Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP022382 Capnocytophaga canimorsus strain 7120 chromosome, complete genome 4 crisprs WYL,cas2,cas1,cas9,DEDDh,PD-DExK,cas3 2 0 178 0

Results visualization

1. NZ_CP022382
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022382_1 101657-101768 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022382_2 285611-285802 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022382_3 1519194-1519285 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022382_4 1911174-1911372 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP022382_2 2.2|285725|61|NZ_CP022382|PILER-CR 285725-285785 61 NZ_CP022382.1 284025-284085 1 0.984
NZ_CP022382_4 4.1|1911226|29|NZ_CP022382|PILER-CR 1911226-1911254 29 NZ_CP022382.1 1911373-1911401 2 0.931

1. spacer 2.2|285725|61|NZ_CP022382|PILER-CR matches to position: 284025-284085, mismatch: 1, identity: 0.984

aaaacaggattttgataacaattcaattttataactttatgattttaagatgtttgatga	CRISPR spacer
aaaacaggattttgataacaattcaattttataactttatgattttaagatgtttgatga	Protospacer
************************************************************

2. spacer 4.1|1911226|29|NZ_CP022382|PILER-CR matches to position: 1911373-1911401, mismatch: 2, identity: 0.931

aagaattcaacggatgtcctgatactgac	CRISPR spacer
aacaattcaacggatgtcctgacactgac	Protospacer
** *******************.******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 15320 10 Salmonella_phage(33.33%) NA NA
DBSCAN-SWA_2 21709 : 25764 3 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_3 32014 : 36499 4 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_4 40397 : 41081 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_5 60015 : 61089 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_6 69669 : 70404 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_7 76464 : 79457 3 Aureococcus_anophage(50.0%) NA NA
DBSCAN-SWA_8 83549 : 87386 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_9 123384 : 124578 1 Shearwaterpox_virus(100.0%) NA NA
DBSCAN-SWA_10 127889 : 130700 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_11 138490 : 141385 2 Organic_Lake_phycodnavirus(50.0%) NA NA
DBSCAN-SWA_12 160946 : 162446 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_13 168952 : 169333 1 Clostridium_phage(100.0%) NA NA
DBSCAN-SWA_14 173270 : 175547 2 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_15 198936 : 200559 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_16 205095 : 207440 2 Klebsiella_phage(50.0%) NA NA
DBSCAN-SWA_17 218691 : 221743 2 uncultured_Mediterranean_phage(50.0%) NA NA
DBSCAN-SWA_18 226180 : 243456 9 Saccharomonospora_phage(20.0%) NA NA
DBSCAN-SWA_19 255712 : 259961 4 Moraxella_phage(33.33%) tRNA NA
DBSCAN-SWA_20 265389 : 266274 1 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_21 269385 : 272069 2 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_22 282558 : 283977 1 Liberibacter_phage(100.0%) NA NA
DBSCAN-SWA_23 287401 : 288205 1 Erysipelothrix_phage(100.0%) integrase attL 273826:273840|attR 290469:290483
DBSCAN-SWA_24 306166 : 310066 4 Streptococcus_virus(50.0%) NA NA
DBSCAN-SWA_25 314898 : 318142 3 Diadromus_pulchellus_ascovirus(50.0%) tRNA NA
DBSCAN-SWA_26 324567 : 325839 1 uncultured_Mediterranean_phage(100.0%) tRNA NA
DBSCAN-SWA_27 335368 : 335767 1 Human_gut_gokushovirus(100.0%) NA NA
DBSCAN-SWA_28 345133 : 351558 7 Aeromonas_phage(33.33%) NA NA
DBSCAN-SWA_29 356858 : 357722 1 Cyanophage(100.0%) NA NA
DBSCAN-SWA_30 360939 : 370149 7 Pandoravirus(25.0%) protease NA
DBSCAN-SWA_31 376037 : 381885 5 Flavobacterium_phage(25.0%) NA NA
DBSCAN-SWA_32 385108 : 386214 2 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_33 391843 : 399779 8 Bodo_saltans_virus(25.0%) tRNA NA
DBSCAN-SWA_34 419053 : 430463 9 Staphylococcus_phage(14.29%) NA NA
DBSCAN-SWA_35 433541 : 435815 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_36 457224 : 461058 3 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_37 506360 : 509731 3 Brevibacillus_phage(50.0%) NA NA
DBSCAN-SWA_38 513256 : 514171 1 Phaeocystis_globosa_virus(100.0%) NA NA
DBSCAN-SWA_39 532739 : 534479 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_40 537666 : 540195 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_41 545346 : 549476 3 Paramecium_bursaria_Chlorella_virus(33.33%) tRNA NA
DBSCAN-SWA_42 555312 : 558798 4 Heterosigma_akashiwo_virus(50.0%) NA NA
DBSCAN-SWA_43 561813 : 563901 1 Moraxella_phage(100.0%) protease,tail NA
DBSCAN-SWA_44 573084 : 573483 1 Bordetella_phage(100.0%) NA NA
DBSCAN-SWA_45 589201 : 589855 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_46 600484 : 602290 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_47 629932 : 630565 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_48 642830 : 643886 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_49 653775 : 654804 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_50 666209 : 671504 3 Aeromonas_phage(50.0%) tRNA NA
DBSCAN-SWA_51 674859 : 675792 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_52 688946 : 690581 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_53 696403 : 697360 1 Erwinia_phage(100.0%) NA NA
DBSCAN-SWA_54 701709 : 702651 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_55 715407 : 721553 4 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_56 738924 : 747161 5 Staphylococcus_phage(33.33%) integrase,transposase NA
DBSCAN-SWA_57 751706 : 755234 3 Cyanophage(50.0%) NA NA
DBSCAN-SWA_58 778434 : 779802 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_59 784681 : 789446 5 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_60 794137 : 814878 23 Streptococcus_phage(20.0%) integrase NA
DBSCAN-SWA_61 819533 : 821497 2 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_62 837668 : 843094 2 Saimiriine_herpesvirus(50.0%) NA NA
DBSCAN-SWA_63 848406 : 849147 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_64 862051 : 863821 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_65 891881 : 892574 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_66 904856 : 908903 3 Ralstonia_phage(50.0%) NA NA
DBSCAN-SWA_67 915058 : 916951 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_68 929337 : 931728 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_69 944161 : 944986 1 Pandoravirus(100.0%) NA NA
DBSCAN-SWA_70 955293 : 956397 1 Geobacillus_phage(100.0%) NA NA
DBSCAN-SWA_71 960316 : 962107 1 Cronobacter_phage(100.0%) NA NA
DBSCAN-SWA_72 965762 : 978410 9 Phaeocystis_globosa_virus(25.0%) NA NA
DBSCAN-SWA_73 986664 : 987099 1 Insectomime_virus(100.0%) NA NA
DBSCAN-SWA_74 998943 : 1006781 6 Bacillus_phage(75.0%) tRNA NA
DBSCAN-SWA_75 1010325 : 1012982 3 Leptospira_phage(33.33%) NA NA
DBSCAN-SWA_76 1017321 : 1018086 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_77 1026445 : 1034643 3 Norovirus(33.33%) NA NA
DBSCAN-SWA_78 1039288 : 1040575 1 Arthrobacter_phage(100.0%) NA NA
DBSCAN-SWA_79 1046155 : 1050978 3 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_80 1058718 : 1059840 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_81 1068140 : 1070195 1 Indivirus(100.0%) tRNA NA
DBSCAN-SWA_82 1074912 : 1075392 1 Tetraselmis_virus(100.0%) NA NA
DBSCAN-SWA_83 1081100 : 1086901 6 Pike_perch_iridovirus(33.33%) NA NA
DBSCAN-SWA_84 1098318 : 1098708 1 uncultured_marine_virus(100.0%) NA NA
DBSCAN-SWA_85 1107864 : 1110114 1 unidentified_phage(100.0%) NA NA
DBSCAN-SWA_86 1113229 : 1118296 3 Aureococcus_anophage(50.0%) tRNA NA
DBSCAN-SWA_87 1123441 : 1128648 3 Tupanvirus(50.0%) tRNA NA
DBSCAN-SWA_88 1158181 : 1172046 10 Bacillus_virus(16.67%) tRNA NA
DBSCAN-SWA_89 1191156 : 1192188 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_90 1196609 : 1199210 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_91 1202585 : 1203323 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_92 1208705 : 1209950 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_93 1227090 : 1228311 1 environmental_halophage(100.0%) NA NA
DBSCAN-SWA_94 1235548 : 1236826 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_95 1241415 : 1242372 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_96 1246706 : 1252128 5 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_97 1255916 : 1267825 10 Hokovirus(25.0%) NA NA
DBSCAN-SWA_98 1280998 : 1282018 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_99 1292877 : 1295289 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_100 1301802 : 1303770 1 Flavobacterium_phage(100.0%) NA NA
DBSCAN-SWA_101 1308712 : 1322721 11 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_102 1326299 : 1330290 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_103 1334788 : 1337415 2 Singapore_grouper_iridovirus(50.0%) NA NA
DBSCAN-SWA_104 1348481 : 1353522 6 Clostridium_phage(33.33%) NA NA
DBSCAN-SWA_105 1407375 : 1408908 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_106 1418712 : 1422927 4 Bacillus_virus(50.0%) transposase NA
DBSCAN-SWA_107 1431830 : 1432778 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_108 1448157 : 1449399 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_109 1452664 : 1454041 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_110 1494698 : 1505476 11 Acanthocystis_turfacea_Chlorella_virus(25.0%) NA NA
DBSCAN-SWA_111 1511154 : 1511751 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_112 1514894 : 1522998 5 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_113 1527060 : 1529583 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_114 1540706 : 1543745 1 Norovirus(100.0%) NA NA
DBSCAN-SWA_115 1557686 : 1558805 1 Tenacibaculum_phage(100.0%) NA NA
DBSCAN-SWA_116 1564691 : 1566440 1 Tupanvirus(100.0%) tRNA NA
DBSCAN-SWA_117 1588823 : 1589819 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_118 1593837 : 1595971 2 Serratia_phage(50.0%) tRNA NA
DBSCAN-SWA_119 1605333 : 1606116 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_120 1610606 : 1611281 1 Vibriophage(100.0%) NA NA
DBSCAN-SWA_121 1620932 : 1621664 1 Sphingomonas_phage(100.0%) NA NA
DBSCAN-SWA_122 1626608 : 1628831 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_123 1637022 : 1641050 4 Cellulophaga_phage(33.33%) NA NA
DBSCAN-SWA_124 1661446 : 1662703 1 Phage_TP(100.0%) NA NA
DBSCAN-SWA_125 1676329 : 1677274 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_126 1693432 : 1694419 1 Wolbachia_phage(100.0%) NA NA
DBSCAN-SWA_127 1711447 : 1715792 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_128 1720583 : 1722200 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_129 1725340 : 1727414 2 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_130 1746261 : 1746750 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_131 1752912 : 1756772 5 Croceibacter_phage(33.33%) tRNA NA
DBSCAN-SWA_132 1761538 : 1767184 6 Escherichia_phage(33.33%) tRNA NA
DBSCAN-SWA_133 1793818 : 1800815 8 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_134 1812311 : 1813136 1 Deep-sea_thermophilic_phage(100.0%) NA NA
DBSCAN-SWA_135 1829421 : 1830402 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_136 1842881 : 1846358 1 Orpheovirus(100.0%) tRNA NA
DBSCAN-SWA_137 1860647 : 1861328 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_138 1871022 : 1877632 5 Microcystis_phage(50.0%) tRNA NA
DBSCAN-SWA_139 1885039 : 1885330 1 Sodalis_phage(100.0%) NA NA
DBSCAN-SWA_140 1892585 : 1900553 7 Yellowstone_lake_phycodnavirus(25.0%) NA NA
DBSCAN-SWA_141 1904140 : 1904668 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_142 1908005 : 1910463 2 Streptococcus_phage(50.0%) NA NA
DBSCAN-SWA_143 1918738 : 1925315 7 Staphylococcus_phage(25.0%) tRNA NA
DBSCAN-SWA_144 1929755 : 1930538 1 Sulfolobus_monocaudavirus(100.0%) NA NA
DBSCAN-SWA_145 1933781 : 1941725 7 Agrobacterium_phage(33.33%) NA NA
DBSCAN-SWA_146 1945577 : 1948406 1 Cafeteria_roenbergensis_virus(100.0%) NA NA
DBSCAN-SWA_147 1955657 : 1961132 1 Norovirus(100.0%) NA NA
DBSCAN-SWA_148 2015900 : 2018538 3 Catovirus(50.0%) tRNA NA
DBSCAN-SWA_149 2026924 : 2030678 2 Hokovirus(50.0%) tRNA NA
DBSCAN-SWA_150 2036702 : 2037155 1 Streptococcus_virus(100.0%) NA NA
DBSCAN-SWA_151 2051264 : 2051858 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_152 2075155 : 2076659 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_153 2080610 : 2082494 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_154 2088424 : 2094068 5 Murmansk_poxvirus(50.0%) NA NA
DBSCAN-SWA_155 2110101 : 2116226 5 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_156 2132854 : 2134831 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_157 2141865 : 2144499 1 Catovirus(100.0%) tRNA NA
DBSCAN-SWA_158 2157869 : 2160632 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_159 2171031 : 2175034 2 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_160 2184126 : 2184786 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_161 2194238 : 2196783 2 Tupanvirus(50.0%) tRNA NA
DBSCAN-SWA_162 2201094 : 2205941 5 Choristoneura_biennis_entomopoxvirus(33.33%) NA NA
DBSCAN-SWA_163 2216099 : 2216810 1 Kaumoebavirus(100.0%) NA NA
DBSCAN-SWA_164 2229697 : 2230351 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_165 2242607 : 2248664 3 Ostreococcus_lucimarinus_virus(50.0%) tRNA NA
DBSCAN-SWA_166 2252696 : 2254106 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_167 2259819 : 2260962 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_168 2268919 : 2275932 7 Cellulophaga_phage(50.0%) integrase attL 2264331:2264345|attR 2282874:2282888
DBSCAN-SWA_169 2279718 : 2281119 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_170 2303107 : 2304667 1 Escherichia_virus(100.0%) NA NA
DBSCAN-SWA_171 2313976 : 2314390 1 Ostreococcus_mediterraneus_virus(100.0%) NA NA
DBSCAN-SWA_172 2333096 : 2335040 2 Agrobacterium_phage(50.0%) protease NA
DBSCAN-SWA_173 2353445 : 2357613 4 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_174 2363615 : 2364788 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_175 2386737 : 2389457 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_176 2395259 : 2396192 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_177 2400197 : 2405690 4 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_178 2410059 : 2411886 1 Wolbachia_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage