Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023375 Escherichia coli strain 1283 plasmid p7, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP023372 Escherichia coli strain 1283 plasmid p109, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP023376 Escherichia coli strain 1283 plasmid p92, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP023373 Escherichia coli strain 1283 plasmid p31, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP023371 Escherichia coli strain 1283 chromosome, complete genome 7 crisprs csa3,PD-DExK,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,c2c9_V-U4,RT,DinG 0 14 6 0
NZ_CP023374 Escherichia coli strain 1283 plasmid p3, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP023372
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 53987 : 85331 31 Stx2-converting_phage(28.57%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP023371
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023371_1 1025116-1025511 Orphan I-E
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023371_2 1051837-1052414 TypeI-E I-E
9 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023371_3 1544566-1544683 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023371_4 2153220-2153343 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023371_5 2777406-2777497 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023371_6 3072801-3072945 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023371_7 3321477-3321573 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023371_5 5.1|2777432|40|NZ_CP023371|CRISPRCasFinder 2777432-2777471 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
NZ_CP023371_4 4.1|2153263|38|NZ_CP023371|CRISPRCasFinder 2153263-2153300 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
NZ_CP023371_2 2.3|1051988|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1051988-1052019 32 NC_021229 Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919 65474-65505 5 0.844
NZ_CP023371_1 1.9|1025268|31|NZ_CP023371|CRISPRCasFinder 1025268-1025298 31 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755174-755204 6 0.806
NZ_CP023371_1 1.9|1025268|31|NZ_CP023371|CRISPRCasFinder 1025268-1025298 31 MH067970 Arthrobacter sp. strain ANT_H40 plasmid pA40H1, complete sequence 47826-47856 6 0.806
NZ_CP023371_2 2.3|1051988|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1051988-1052019 32 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 208287-208318 6 0.812
NZ_CP023371_1 1.12|1025451|31|NZ_CP023371|CRISPRCasFinder 1025451-1025481 31 MG945629 UNVERIFIED: Microviridae sp. isolate 6200-1602, complete genome 4209-4239 7 0.774
NZ_CP023371_1 1.12|1025451|31|NZ_CP023371|CRISPRCasFinder 1025451-1025481 31 MK814759 Gordonia phage Reyja, complete genome 4468-4498 7 0.774
NZ_CP023371_2 2.4|1052049|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1052049-1052080 32 MK416018 Klebsiella phage ST147-VIM1phi7.1, complete genome 24790-24821 7 0.781
NZ_CP023371_2 2.5|1052110|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1052110-1052141 32 MF351863 Synechococcus phage Bellamy, complete genome 123998-124029 7 0.781
NZ_CP023371_1 1.3|1025266|33|NZ_CP023371|PILER-CR,CRT 1025266-1025298 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755172-755204 8 0.758
NZ_CP023371_1 1.9|1025268|31|NZ_CP023371|CRISPRCasFinder 1025268-1025298 31 NZ_CP007070 Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence 191920-191950 8 0.742
NZ_CP023371_1 1.11|1025390|31|NZ_CP023371|CRISPRCasFinder 1025390-1025420 31 NZ_CP033579 Vibrio mediterranei strain 117-T6 plasmid unnamed, complete sequence 47369-47399 8 0.742
NZ_CP023371_2 2.3|1051988|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1051988-1052019 32 MK113951 Phage 5P_3, complete genome 11967-11998 8 0.75
NZ_CP023371_2 2.3|1051988|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1051988-1052019 32 AP017924 Ralstonia phage RP12 DNA, complete genome 11643-11674 8 0.75
NZ_CP023371_2 2.9|1052354|32|NZ_CP023371|CRISPRCasFinder,CRT 1052354-1052385 32 NZ_AP018516 Acetobacter orientalis strain FAN1 plasmid pAOF1, complete sequence 48296-48327 8 0.75
NZ_CP023371_1 1.7|1025146|31|NZ_CP023371|CRISPRCasFinder 1025146-1025176 31 NC_007959 Nitrobacter hamburgensis X14 plasmid 1, complete sequence 246574-246604 9 0.71
NZ_CP023371_1 1.8|1025207|31|NZ_CP023371|CRISPRCasFinder 1025207-1025237 31 MF158039 Shigella phage Sf12, complete genome 4976-5006 9 0.71
NZ_CP023371_1 1.8|1025207|31|NZ_CP023371|CRISPRCasFinder 1025207-1025237 31 MF158042 Shigella phage Sd1, complete genome 939-969 9 0.71
NZ_CP023371_2 2.4|1052049|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1052049-1052080 32 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 1143591-1143622 9 0.719
NZ_CP023371_2 2.4|1052049|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1052049-1052080 32 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 891493-891524 9 0.719
NZ_CP023371_2 2.4|1052049|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1052049-1052080 32 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 1143594-1143625 9 0.719
NZ_CP023371_2 2.4|1052049|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1052049-1052080 32 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 315030-315061 9 0.719
NZ_CP023371_2 2.4|1052049|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1052049-1052080 32 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 1123532-1123563 9 0.719
NZ_CP023371_1 1.8|1025207|31|NZ_CP023371|CRISPRCasFinder 1025207-1025237 31 MT840185 Bacteriophage sp. Joined_contig_19 genomic sequence 64310-64340 10 0.677
NZ_CP023371_1 1.8|1025207|31|NZ_CP023371|CRISPRCasFinder 1025207-1025237 31 KF356199 Microcystis phage MaMV-DC, complete genome 50157-50187 10 0.677
NZ_CP023371_1 1.8|1025207|31|NZ_CP023371|CRISPRCasFinder 1025207-1025237 31 NC_008562 Microcystis phage Ma-LMM01 DNA, complete genome 44744-44774 10 0.677
NZ_CP023371_2 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1051927-1051958 32 NZ_CP028970 Aminobacter sp. MSH1 plasmid pUSP2, complete sequence 156123-156154 10 0.688
NZ_CP023371_2 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1051927-1051958 32 NZ_CP053984 Achromobacter pestifer strain FDAARGOS_790 plasmid unnamed, complete sequence 21888-21919 10 0.688
NZ_CP023371_2 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1051927-1051958 32 NC_010935 Comamonas testosteroni CNB-1 plasmid pCNB, complete sequence 28766-28797 10 0.688
NZ_CP023371_2 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1051927-1051958 32 JX469826 Uncultured bacterium plasmid pB12, complete sequence 11283-11314 10 0.688
NZ_CP023371_2 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1051927-1051958 32 JN106171 Uncultured bacterium plasmid pAKD26, complete sequence 11289-11320 10 0.688
NZ_CP023371_2 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1051927-1051958 32 NC_016968 Comamonas testosteroni plasmid pTB30, complete sequence 11287-11318 10 0.688
NZ_CP023371_2 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1051927-1051958 32 NC_016978 Comamonas testosteroni plasmid pI2, complete sequence 11272-11303 10 0.688
NZ_CP023371_2 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1051927-1051958 32 NZ_CP017760 Cupriavidus necator strain NH9 plasmid pENH91, complete sequence 67078-67109 10 0.688
NZ_CP023371_2 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1051927-1051958 32 NZ_CP053554 Diaphorobacter sp. JS3050 plasmid pDCNB, complete sequence 4235-4266 10 0.688
NZ_CP023371_2 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1051927-1051958 32 NC_019263 Delftia acidovorans plasmid pLME1, complete sequence 11288-11319 10 0.688
NZ_CP023371_2 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1051927-1051958 32 NC_019264 Delftia acidovorans plasmid pNB8c, complete sequence 11288-11319 10 0.688
NZ_CP023371_2 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1051927-1051958 32 NC_019283 Delftia acidovorans plasmid pC1-1, complete sequence 11288-11319 10 0.688
NZ_CP023371_2 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1051927-1051958 32 NC_006830 Achromobacter xylosoxidans A8 plasmid pA81, complete sequence 11350-11381 10 0.688
NZ_CP023371_2 2.3|1051988|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT 1051988-1052019 32 NC_002580 Propionibacterium freudenreichii plasmid p545, complete sequence 2898-2929 10 0.688
NZ_CP023371_1 1.2|1025205|33|NZ_CP023371|PILER-CR,CRT 1025205-1025237 33 MF158039 Shigella phage Sf12, complete genome 4974-5006 11 0.667
NZ_CP023371_1 1.2|1025205|33|NZ_CP023371|PILER-CR,CRT 1025205-1025237 33 MF158042 Shigella phage Sd1, complete genome 937-969 11 0.667

1. spacer 5.1|2777432|40|NZ_CP023371|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 4.1|2153263|38|NZ_CP023371|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 2.3|1051988|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NC_021229 (Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919) position: , mismatch: 5, identity: 0.844

-ctgctggagctggctgcaaggcaagccgccca	CRISPR spacer
tccgctcg-gcaggctgcaacgcaagccgccca	Protospacer
 *.*** * ** ******** ************

4. spacer 1.9|1025268|31|NZ_CP023371|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.806

cgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
cgtggtcgtgggtgctgctgttgctggagcg	Protospacer
*******.**************** *.. *.

5. spacer 1.9|1025268|31|NZ_CP023371|CRISPRCasFinder matches to MH067970 (Arthrobacter sp. strain ANT_H40 plasmid pA40H1, complete sequence) position: , mismatch: 6, identity: 0.806

cgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
cgtggtcaagggtgctgctgttcccacgcct	Protospacer
******** ************* * . *** 

6. spacer 2.3|1051988|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 6, identity: 0.812

-ctgctggagctggctgcaaggcaagccgccca	CRISPR spacer
tccgctcg-gcaggctgcaacgcaagccgcccc	Protospacer
 *.*** * ** ******** *********** 

7. spacer 1.12|1025451|31|NZ_CP023371|CRISPRCasFinder matches to MG945629 (UNVERIFIED: Microviridae sp. isolate 6200-1602, complete genome) position: , mismatch: 7, identity: 0.774

agcctgacgagactactgaggccgttctgtc	CRISPR spacer
aaaaggccaagactactgaggccgttcagtc	Protospacer
*.   * *.****************** ***

8. spacer 1.12|1025451|31|NZ_CP023371|CRISPRCasFinder matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 7, identity: 0.774

agcctgacgagactactgaggccgttctgtc-	CRISPR spacer
agcctgacgaggctactggggcca-gcggtgg	Protospacer
***********.******.****.  * **  

9. spacer 2.4|1052049|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to MK416018 (Klebsiella phage ST147-VIM1phi7.1, complete genome) position: , mismatch: 7, identity: 0.781

cccaccagcgcgttttttgccggggccatagt	CRISPR spacer
cccatcagcgcgttttttggcggtgtgatgga	Protospacer
****.************** *** *. **.* 

10. spacer 2.5|1052110|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to MF351863 (Synechococcus phage Bellamy, complete genome) position: , mismatch: 7, identity: 0.781

ttgaactcaccacgattgttaatatggacgat	CRISPR spacer
aaggtatcaccacgattgttgatatgggcgat	Protospacer
  *.  **************.******.****

11. spacer 1.3|1025266|33|NZ_CP023371|PILER-CR,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758

gacgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
tccgtggtcgtgggtgctgctgttgctggagcg	Protospacer
  *******.**************** *.. *.

12. spacer 1.9|1025268|31|NZ_CP023371|CRISPRCasFinder matches to NZ_CP007070 (Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

cgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
tgcggtcatggatgctgatgttgcagtgatg	Protospacer
.*.********.***** ******** * ..

13. spacer 1.11|1025390|31|NZ_CP023371|CRISPRCasFinder matches to NZ_CP033579 (Vibrio mediterranei strain 117-T6 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

atagcaatagtccatagatttgcgaaaacag	CRISPR spacer
aggtttgtagtccattgatttgcgaaaactg	Protospacer
* . . .******** ************* *

14. spacer 2.3|1051988|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to MK113951 (Phage 5P_3, complete genome) position: , mismatch: 8, identity: 0.75

ctgctggagctggctgcaaggcaagccgccca	CRISPR spacer
gagcatcggctggctgcaaggcaagctgcccc	Protospacer
  **   .******************.**** 

15. spacer 2.3|1051988|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to AP017924 (Ralstonia phage RP12 DNA, complete genome) position: , mismatch: 8, identity: 0.75

ctgctggagctggctgcaaggcaagccgccca	CRISPR spacer
gcggaagcgctggctgcacggcaagcggccca	Protospacer
 .*  .* ********** ******* *****

16. spacer 2.9|1052354|32|NZ_CP023371|CRISPRCasFinder,CRT matches to NZ_AP018516 (Acetobacter orientalis strain FAN1 plasmid pAOF1, complete sequence) position: , mismatch: 8, identity: 0.75

gcaacgacggtgagatttcacgcctgacgctg	CRISPR spacer
tcaacgacggtaagatgtcacgcctaaagaat	Protospacer
 **********.**** ********.* *   

17. spacer 1.7|1025146|31|NZ_CP023371|CRISPRCasFinder matches to NC_007959 (Nitrobacter hamburgensis X14 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.71

caaaaaccgggcaatcgcaaaaaggcgtaat	CRISPR spacer
aaaaaaccgcccaatcgcaaaaagatgacga	Protospacer
 ********  *************..*  . 

18. spacer 1.8|1025207|31|NZ_CP023371|CRISPRCasFinder matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 9, identity: 0.71

tgtttgcggcattaacgctcaccagtatttc	CRISPR spacer
tgtttgcagcattaacgctccccaagtgccg	Protospacer
*******.************ ***.   .. 

19. spacer 1.8|1025207|31|NZ_CP023371|CRISPRCasFinder matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 9, identity: 0.71

tgtttgcggcattaacgctcaccagtatttc	CRISPR spacer
tgtttgcagcattaacgctctccaagtgccg	Protospacer
*******.************ ***.   .. 

20. spacer 2.4|1052049|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 9, identity: 0.719

cccaccagcgcgttttttgccggggccatagt	CRISPR spacer
gccacccgcgctttttttgccgggccggatat	Protospacer
 ***** **** ************ * .  .*

21. spacer 2.4|1052049|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 9, identity: 0.719

cccaccagcgcgttttttgccggggccatagt	CRISPR spacer
gccacccgcgctttttttgccgggccggatat	Protospacer
 ***** **** ************ * .  .*

22. spacer 2.4|1052049|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 9, identity: 0.719

cccaccagcgcgttttttgccggggccatagt	CRISPR spacer
gccacccgcgctttttttgccgggccggatat	Protospacer
 ***** **** ************ * .  .*

23. spacer 2.4|1052049|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 9, identity: 0.719

cccaccagcgcgttttttgccggggccatagt	CRISPR spacer
gccacccgcgctttttttgccgggccggatat	Protospacer
 ***** **** ************ * .  .*

24. spacer 2.4|1052049|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 9, identity: 0.719

cccaccagcgcgttttttgccggggccatagt	CRISPR spacer
gccacccgcgctttttttgccgggccggatat	Protospacer
 ***** **** ************ * .  .*

25. spacer 1.8|1025207|31|NZ_CP023371|CRISPRCasFinder matches to MT840185 (Bacteriophage sp. Joined_contig_19 genomic sequence) position: , mismatch: 10, identity: 0.677

tgtttgcggcattaacgctcaccagtatttc	CRISPR spacer
gtgcggcggcattaatgctcacaagtatggt	Protospacer
   . **********.****** *****  .

26. spacer 1.8|1025207|31|NZ_CP023371|CRISPRCasFinder matches to KF356199 (Microcystis phage MaMV-DC, complete genome) position: , mismatch: 10, identity: 0.677

tgtttgcggcattaacgctcaccagtatttc	CRISPR spacer
gtgcggcggcattaatgctcacaagtatggt	Protospacer
   . **********.****** *****  .

27. spacer 1.8|1025207|31|NZ_CP023371|CRISPRCasFinder matches to NC_008562 (Microcystis phage Ma-LMM01 DNA, complete genome) position: , mismatch: 10, identity: 0.677

tgtttgcggcattaacgctcaccagtatttc	CRISPR spacer
gtgcggcggcattaatgctcacaagtatggt	Protospacer
   . **********.****** *****  .

28. spacer 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
acgtcaccccggaagcgattgccagcacacgc	Protospacer
.  ********.*** **********  .* .

29. spacer 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053984 (Achromobacter pestifer strain FDAARGOS_790 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

30. spacer 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NC_010935 (Comamonas testosteroni CNB-1 plasmid pCNB, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

31. spacer 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to JX469826 (Uncultured bacterium plasmid pB12, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

32. spacer 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to JN106171 (Uncultured bacterium plasmid pAKD26, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

33. spacer 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NC_016968 (Comamonas testosteroni plasmid pTB30, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

34. spacer 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NC_016978 (Comamonas testosteroni plasmid pI2, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

35. spacer 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017760 (Cupriavidus necator strain NH9 plasmid pENH91, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

36. spacer 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053554 (Diaphorobacter sp. JS3050 plasmid pDCNB, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

37. spacer 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NC_019263 (Delftia acidovorans plasmid pLME1, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

38. spacer 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NC_019264 (Delftia acidovorans plasmid pNB8c, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

39. spacer 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NC_019283 (Delftia acidovorans plasmid pC1-1, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

40. spacer 2.2|1051927|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NC_006830 (Achromobacter xylosoxidans A8 plasmid pA81, complete sequence) position: , mismatch: 10, identity: 0.688

gactcaccccgaaagagattgccagccagctt	CRISPR spacer
aggtactgacgaatgagaatgccagccagctt	Protospacer
.. *  .  **** **** *************

41. spacer 2.3|1051988|32|NZ_CP023371|PILER-CR,CRISPRCasFinder,CRT matches to NC_002580 (Propionibacterium freudenreichii plasmid p545, complete sequence) position: , mismatch: 10, identity: 0.688

ctgctggagctggctgcaaggcaagccgccca	CRISPR spacer
ccctgagagctggctgccacgcaagccgctgg	Protospacer
*. . .*********** * *********. .

42. spacer 1.2|1025205|33|NZ_CP023371|PILER-CR,CRT matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 11, identity: 0.667

tgtgtttgcggcattaacgctcaccagtatttc	CRISPR spacer
attgtttgcagcattaacgctccccaagtgccg	Protospacer
  *******.************ ***.   .. 

43. spacer 1.2|1025205|33|NZ_CP023371|PILER-CR,CRT matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 11, identity: 0.667

tgtgtttgcggcattaacgctcaccagtatttc	CRISPR spacer
attgtttgcagcattaacgctctccaagtgccg	Protospacer
  *******.************ ***.   .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1059840 : 1073023 12 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_2 1673247 : 1683465 11 Enterobacteria_phage(75.0%) transposase NA
DBSCAN-SWA_3 1779454 : 1787335 7 Escherichia_phage(42.86%) transposase NA
DBSCAN-SWA_4 2904131 : 2989892 88 Salmonella_phage(60.0%) lysis,tRNA,portal,capsid,terminase,plate,tail,head,protease,integrase attL 2897094:2897109|attR 2992463:2992478
DBSCAN-SWA_5 3533604 : 3646660 110 Enterobacteria_phage(40.68%) lysis,portal,capsid,terminase,tail,holin,head,integrase attL 3594971:3595017|attR 3642758:3642804
DBSCAN-SWA_6 3656794 : 3723386 56 uncultured_Caudovirales_phage(20.0%) transposase,tRNA,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage