Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 3 crisprs csa3,RT 0 3 142 0
NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 1 crisprs DEDDh 0 1 1 0
NZ_CP019485 Sinorhizobium meliloti strain B401 chromosome, complete genome 3 crisprs WYL,cas3,csa3 1 0 3 0

Results visualization

1. NZ_CP019484
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019484_1 1225631-1225733 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019484_2 1225826-1225907 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019484_3 1226006-1226110 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 651661-651708 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1085079-1085126 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1053905-1053952 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 636655-636702 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1151301-1151348 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 233702-233749 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 644720-644767 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 634529-634576 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 655818-655865 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1302457-1302504 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 895953-896000 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 772699-772746 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 558706-558753 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 292156-292203 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1423320-1423367 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 373071-373118 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 795261-795308 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 658334-658381 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1225658-1225705 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 998341-998388 0 1.0
NZ_CP019484_1 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder 1225658-1225705 48 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1085084-1085131 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1085274-1085300 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1054100-1054126 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1151496-1151522 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 656013-656039 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 772894-772920 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 292351-292377 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 373266-373292 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1225853-1225879 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 998536-998562 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1085279-1085305 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 651487-651513 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 636481-636507 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 233528-233554 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 644546-644572 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 634355-634381 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1302283-1302309 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 895779-895805 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 558532-558558 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1423146-1423172 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 795087-795113 0 1.0
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 658160-658186 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 651283-651333 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 636277-636327 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 233324-233374 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 644342-644392 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 634151-634201 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1302079-1302129 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 895575-895625 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 558328-558378 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1422942-1422992 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 794883-794933 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 657956-658006 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1085454-1085504 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1151676-1151726 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 773074-773124 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 292531-292581 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 373446-373496 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1226033-1226083 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 998716-998766 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1085459-1085509 0 1.0
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1054280-1054330 1 0.98
NZ_CP019484_3 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder 1226033-1226083 51 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 656190-656240 1 0.98
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 778651-778677 5 0.815
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 405901-405927 5 0.815
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP049043 Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_6, complete sequence 43383-43409 5 0.815
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 MN585980 Microbacterium phage Gina, complete genome 24050-24076 5 0.815
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 MN586059 Microbacterium phage Teamocil, complete genome 24149-24175 5 0.815
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 341978-342004 6 0.778
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 339070-339096 6 0.778
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 345316-345342 6 0.778
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 353491-353517 6 0.778
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 339070-339096 6 0.778
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 562461-562487 6 0.778
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 MK279840 Mycobacterium phage JacoRen57, complete genome 26434-26460 7 0.741
NZ_CP019484_2 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder 1225853-1225879 27 NZ_CP015090 Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence 75369-75395 7 0.741

1. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

2. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

3. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

4. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

5. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

6. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

7. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

8. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

9. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

10. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

11. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

12. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

13. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

14. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

15. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

16. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

17. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

18. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

19. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

20. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

21. spacer 1.1|1225658|48|NZ_CP019484|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

22. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

23. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

24. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

25. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

26. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

27. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

28. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

29. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

30. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

31. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

32. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

33. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

34. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

35. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

36. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

37. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

38. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

39. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

40. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

41. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

42. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

43. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

44. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

45. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

46. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

47. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

48. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

49. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

50. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

51. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

52. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

53. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

54. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

55. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

56. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

57. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

58. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

59. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

60. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

61. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

62. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 1, identity: 0.98

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagtacagccacacgatcgatctcg	Protospacer
*****************************.*********************

63. spacer 3.1|1226033|51|NZ_CP019484|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 1, identity: 0.98

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagtacagccacacgatcgatctcg	Protospacer
*****************************.*********************

64. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.815

acggttccgacgaggcggcgggcagga	CRISPR spacer
tggaatccgacgaggcggcgggcacga	Protospacer
  *. ******************* **

65. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

acggttccgacgaggcggcgggcagga	CRISPR spacer
cggcttccggcgtggcggcgggcagga	Protospacer
  * *****.** **************

66. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP049043 (Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_6, complete sequence) position: , mismatch: 5, identity: 0.815

acggttccgacgaggcggcgggcagga	CRISPR spacer
gccgttccgagaaggcggcgggcaggt	Protospacer
.* ******* .************** 

67. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to MN585980 (Microbacterium phage Gina, complete genome) position: , mismatch: 5, identity: 0.815

acggttccgacgaggcggcgggcagga	CRISPR spacer
gcggctccgtcgaggcggcgggcacca	Protospacer
.***.**** **************  *

68. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to MN586059 (Microbacterium phage Teamocil, complete genome) position: , mismatch: 5, identity: 0.815

acggttccgacgaggcggcgggcagga	CRISPR spacer
gcggctccgtcgaggcggcgggcacca	Protospacer
.***.**** **************  *

69. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 6, identity: 0.778

acggttccgacgaggcggcgggcagga	CRISPR spacer
tcggtttcgccgaggcggcgggcaaat	Protospacer
 *****.** **************.. 

70. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 6, identity: 0.778

acggttccgacgaggcggcgggcagga	CRISPR spacer
tcggtttcgccgaggcggcgggcaaat	Protospacer
 *****.** **************.. 

71. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 6, identity: 0.778

acggttccgacgaggcggcgggcagga	CRISPR spacer
tcggtttcgccgaggcggcgggcaaat	Protospacer
 *****.** **************.. 

72. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 6, identity: 0.778

acggttccgacgaggcggcgggcagga	CRISPR spacer
tcggtttcgccgaggcggcgggcaaat	Protospacer
 *****.** **************.. 

73. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 6, identity: 0.778

acggttccgacgaggcggcgggcagga	CRISPR spacer
tcggtttcgccgaggcggcgggcaaat	Protospacer
 *****.** **************.. 

74. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 6, identity: 0.778

acggttccgacgaggcggcgggcagga	CRISPR spacer
tcggtttcgccgaggcggcgggcaaat	Protospacer
 *****.** **************.. 

75. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to MK279840 (Mycobacterium phage JacoRen57, complete genome) position: , mismatch: 7, identity: 0.741

acggttccgacgaggcggcgggcagga	CRISPR spacer
gtacgcccgacgaggcggcggtcagga	Protospacer
...  .*************** *****

76. spacer 2.1|1225853|27|NZ_CP019484|CRISPRCasFinder matches to NZ_CP015090 (Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence) position: , mismatch: 7, identity: 0.741

acggttccgacgaggcggcgggcagga	CRISPR spacer
ttggttccggcgaggcggcgggcgtag	Protospacer
 .*******.*************. ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 8612 7 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_2 13417 : 16962 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_3 19987 : 27651 8 Sinorhizobium_phage(33.33%) NA NA
DBSCAN-SWA_4 43094 : 43646 1 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_5 48169 : 49711 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_6 53263 : 56080 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_7 59890 : 60568 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_8 66598 : 67633 1 Hokovirus(100.0%) NA NA
DBSCAN-SWA_9 70784 : 73944 3 Micromonas_pusilla_virus(33.33%) NA NA
DBSCAN-SWA_10 83837 : 84572 1 Streptomyces_phage(100.0%) NA NA
DBSCAN-SWA_11 87764 : 89282 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_12 102343 : 105944 3 Lake_Baikal_phage(33.33%) NA NA
DBSCAN-SWA_13 109264 : 111980 3 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_14 119755 : 120562 1 Brazilian_cedratvirus(100.0%) NA NA
DBSCAN-SWA_15 135115 : 143504 7 Ochrobactrum_phage(40.0%) NA NA
DBSCAN-SWA_16 149530 : 157362 4 Hokovirus(100.0%) NA NA
DBSCAN-SWA_17 168918 : 170442 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_18 176056 : 177142 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_19 182353 : 183376 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_20 198377 : 200048 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_21 212382 : 215714 2 Vaccinia_virus(50.0%) NA NA
DBSCAN-SWA_22 219534 : 234223 11 Tupanvirus(16.67%) NA NA
DBSCAN-SWA_23 264741 : 268412 3 Ochrobactrum_phage(66.67%) NA NA
DBSCAN-SWA_24 272667 : 273495 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_25 282093 : 282894 1 Paramecium_bursaria_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_26 289852 : 291340 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_27 306321 : 308298 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_28 312971 : 314789 1 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_29 331913 : 335407 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_30 342711 : 346572 4 Escherichia_phage(66.67%) NA NA
DBSCAN-SWA_31 353261 : 358705 4 Acinetobacter_phage(66.67%) NA NA
DBSCAN-SWA_32 364576 : 366223 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_33 380519 : 385000 3 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_34 391744 : 399301 7 Hokovirus(33.33%) NA NA
DBSCAN-SWA_35 402625 : 403156 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_36 409765 : 411114 2 Bacillus_virus(50.0%) NA NA
DBSCAN-SWA_37 414198 : 415134 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_38 421126 : 422176 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_39 427096 : 427810 1 Mollivirus(100.0%) NA NA
DBSCAN-SWA_40 436022 : 438124 2 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_41 450285 : 454006 5 Mycoplasma_phage(50.0%) NA NA
DBSCAN-SWA_42 458505 : 460730 2 Acanthocystis_turfacea_Chlorella_virus(50.0%) NA NA
DBSCAN-SWA_43 465003 : 466107 1 Stenotrophomonas_phage(100.0%) NA NA
DBSCAN-SWA_44 480477 : 481200 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_45 493793 : 496412 2 Lactococcus_phage(50.0%) NA NA
DBSCAN-SWA_46 520484 : 521431 1 Leptospira_phage(100.0%) transposase NA
DBSCAN-SWA_47 528634 : 530221 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_48 541005 : 542034 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_49 545182 : 550099 5 Tetraselmis_virus(33.33%) NA NA
DBSCAN-SWA_50 558242 : 558701 1 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_51 567934 : 569485 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_52 574382 : 584147 8 Hokovirus(20.0%) NA NA
DBSCAN-SWA_53 592346 : 593027 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_54 599678 : 602144 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_55 610698 : 623404 11 Acinetobacter_phage(33.33%) NA NA
DBSCAN-SWA_56 634543 : 638919 4 Mycoplasma_phage(50.0%) NA NA
DBSCAN-SWA_57 642850 : 643636 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_58 656721 : 660968 3 Megavirus(50.0%) NA NA
DBSCAN-SWA_59 668485 : 674715 5 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_60 684986 : 686819 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_61 691816 : 697101 4 Mycoplasma_phage(33.33%) NA NA
DBSCAN-SWA_62 701339 : 702869 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_63 709972 : 711724 2 Chrysochromulina_ericina_virus(50.0%) NA NA
DBSCAN-SWA_64 715759 : 717370 1 Catovirus(100.0%) NA NA
DBSCAN-SWA_65 724602 : 726144 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_66 729269 : 734804 5 Cedratvirus(33.33%) NA NA
DBSCAN-SWA_67 752310 : 753321 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_68 766457 : 770042 6 EBPR_siphovirus(50.0%) NA NA
DBSCAN-SWA_69 781677 : 785262 6 EBPR_siphovirus(50.0%) NA NA
DBSCAN-SWA_70 795718 : 806314 8 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_71 811202 : 812294 1 Emiliania_huxleyi_virus(100.0%) NA NA
DBSCAN-SWA_72 817621 : 818293 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_73 826443 : 828012 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_74 834216 : 835734 1 Staphylococcus_phage(100.0%) NA NA
DBSCAN-SWA_75 841056 : 841485 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_76 849884 : 851642 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_77 855433 : 857344 1 Sinorhizobium_phage(100.0%) NA NA
DBSCAN-SWA_78 875645 : 876656 1 Paenibacillus_phage(100.0%) NA NA
DBSCAN-SWA_79 880601 : 881372 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_80 889681 : 890779 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_81 899685 : 907187 8 Sinorhizobium_phage(33.33%) NA NA
DBSCAN-SWA_82 910594 : 911698 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_83 915944 : 921360 7 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_84 929086 : 934541 5 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_85 938565 : 940764 1 Megavirus(100.0%) NA NA
DBSCAN-SWA_86 944552 : 945770 1 uncultured_Mediterranean_phage(100.0%) NA NA
DBSCAN-SWA_87 956587 : 957778 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_88 966938 : 968315 1 Acanthocystis_turfacea_Chlorella_virus(100.0%) NA NA
DBSCAN-SWA_89 971359 : 973252 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_90 990007 : 991036 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_91 996062 : 997355 1 Moraxella_phage(100.0%) NA NA
DBSCAN-SWA_92 1000627 : 1005349 3 Acinetobacter_phage(100.0%) NA NA
DBSCAN-SWA_93 1010688 : 1011168 1 Agrobacterium_phage(100.0%) NA NA
DBSCAN-SWA_94 1019726 : 1020518 1 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_95 1026075 : 1030817 4 Erysipelothrix_phage(50.0%) NA NA
DBSCAN-SWA_96 1036000 : 1037134 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_97 1042323 : 1044243 1 Bodo_saltans_virus(100.0%) NA NA
DBSCAN-SWA_98 1049661 : 1054005 3 Catovirus(50.0%) NA NA
DBSCAN-SWA_99 1062271 : 1063111 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_100 1069555 : 1082107 9 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_101 1087719 : 1089321 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_102 1097222 : 1098971 1 Anomala_cuprea_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_103 1102138 : 1106179 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_104 1120938 : 1122708 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_105 1132813 : 1137096 5 Enterobacteria_phage(60.0%) NA NA
DBSCAN-SWA_106 1141773 : 1143507 2 Bordetella_phage(50.0%) NA NA
DBSCAN-SWA_107 1149744 : 1151238 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_108 1177123 : 1178182 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_109 1181500 : 1183012 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_110 1186946 : 1187837 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_111 1192639 : 1201035 8 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_112 1212138 : 1213302 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_113 1220255 : 1221407 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_114 1238882 : 1247324 10 uncultured_virus(40.0%) NA NA
DBSCAN-SWA_115 1257717 : 1260201 1 uncultured_virus(100.0%) NA NA
DBSCAN-SWA_116 1268753 : 1274306 5 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_117 1286968 : 1288057 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_118 1294676 : 1298274 3 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_119 1304618 : 1310989 6 Streptococcus_virus(20.0%) NA NA
DBSCAN-SWA_120 1328182 : 1331503 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_121 1342875 : 1344051 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_122 1347196 : 1347865 1 Bacillus_thuringiensis_phage(100.0%) NA NA
DBSCAN-SWA_123 1363282 : 1364062 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_124 1384479 : 1389301 3 Acinetobacter_phage(66.67%) NA NA
DBSCAN-SWA_125 1396563 : 1397394 1 Mycobacterium_phage(100.0%) NA NA
DBSCAN-SWA_126 1409482 : 1410232 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_127 1417549 : 1419064 1 Diachasmimorpha_longicaudata_entomopoxvirus(100.0%) NA NA
DBSCAN-SWA_128 1432589 : 1434125 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_129 1439120 : 1441055 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_130 1445504 : 1448876 3 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_131 1455598 : 1456483 1 Mycobacterium_virus(100.0%) NA NA
DBSCAN-SWA_132 1462718 : 1467474 4 Pandoravirus(33.33%) NA NA
DBSCAN-SWA_133 1471188 : 1472685 1 Cedratvirus(100.0%) NA NA
DBSCAN-SWA_134 1477746 : 1479072 2 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_135 1489496 : 1493005 5 Macacine_betaherpesvirus(50.0%) NA NA
DBSCAN-SWA_136 1497128 : 1497770 1 Pseudomonas_phage(100.0%) NA NA
DBSCAN-SWA_137 1504482 : 1505595 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_138 1511695 : 1520429 12 Bacillus_phage(20.0%) NA NA
DBSCAN-SWA_139 1523648 : 1524170 1 Rhizobium_phage(100.0%) NA NA
DBSCAN-SWA_140 1533824 : 1534892 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_141 1568104 : 1572911 4 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_142 1579897 : 1581823 2 Bacillus_virus(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP019483
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019483_1 320232-320341 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP019483_1 1.1|320258|58|NZ_CP019483|CRISPRCasFinder 320258-320315 58 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 709941-709998 0 1.0
NZ_CP019483_1 1.1|320258|58|NZ_CP019483|CRISPRCasFinder 320258-320315 58 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 618048-618105 0 1.0
NZ_CP019483_1 1.1|320258|58|NZ_CP019483|CRISPRCasFinder 320258-320315 58 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 534472-534529 0 1.0
NZ_CP019483_1 1.1|320258|58|NZ_CP019483|CRISPRCasFinder 320258-320315 58 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 320258-320315 0 1.0
NZ_CP019483_1 1.1|320258|58|NZ_CP019483|CRISPRCasFinder 320258-320315 58 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 295298-295355 0 1.0
NZ_CP019483_1 1.1|320258|58|NZ_CP019483|CRISPRCasFinder 320258-320315 58 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 1180665-1180722 0 1.0
NZ_CP019483_1 1.1|320258|58|NZ_CP019483|CRISPRCasFinder 320258-320315 58 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 1086301-1086358 0 1.0
NZ_CP019483_1 1.1|320258|58|NZ_CP019483|CRISPRCasFinder 320258-320315 58 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 1186250-1186307 0 1.0
NZ_CP019483_1 1.1|320258|58|NZ_CP019483|CRISPRCasFinder 320258-320315 58 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 275823-275880 0 1.0
NZ_CP019483_1 1.1|320258|58|NZ_CP019483|CRISPRCasFinder 320258-320315 58 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 7342-7399 0 1.0
NZ_CP019483_1 1.1|320258|58|NZ_CP019483|CRISPRCasFinder 320258-320315 58 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 819905-819962 0 1.0
NZ_CP019483_1 1.1|320258|58|NZ_CP019483|CRISPRCasFinder 320258-320315 58 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 347456-347513 1 0.983
NZ_CP019483_1 1.1|320258|58|NZ_CP019483|CRISPRCasFinder 320258-320315 58 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 403311-403368 1 0.983
NZ_CP019483_1 1.1|320258|58|NZ_CP019483|CRISPRCasFinder 320258-320315 58 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 347117-347174 1 0.983
NZ_CP019483_1 1.1|320258|58|NZ_CP019483|CRISPRCasFinder 320258-320315 58 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 373772-373829 1 0.983

1. spacer 1.1|320258|58|NZ_CP019483|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 0, identity: 1.0

gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	CRISPR spacer
gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	Protospacer
**********************************************************

2. spacer 1.1|320258|58|NZ_CP019483|CRISPRCasFinder matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 0, identity: 1.0

gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	CRISPR spacer
gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	Protospacer
**********************************************************

3. spacer 1.1|320258|58|NZ_CP019483|CRISPRCasFinder matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 0, identity: 1.0

gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	CRISPR spacer
gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	Protospacer
**********************************************************

4. spacer 1.1|320258|58|NZ_CP019483|CRISPRCasFinder matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 0, identity: 1.0

gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	CRISPR spacer
gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	Protospacer
**********************************************************

5. spacer 1.1|320258|58|NZ_CP019483|CRISPRCasFinder matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 0, identity: 1.0

gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	CRISPR spacer
gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	Protospacer
**********************************************************

6. spacer 1.1|320258|58|NZ_CP019483|CRISPRCasFinder matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 0, identity: 1.0

gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	CRISPR spacer
gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	Protospacer
**********************************************************

7. spacer 1.1|320258|58|NZ_CP019483|CRISPRCasFinder matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 0, identity: 1.0

gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	CRISPR spacer
gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	Protospacer
**********************************************************

8. spacer 1.1|320258|58|NZ_CP019483|CRISPRCasFinder matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 0, identity: 1.0

gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	CRISPR spacer
gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	Protospacer
**********************************************************

9. spacer 1.1|320258|58|NZ_CP019483|CRISPRCasFinder matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 0, identity: 1.0

gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	CRISPR spacer
gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	Protospacer
**********************************************************

10. spacer 1.1|320258|58|NZ_CP019483|CRISPRCasFinder matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 0, identity: 1.0

gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	CRISPR spacer
gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	Protospacer
**********************************************************

11. spacer 1.1|320258|58|NZ_CP019483|CRISPRCasFinder matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 0, identity: 1.0

gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	CRISPR spacer
gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	Protospacer
**********************************************************

12. spacer 1.1|320258|58|NZ_CP019483|CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 1, identity: 0.983

gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	CRISPR spacer
gatcaggtccatgagccgttcgcgccggtcgccgcggtcgccgatcagttccatcagg	Protospacer
******************.***************************************

13. spacer 1.1|320258|58|NZ_CP019483|CRISPRCasFinder matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 1, identity: 0.983

gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	CRISPR spacer
gatcaggtccatgagccgctcgcgccggtcaccgcggtcgccgatcagttccatcagg	Protospacer
******************************.***************************

14. spacer 1.1|320258|58|NZ_CP019483|CRISPRCasFinder matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 1, identity: 0.983

gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	CRISPR spacer
gatcaggtccatgagccgttcgcgccggtcgccgcggtcgccgatcagttccatcagg	Protospacer
******************.***************************************

15. spacer 1.1|320258|58|NZ_CP019483|CRISPRCasFinder matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 1, identity: 0.983

gatcaggtccatgagccgctcgcgccggtcgccgcggtcgccgatcagttccatcagg	CRISPR spacer
gatcaggtccatgagccgttcgcgccggtcgccgcggtcgccgatcagttccatcagg	Protospacer
******************.***************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 366741 : 375072 11 uncultured_virus(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP019485
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019485_1 173772-173918 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019485_2 1091403-1091513 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP019485_3 1967264-1967376 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP019485_1 1.2|173879|16|NZ_CP019485|CRISPRCasFinder 173879-173894 16 NZ_CP019485.1 531252-531267 1 0.938
NZ_CP019485_1 1.2|173879|16|NZ_CP019485|CRISPRCasFinder 173879-173894 16 NZ_CP019485.1 2383574-2383589 1 0.938

1. spacer 1.2|173879|16|NZ_CP019485|CRISPRCasFinder matches to position: 531252-531267, mismatch: 1, identity: 0.938

tagggtgaggggcggt	CRISPR spacer
tagggtgaggggcagt	Protospacer
*************.**

2. spacer 1.2|173879|16|NZ_CP019485|CRISPRCasFinder matches to position: 2383574-2383589, mismatch: 1, identity: 0.938

tagggtgaggggcggt	CRISPR spacer
tagggtgaggggcagt	Protospacer
*************.**

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1606753 : 1618002 12 uncultured_Mediterranean_phage(80.0%) tRNA NA
DBSCAN-SWA_2 2459650 : 2469285 7 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_3 2501046 : 2550882 45 Klosneuvirus(16.67%) holin,transposase,tRNA,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage