Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_AP017619 Escherichia coli strain MRY15-117 plasmid pMRY15-117_2, complete sequence 0 crisprs NA 0 0 0 0
NZ_AP017618 Escherichia coli strain MRY15-117 plasmid pMRY15-117_1, complete sequence 0 crisprs csa3 0 0 1 0
NZ_AP017617 Escherichia coli strain MRY15-117 2 crisprs c2c9_V-U4,DinG,DEDDh,cas3,csa3,WYL,RT,PD-DExK 0 2 9 0

Results visualization

1. NZ_AP017618
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6769 : 43165 43 Escherichia_phage(36.36%) integrase,transposase attL 6718:6777|attR 19193:20012
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_AP017617
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017617_1 1540833-1540956 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_AP017617_2 2151077-2151168 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_AP017617_2 2.1|2151103|40|NZ_AP017617|CRISPRCasFinder 2151103-2151142 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_AP017617_1 1.1|1540876|38|NZ_AP017617|CRISPRCasFinder 1540876-1540913 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947

1. spacer 2.1|2151103|40|NZ_AP017617|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 1.1|1540876|38|NZ_AP017617|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 542482 : 600935 75 Enterobacteria_phage(47.27%) head,capsid,tRNA,terminase,lysis,holin,tail,portal,protease,integrase attL 552633:552679|attR 601358:601404
DBSCAN-SWA_2 954968 : 964410 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_3 1076554 : 1087812 10 Acanthocystis_turfacea_Chlorella_virus(25.0%) NA NA
DBSCAN-SWA_4 1132854 : 1244517 89 uncultured_Caudovirales_phage(33.33%) transposase,plate,integrase attL 1128453:1128512|attR 1246334:1246349
DBSCAN-SWA_5 2540261 : 2553189 6 Escherichia_phage(83.33%) integrase attL 2545764:2545777|attR 2554234:2554247
DBSCAN-SWA_6 3196880 : 3205806 6 Stx2-converting_phage(66.67%) transposase NA
DBSCAN-SWA_7 3273695 : 3332975 55 Pseudomonas_phage(45.45%) transposase,protease,integrase attL 3272883:3272898|attR 3345100:3345115
DBSCAN-SWA_8 4140414 : 4145068 6 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_9 4646525 : 4663017 22 Burkholderia_phage(33.33%) plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage