UNVERIFIED: Staphylococcus phage WV, complete genome) position: , mismatch: 6, identity: 0.793

tcctttctcttttaaatattcttcttgat	CRISPR spacer
ttgcttctcttttaaatatgcttctcgtt	Protospacer
*. .*************** *****.* *

49. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to KY794643 (Staphylococcus phage vB_Sau_S24, complete genome) position: , mismatch: 6, identity: 0.793

tcctttctcttttaaatattcttcttgat	CRISPR spacer
ttgcttctcttttaaatatgcttctcgtt	Protospacer
*. .*************** *****.* *

50. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to LR215720 (Staphylococcus phage Stab23 genome assembly, chromosome: I) position: , mismatch: 6, identity: 0.793

tcctttctcttttaaatattcttcttgat	CRISPR spacer
ttgcttctcttttaaatatgcttctcgtt	Protospacer
*. .*************** *****.* *

51. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MH552526 (Siphoviridae sp. isolate ctfj46, complete genome) position: , mismatch: 6, identity: 0.793

tcctttctcttttaaatattcttcttgat	CRISPR spacer
cgctctcttttttaaatattcttctcaat	Protospacer
. **.***.****************..**

52. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to KY794642 (Staphylococcus phage vB_Sau_Clo6, complete genome) position: , mismatch: 6, identity: 0.793

tcctttctcttttaaatattcttcttgat	CRISPR spacer
ttgcttctcttttaaatatgcttctcgtt	Protospacer
*. .*************** *****.* *

53. spacer 2.1|2160977|29|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011053 (Halomonas sp. KO116 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.793

tttcctgtatcatgaaacacacaaaactt	CRISPR spacer
cctcctgtctcatgaaatacacaaaacgc	Protospacer
..****** ********.********* .

54. spacer 2.2|2161042|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021407 (Celeribacter manganoxidans strain DY25 plasmid pDY25-C, complete sequence) position: , mismatch: 6, identity: 0.8

tgttagaaagccgatgacatcctccgtaat	CRISPR spacer
taggagacagccgatgacatcctccgtcaa	Protospacer
*.  *** ******************* * 

55. spacer 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to KY653120 (Staphylococcus phage IME1348_01, complete genome) position: , mismatch: 6, identity: 0.8

atatcaaatgttagatttaggtaagtcaca	CRISPR spacer
ctatcaaatgctagatttaggaaaatatca	Protospacer
 *********.********** **.*  **

56. spacer 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to JN192401 (Staphylococcus phage vB_SepiS-phiIPLA7, complete genome) position: , mismatch: 6, identity: 0.8

atatcaaatgttagatttaggtaagtcaca	CRISPR spacer
ctatcaaatgctagatttaggaaaatatca	Protospacer
 *********.********** **.*  **

57. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to NC_049455 (Shigella phage MK-13, complete genome) position: , mismatch: 7, identity: 0.767

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
taagtatagaaaacatttagaggatatgaa	Protospacer
 ************** *****.****  ..

58. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to NC_049509 (Salmonella phage P46FS4, complete genome) position: , mismatch: 7, identity: 0.767

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
taagtatagaaaacatttagaggatatgaa	Protospacer
 ************** *****.****  ..

59. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to JX181829 (Salmonella phage SKML-39, complete genome) position: , mismatch: 7, identity: 0.767

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
taagtatagaaaacatttagaggatatgaa	Protospacer
 ************** *****.****  ..

60. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to FJ373894 (Shigella phage phiSboM-AG3, complete genome) position: , mismatch: 7, identity: 0.767

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
taagtatagaaaacatttagaggatatgaa	Protospacer
 ************** *****.****  ..

61. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to AP014109 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C35-MedDCM-OCT-S34-C78, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
aaagtatataaaagaattagaagatatatt	Protospacer
.******* **** ************    

62. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to MN698240 (Pelagibacter phage HTVC026P, complete genome) position: , mismatch: 7, identity: 0.767

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
tgagtatagaaaagaattagaagaatcagg	Protospacer
 .*********** **********    **

63. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to AP014442 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C27A-MedDCM-OCT-S26-C72, *** SEQUENCING IN PROGRESS ***, 7 ordered pieces) position: , mismatch: 7, identity: 0.767

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
tgagtatagaaaagaattagaagaatcagg	Protospacer
 .*********** **********    **

64. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to AP013761 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C27A-MedDCM-OCT-S46-C247, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
tgagtatagaaaagaattagaagaatcagg	Protospacer
 .*********** **********    **

65. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to MN693267 (Marine virus AFVG_25M289, complete genome) position: , mismatch: 7, identity: 0.767

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
tgaatatagaaaaaaattagaagatgaagt	Protospacer
 .*.********* ***********.* * 

66. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to MN693230 (Marine virus AFVG_25M453, complete genome) position: , mismatch: 7, identity: 0.767

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
tgaagacacaaaacaattagaagatgacgg	Protospacer
 .*. *.* ****************.****

67. spacer 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MW057858 (Providencia phage PSTCR6, complete genome) position: , mismatch: 7, identity: 0.767

aaagcactttctttagaagcatttaaaaca	CRISPR spacer
acgaccatttctttaggagcatgtaaaaca	Protospacer
* ..*  *********.***** *******

68. spacer 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NC_020909 (Octadecabacter arcticus 238 plasmid pOA238_118, complete sequence) position: , mismatch: 7, identity: 0.767

aaagcactttctttagaagcatttaaaaca	CRISPR spacer
atgccaagttgtttagaagcatttaaaact	Protospacer
* . **  ** ****************** 

69. spacer 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NC_024208 (Lactococcus phage P118, complete genome) position: , mismatch: 7, identity: 0.767

aaagcactttctttagaagcatttaaaaca	CRISPR spacer
caaggtatttctttagaaacatttaaaaac	Protospacer
 ***   ***********.*********  

70. spacer 1.14|743338|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP014926 (Lactobacillus paracollinoides strain TMW 1.1995 plasmid pL11995-2, complete sequence) position: , mismatch: 7, identity: 0.767

aaatcatgatcactattgctaacacctatg	CRISPR spacer
caatcataatcacaattgctaacacgcttt	Protospacer
 ******.***** *********** . * 

71. spacer 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN480763 (Streptococcus salivarius strain YU10 plasmid pSsal-YU10, complete sequence) position: , mismatch: 7, identity: 0.767

gcttgaaccatttgtagaaaagaaaacttg	CRISPR spacer
taatgaaccatatgtataaaagaaaacgag	Protospacer
   ******** **** **********  *

72. spacer 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN693783 (Marine virus AFVG_250M207, complete genome) position: , mismatch: 7, identity: 0.767

gcttgaaccatttgtagaaaagaaaacttg	CRISPR spacer
tctttaaccatttgtaaaaaagaacgaatg	Protospacer
 *** ***********.******* .  **

73. spacer 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN850571 (Escherichia phage nepoznato, complete genome) position: , mismatch: 7, identity: 0.767

catctatactatcaattaaagttttagata	CRISPR spacer
atacaatacttacaattaaagttttagatg	Protospacer
   * *****  *****************.

74. spacer 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MH160766 (Escherichia phage vB_EcoM-Ro121lw, complete genome) position: , mismatch: 7, identity: 0.767

catctatactatcaattaaagttttagata	CRISPR spacer
atacaatacttacaattaaagttttagatg	Protospacer
   * *****  *****************.

75. spacer 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to LR746310 (Klebsiella phage vB_KpnM_05F genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.767

catctatactatcaattaaagttttagata	CRISPR spacer
cttcgatactatcaagtaaagttttgattg	Protospacer
* ** ********** *********.. *.

76. spacer 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN101223 (Klebsiella phage KOX10, complete genome) position: , mismatch: 7, identity: 0.767

catctatactatcaattaaagttttagata	CRISPR spacer
cttcgatactatcaagtaaagttttgattg	Protospacer
* ** ********** *********.. *.

77. spacer 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 7, identity: 0.767

catctatactatcaattaaagttttagata	CRISPR spacer
tattaatagtatcaattaaagctttagaag	Protospacer
.**. *** ************.****** .

78. spacer 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN693326 (Marine virus AFVG_25M108, complete genome) position: , mismatch: 7, identity: 0.767

catctatactatcaattaaagttttagata	CRISPR spacer
tttttacactatcaattaaagtttttacta	Protospacer
. *.**.****************** . **

79. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MF417889 (Uncultured Caudovirales phage clone 10S_14, partial genome) position: , mismatch: 7, identity: 0.759

tcctttctcttttaaatattcttcttgat	CRISPR spacer
attattttcttttaaatattcttcttgtg	Protospacer
 .. **.********************  

80. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MK288021 (Bacillus phage pW2, complete genome) position: , mismatch: 7, identity: 0.759

tcctttctcttttaaatattcttcttgat	CRISPR spacer
ttctttcttttttaaatattcttcactcg	Protospacer
*.******.*************** .   

81. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022984 (Bacillus kochii strain BDGP4 plasmid pBkBDGP4A, complete sequence) position: , mismatch: 7, identity: 0.759

tcctttctcttttaaatattcttcttgat	CRISPR spacer
tattctctcttttaaataatcttcttttg	Protospacer
* .*.************* *******   

82. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP023971 (Staphylococcus lugdunensis strain FDAARGOS_381 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

tcctttctcttttaaatattcttcttgat	CRISPR spacer
aaatttctcttttcaatattattcttcct	Protospacer
   ********** ****** *****  *

83. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 7, identity: 0.759

tcctttctcttttaaatattcttcttgat--	CRISPR spacer
atttttctcttttaaatattc--ctcgacca	Protospacer
 ..******************  **.**.  

84. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP044365 (Lactobacillus paracasei strain TD 062 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.759

tcctttctcttttaaatattcttcttgat	CRISPR spacer
cgctttctctgttacatattcttctctaa	Protospacer
. ******** *** **********. * 

85. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NC_009927 (Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence) position: , mismatch: 7, identity: 0.759

tcctttctcttttaaatattcttcttgat	CRISPR spacer
acctttctcttttaaataatcctcgattt	Protospacer
 ***************** **.**    *

86. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to AP013634 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C28-MedDCM-OCT-S42-C185, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.759

tcctttctcttttaaatattcttcttgat	CRISPR spacer
acctttctcttttctatattcttcaagtg	Protospacer
 ************  *********  *  

87. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to AP013632 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C28-MedDCM-OCT-S36-C291, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.759

tcctttctcttttaaatattcttcttgat	CRISPR spacer
acctttctcttttctatattcttcaagtg	Protospacer
 ************  *********  *  

88. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to AP013620 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C28-MedDCM-OCT-S24-C131, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.759

tcctttctcttttaaatattcttcttgat	CRISPR spacer
acctttctcttttctatattcttcaagtg	Protospacer
 ************  *********  *  

89. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN693979 (Marine virus AFVG_250M571, complete genome) position: , mismatch: 7, identity: 0.759

tcctttctcttttaaatattcttcttgat	CRISPR spacer
ttcaaaagcttttaaatattcttctggat	Protospacer
*.*     ***************** ***

90. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN694171 (Marine virus AFVG_250M572, complete genome) position: , mismatch: 7, identity: 0.759

tcctttctcttttaaatattcttcttgat	CRISPR spacer
ttcaaaagcttttaaatattcttctggat	Protospacer
*.*     ***************** ***

91. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to AP013630 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C28-MedDCM-OCT-S34-C146, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.759

tcctttctcttttaaatattcttcttgat	CRISPR spacer
acctttctcttttctatattcttcaagtg	Protospacer
 ************  *********  *  

92. spacer 2.1|2160977|29|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to AP019515 (Halomonas sulfidaeris ATCC BAA-803 plasmid pBAA-803-A DNA, complete genome) position: , mismatch: 7, identity: 0.759

tttcctgtatcatgaaacacacaaaactt	CRISPR spacer
ccgcctgtctcatgaaatacacaaaacgc	Protospacer
.. ***** ********.********* .

93. spacer 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039285 (Leptospira interrogans strain FMAS_AW1 plasmid pLiSL2, complete sequence) position: , mismatch: 7, identity: 0.767

atatcaaatgttagatttaggtaagtcaca	CRISPR spacer
ggatcaaattttagatttaggtaaaacatt	Protospacer
. ******* **************. **. 

94. spacer 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043040 (Leptospira interrogans serovar Hardjo strain L53 plasmid p1) position: , mismatch: 7, identity: 0.767

atatcaaatgttagatttaggtaagtcaca	CRISPR spacer
ggatcaaattttagatttaggtaaaacatt	Protospacer
. ******* **************. **. 

95. spacer 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044516 (Leptospira interrogans serovar Canicola strain 611 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

atatcaaatgttagatttaggtaagtcaca	CRISPR spacer
ggatcaaattttagatttaggtaaaacatt	Protospacer
. ******* **************. **. 

96. spacer 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to NC_025197 (Leptospira interrogans serovar Canicola strain Gui44 plasmid pGui2, complete sequence) position: , mismatch: 7, identity: 0.767

atatcaaatgttagatttaggtaagtcaca	CRISPR spacer
ggatcaaattttagatttaggtaaaacatt	Protospacer
. ******* **************. **. 

97. spacer 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044512 (Leptospira interrogans serovar Canicola strain LJ178 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

atatcaaatgttagatttaggtaagtcaca	CRISPR spacer
ggatcaaattttagatttaggtaaaacatt	Protospacer
. ******* **************. **. 

98. spacer 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039260 (Leptospira interrogans strain FMAS_KW1 plasmid pLiLS1, complete sequence) position: , mismatch: 7, identity: 0.767

atatcaaatgttagatttaggtaagtcaca	CRISPR spacer
ggatcaaattttagatttaggtaaaacatt	Protospacer
. ******* **************. **. 

99. spacer 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039286 (Leptospira interrogans strain FMAS_AW1 plasmid pLiSL3, complete sequence) position: , mismatch: 7, identity: 0.767

atatcaaatgttagatttaggtaagtcaca	CRISPR spacer
ggatcaaattttagatttaggtaaaacatt	Protospacer
. ******* **************. **. 

100. spacer 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039286 (Leptospira interrogans strain FMAS_AW1 plasmid pLiSL3, complete sequence) position: , mismatch: 7, identity: 0.767

atatcaaatgttagatttaggtaagtcaca	CRISPR spacer
ggatcaaattttagatttaggtaaaacatt	Protospacer
. ******* **************. **. 

101. spacer 2.3|2161108|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to NC_025151 (Leptospira interrogans serovar Lai str. 56601 plasmid Laicp, complete sequence) position: , mismatch: 7, identity: 0.767

atatcaaatgttagatttaggtaagtcaca	CRISPR spacer
ggatcaaattttagatttaggtaaaacatt	Protospacer
. ******* **************. **. 

102. spacer 2.6|2161306|29|NZ_CP023497|CRISPRCasFinder,CRT matches to AP018320 (Nostoc sp. HK-01 plasmid plasmid2 DNA, complete genome) position: , mismatch: 7, identity: 0.759

taatctcgattttcgctttgttgtcacta	CRISPR spacer
cgatctcgattttcgcttgcttgtcccac	Protospacer
..****************  ***** *  

103. spacer 1.1|742481|30|NZ_CP023497|CRT matches to NZ_LR134427 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 18) position: , mismatch: 8, identity: 0.733

ttgccatacgatttgtattgatattacttt	CRISPR spacer
cgtccataggaattgtattgatattaatgg	Protospacer
.  ***** ** ************** *  

104. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to NC_018141 (Legionella pneumophila subsp. pneumophila plasmid pLELO, complete sequence) position: , mismatch: 8, identity: 0.733

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
ttagtatagaaaacaataagatgattgcct	Protospacer
  *************** *** *** .*  

105. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to NZ_CP045305 (Legionella longbeachae strain B1445CHC plasmid pB1445CHC_150k, complete sequence) position: , mismatch: 8, identity: 0.733

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
ttagtatagaaaacaataagatgattgcct	Protospacer
  *************** *** *** .*  

106. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to NZ_CP025492 (Legionella sainthelensi strain LA01-117 plasmid pLA01-117_150k, complete sequence) position: , mismatch: 8, identity: 0.733

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
ttagtatagaaaacaataagatgattgcct	Protospacer
  *************** *** *** .*  

107. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to NZ_CP021284 (Legionella pneumophila subsp. pneumophila strain Allentown 1 (D-7475) plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
ttagtatagaaaacaataagatgattgcct	Protospacer
  *************** *** *** .*  

108. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to NZ_CP042253 (Legionella longbeachae strain B3526CHC plasmid pB3526CHC_150k, complete sequence) position: , mismatch: 8, identity: 0.733

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
ttagtatagaaaacaataagatgattgcct	Protospacer
  *************** *** *** .*  

109. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to NZ_CP011106 (Legionella pneumophila strain L10-023 isolate Ulm plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
ttagtatagaaaacaataagatgattgcct	Protospacer
  *************** *** *** .*  

110. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to MT757399 (Enterococcus phage AE4_17, complete genome) position: , mismatch: 8, identity: 0.733

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
gataattagaaaacaattagaaaataaatt	Protospacer
** .  ****************.****   

111. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to JQ309827 (Enterococcus phage vB_Efae230P-4, complete genome) position: , mismatch: 8, identity: 0.733

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
gataattagaaaacaattagaaaataaatt	Protospacer
** .  ****************.****   

112. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to MK721198 (Enterococcus phage vB_EfaP_Ef7.4, complete genome) position: , mismatch: 8, identity: 0.733

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
gataattagaaaacaattagaaaataaatt	Protospacer
** .  ****************.****   

113. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to NC_049939 (Enterococcus phage vB_EfaP_Ef7.3, complete genome) position: , mismatch: 8, identity: 0.733

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
gataattagaaaacaattagaaaataaatt	Protospacer
** .  ****************.****   

114. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to MT747434 (Enterococcus phage ZEF1, complete genome) position: , mismatch: 8, identity: 0.733

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
gataattagaaaacaattagaaaataaatt	Protospacer
** .  ****************.****   

115. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to NC_049932 (Enterococcus phage vB_EfaP_Ef6.2, complete genome) position: , mismatch: 8, identity: 0.733

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
gataattagaaaacaattagaaaataaatt	Protospacer
** .  ****************.****   

116. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to MK721183 (Enterococcus phage vB_EfaP_Ef7.2, complete genome) position: , mismatch: 8, identity: 0.733

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
gataattagaaaacaattagaaaataaatt	Protospacer
** .  ****************.****   

117. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to NC_049933 (Enterococcus phage vB_EfaP_Ef6.3, complete genome) position: , mismatch: 8, identity: 0.733

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
gataattagaaaacaattagaaaataaatt	Protospacer
** .  ****************.****   

118. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to LT630001 (Enterococcus phage Idefix genome assembly, chromosome: IDF) position: , mismatch: 8, identity: 0.733

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
gataattagaaaacaattagaaaataaatt	Protospacer
** .  ****************.****   

119. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to NC_049935 (Enterococcus phage vB_EfaP_Efmus4, complete genome) position: , mismatch: 8, identity: 0.733

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
gataattagaaaacaattagaaaataaatt	Protospacer
** .  ****************.****   

120. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to MK721195 (Enterococcus phage vB_EfaP_Efmus1, complete genome) position: , mismatch: 8, identity: 0.733

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
gataattagaaaacaattagaaaataaatt	Protospacer
** .  ****************.****   

121. spacer 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN694190 (Marine virus AFVG_250M608, complete genome) position: , mismatch: 8, identity: 0.733

aaagcactttctttagaagcatttaaaaca	CRISPR spacer
cattggatttctttagaagaatttaaaaaa	Protospacer
 *   . ************ ******** *

122. spacer 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MT446392 (UNVERIFIED: Escherichia virus TH15, complete genome) position: , mismatch: 8, identity: 0.733

aaagcactttctttagaagcatttaaaaca	CRISPR spacer
actaatttttctttagaaccatttaaatca	Protospacer
*  .  .*********** ******** **

123. spacer 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NC_028957 (Enterobacteria phage vB_EcoM_VR26, complete genome) position: , mismatch: 8, identity: 0.733

aaagcactttctttagaagcatttaaaaca	CRISPR spacer
actaatttttctttagaaccatttaaatca	Protospacer
*  .  .*********** ******** **

124. spacer 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN694108 (Marine virus AFVG_250M1116, complete genome) position: , mismatch: 8, identity: 0.733

gcttgaaccatttgtagaaaagaaaacttg	CRISPR spacer
tgttaaaccatttatagaaaagaaaaacac	Protospacer
  **.********.************ .  

125. spacer 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN694607 (Marine virus AFVG_250M465, complete genome) position: , mismatch: 8, identity: 0.733

gcttgaaccatttgtagaaaagaaaacttg	CRISPR spacer
tgttaaaccatttatagaaaagaaaaacac	Protospacer
  **.********.************ .  

126. spacer 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN617835 (Enterobacter phage prasa_myo, complete genome) position: , mismatch: 8, identity: 0.733

gcttgaaccatttgtagaaaagaaaacttg	CRISPR spacer
tgagaaaccatttttagaaaagaatacttt	Protospacer
    .******** ********** **** 

127. spacer 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MG999954 (Enterobacter phage myPSH1140, complete genome) position: , mismatch: 8, identity: 0.733

gcttgaaccatttgtagaaaagaaaacttg	CRISPR spacer
tgagaaaccatttttagaaaagaatacttt	Protospacer
    .******** ********** **** 

128. spacer 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN694734 (Marine virus AFVG_250M466, complete genome) position: , mismatch: 8, identity: 0.733

gcttgaaccatttgtagaaaagaaaacttg	CRISPR spacer
tgttaaaccatttatagaaaagaaaaacac	Protospacer
  **.********.************ .  

129. spacer 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN694237 (Marine virus AFVG_250M414, complete genome) position: , mismatch: 8, identity: 0.733

gcttgaaccatttgtagaaaagaaaacttg	CRISPR spacer
tgttaaaccatttatagaaaagaaaaacac	Protospacer
  **.********.************ .  

130. spacer 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN694635 (Marine virus AFVG_250M372, complete genome) position: , mismatch: 8, identity: 0.733

gcttgaaccatttgtagaaaagaaaacttg	CRISPR spacer
tgttaaaccatttatagaaaagaaaaacac	Protospacer
  **.********.************ .  

131. spacer 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN694004 (Marine virus AFVG_250M467, complete genome) position: , mismatch: 8, identity: 0.733

gcttgaaccatttgtagaaaagaaaacttg	CRISPR spacer
tgttaaaccatttatagaaaagaaaaacac	Protospacer
  **.********.************ .  

132. spacer 1.17|743536|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NC_047776 (Escherichia phage ESCO5, complete genome) position: , mismatch: 8, identity: 0.733

catctatactatcaattaaagttttagata	CRISPR spacer
atacagtacttacaattaaagttttagatg	Protospacer
   * .****  *****************.

133. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP042329 (Euhalothece natronophila Z-M001 plasmid pEu3, complete sequence) position: , mismatch: 8, identity: 0.724

tcctttctcttttaaatattcttcttgat	CRISPR spacer
atctttctcttttaaatattgttgaaaac	Protospacer
 .****************** **   .*.

134. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 8, identity: 0.724

tcctttctcttttaaatattcttcttgat	CRISPR spacer
gaaattctcttttaaatagacttcttgtg	Protospacer
    **************  *******  

135. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN693341 (Marine virus AFVG_25M304, complete genome) position: , mismatch: 8, identity: 0.724

tcctttctcttttaaatattcttcttgat	CRISPR spacer
agttttctcctttaaataatcttcttatc	Protospacer
  .******.******** *******. .

136. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to KY653124 (Staphylococcus phage IME1367_01, complete genome) position: , mismatch: 8, identity: 0.724

tcctttctcttttaaatattcttcttgat	CRISPR spacer
attattttcttttaagtattcttcttgtg	Protospacer
 .. **.********.***********  

137. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN693607 (Marine virus AFVG_25M305, complete genome) position: , mismatch: 8, identity: 0.724

tcctttctcttttaaatattcttcttgat	CRISPR spacer
agttttctcctttaaataatcttcttatc	Protospacer
  .******.******** *******. .

138. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN693326 (Marine virus AFVG_25M108, complete genome) position: , mismatch: 8, identity: 0.724

tcctttctcttttaaatattcttcttgat	CRISPR spacer
aaaatcaccttttgaatattcttcttgat	Protospacer
    *. .*****.***************

139. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MN693326 (Marine virus AFVG_25M108, complete genome) position: , mismatch: 8, identity: 0.724

tcctttctcttttaaatattcttcttgat	CRISPR spacer
aaaatcaccttttgaatattcttcttgat	Protospacer
    *. .*****.***************

140. spacer 1.18|743602|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MH552499 (Podoviridae sp. isolate ctcf755, complete genome) position: , mismatch: 8, identity: 0.724

tcctttctcttttaaatattcttcttgat	CRISPR spacer
attttttacttttaaatattcttctttta	Protospacer
 ..***. ******************   

141. spacer 1.19|743667|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MH059636 (Erwinia phage Cronus, complete genome) position: , mismatch: 8, identity: 0.724

ccccgctttggttaaacaagttgaatatg	CRISPR spacer
aagttctttggctaaacaagttgaatagt	Protospacer
   . ******.***************  

142. spacer 1.19|743667|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NC_012473 (Bacillus cereus 03BB102 plasmid p03BB102_179, complete sequence) position: , mismatch: 8, identity: 0.724

ccccgctttggttaaacaagttgaatatg	CRISPR spacer
tgagattttggttgaacaaattgaatatg	Protospacer
.   ..*******.*****.*********

143. spacer 1.19|743667|29|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009317 (Bacillus cereus 03BB102 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

ccccgctttggttaaacaagttgaatatg	CRISPR spacer
tgagattttggttgaacaaattgaatatg	Protospacer
.   ..*******.*****.*********

144. spacer 2.2|2161042|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023039 (Komagataeibacter saccharivorans strain CV1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733

tgttagaaagccgatgacatcctcc-gtaat	CRISPR spacer
ccgaagaaaggcgatgacatcctcctgtcg-	Protospacer
.   ****** ************** ** . 

145. spacer 2.4|2161174|30|NZ_CP023497|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016746 (Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence) position: , mismatch: 8, identity: 0.733

tgaattgggcgtaaaaacatttgatgcatc	CRISPR spacer
tcaattgagcgtaaaaacattttattttat	Protospacer
* *****.************** ** .  .

146. spacer 1.5|742745|30|NZ_CP023497|CRT,CRISPRCasFinder matches to NZ_CP011513 (Paenibacillus peoriae strain HS311 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

gaagtatagaaaacaattagaagataacgg	CRISPR spacer
tagaactagaaaacaatcagaagataagaa	Protospacer
 *..  ***********.********* ..

147. spacer 1.11|743140|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to MK867354 (Synechococcus phage S-SCSM1, complete genome) position: , mismatch: 9, identity: 0.7

aaagcactttctttagaagcatttaaaaca	CRISPR spacer
tcaagactttctttataagcatttaatttt	Protospacer
  *. ********** **********  . 

148. spacer 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NC_017296 (Clostridium acetobutylicum EA 2018 plasmid pEA2018, complete sequence) position: , mismatch: 9, identity: 0.7

gcttgaaccatttgtagaaaagaaaacttg	CRISPR spacer
agttgaaccttttttagaaaagaaacaaga	Protospacer
. ******* *** ***********    .

149. spacer 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NC_015686 (Clostridium acetobutylicum DSM 1731 plasmid pSMBa, complete sequence) position: , mismatch: 9, identity: 0.7

gcttgaaccatttgtagaaaagaaaacttg	CRISPR spacer
agttgaaccttttttagaaaagaaacaaga	Protospacer
. ******* *** ***********    .

150. spacer 1.15|743404|30|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NC_001988 (Clostridium acetobutylicum ATCC 824 plasmid pSOL1, complete sequence) position: , mismatch: 9, identity: 0.7

gcttgaaccatttgtagaaaagaaaacttg	CRISPR spacer
agttgaaccttttttagaaaagaaacaaga	Protospacer
. ******* *** ***********    .

151. spacer 1.20|743732|31|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP010864 (Marinovum algicola DG 898 plasmid pMaD9, complete sequence) position: , mismatch: 9, identity: 0.71

tgaaggggatatcaacttcaacgccgccgtc	CRISPR spacer
gatcggggatatcaacctcgacgccgccagg	Protospacer
 .  ************.**.********.  

152. spacer 1.20|743732|31|NZ_CP023497|CRT,CRISPRCasFinder,PILER-CR matches to NC_029094 (Pseudoalteromonas phage H101, complete genome) position: , mismatch: 9, identity: 0.71

tgaaggggatatcaacttcaacgccgccgtc	CRISPR spacer
tgaagaggatctcaacttcaacgagttgggt	Protospacer
*****.**** ************   . * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 53136 : 87502 35 Staphylococcus_phage(92.59%) tRNA NA
DBSCAN-SWA_2 168262 : 225578 62 Staphylococcus_phage(53.85%) tRNA,terminase,head,protease,integrase,portal,tail,capsid attL 209732:209749|attR 223636:223653
DBSCAN-SWA_3 616444 : 646088 27 Mycoplasma_phage(33.33%) protease,holin NA
DBSCAN-SWA_4 1686210 : 1696330 8 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_5 1738831 : 1753318 18 Staphylococcus_phage(76.92%) terminase,head,protease,integrase,transposase,portal,tail,capsid attL 1733815:1733829|attR 1756786:1756800
DBSCAN-SWA_6 1793364 : 1841465 66 Staphylococcus_phage(55.56%) terminase,head,holin,protease,integrase,transposase,portal,tail,capsid attL 1792681:1792696|attR 1817100:1817115
DBSCAN-SWA_7 2039470 : 2047892 9 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_8 2614556 : 2624630 7 Klosneuvirus(33.33%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage