Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023161 Xanthomonas citri pv. malvacearum strain MS14003 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP023159 Xanthomonas citri pv. malvacearum strain MS14003 chromosome, complete genome 3 crisprs WYL,DinG,cas3,DEDDh,csa3 0 5 8 0
NZ_CP023162 Xanthomonas citri pv. malvacearum strain MS14003 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP023160 Xanthomonas citri pv. malvacearum strain MS14003 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP023159
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023159_1 27339-27693 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023159_2 2687281-2687375 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023159_3 3160447-3160585 Orphan NA
1 spacers
DEDDh,csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023159_1 1.11|27472|31|NZ_CP023159|CRISPRCasFinder 27472-27502 31 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 934481-934511 6 0.806
NZ_CP023159_1 1.13|27583|34|NZ_CP023159|CRISPRCasFinder 27583-27616 34 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1614842-1614875 6 0.824
NZ_CP023159_1 1.11|27472|31|NZ_CP023159|CRISPRCasFinder 27472-27502 31 NZ_CP015279 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence 150331-150361 7 0.774
NZ_CP023159_1 1.11|27472|31|NZ_CP023159|CRISPRCasFinder 27472-27502 31 NZ_CP015280 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence 81610-81640 7 0.774
NZ_CP023159_1 1.13|27583|34|NZ_CP023159|CRISPRCasFinder 27583-27616 34 MH271303 Microbacterium phage MementoMori, complete genome 20739-20772 8 0.765
NZ_CP023159_1 1.13|27583|34|NZ_CP023159|CRISPRCasFinder 27583-27616 34 MN813682 Microbacterium phage Matzah, complete genome 21015-21048 8 0.765
NZ_CP023159_1 1.13|27583|34|NZ_CP023159|CRISPRCasFinder 27583-27616 34 MK937591 Microbacterium phage Cinna, complete genome 21039-21072 8 0.765
NZ_CP023159_1 1.14|27640|31|NZ_CP023159|CRISPRCasFinder 27640-27670 31 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 380719-380749 8 0.742
NZ_CP023159_1 1.5|27577|38|NZ_CP023159|CRT 27577-27614 38 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1614844-1614881 10 0.737
NZ_CP023159_1 1.6|27634|35|NZ_CP023159|CRT 27634-27668 35 NZ_CP049358 Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence 138975-139009 10 0.714
NZ_CP023159_1 1.13|27583|34|NZ_CP023159|CRISPRCasFinder 27583-27616 34 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 72444-72477 11 0.676
NZ_CP023159_1 1.13|27583|34|NZ_CP023159|CRISPRCasFinder 27583-27616 34 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 22147-22180 12 0.647
NZ_CP023159_1 1.13|27583|34|NZ_CP023159|CRISPRCasFinder 27583-27616 34 NZ_CP023152 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence 116465-116498 12 0.647

1. spacer 1.11|27472|31|NZ_CP023159|CRISPRCasFinder matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 6, identity: 0.806

cgcatcggcgacaacgcgcgtaccg-gtggcg	CRISPR spacer
cgcagcggcgacaacgcgcgcaccatcttgc-	Protospacer
**** ***************.***.  * ** 

2. spacer 1.13|27583|34|NZ_CP023159|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

ctcgccgagcgcggcagccagatcagtggcggcg-	CRISPR spacer
ttcgtcgagcgcggcagccagatca-tggggctgg	Protospacer
.***.******************** *** * .* 

3. spacer 1.11|27472|31|NZ_CP023159|CRISPRCasFinder matches to NZ_CP015279 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.774

cgcatcggcgacaacgcgcgtaccggtggcg	CRISPR spacer
atcaccggcgacaacgcgcgcaccgccgccg	Protospacer
  **.***************.**** .* **

4. spacer 1.11|27472|31|NZ_CP023159|CRISPRCasFinder matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 7, identity: 0.774

cgcatcggcgacaacgcgcgtaccggtggcg	CRISPR spacer
atcaccggcgacaacgcgcgcaccgccgccg	Protospacer
  **.***************.**** .* **

5. spacer 1.13|27583|34|NZ_CP023159|CRISPRCasFinder matches to MH271303 (Microbacterium phage MementoMori, complete genome) position: , mismatch: 8, identity: 0.765

ctcgccgagcgcggcagccagat-cagtggcggcg	CRISPR spacer
ctcgccgagcgcggcatcccgatcctctccctgc-	Protospacer
**************** ** *** *  *  * ** 

6. spacer 1.13|27583|34|NZ_CP023159|CRISPRCasFinder matches to MN813682 (Microbacterium phage Matzah, complete genome) position: , mismatch: 8, identity: 0.765

ctcgccgagcgcggcagccagat-cagtggcggcg	CRISPR spacer
ctcgccgagcgcggcatcccgatcctctccctgc-	Protospacer
**************** ** *** *  *  * ** 

7. spacer 1.13|27583|34|NZ_CP023159|CRISPRCasFinder matches to MK937591 (Microbacterium phage Cinna, complete genome) position: , mismatch: 8, identity: 0.765

ctcgccgagcgcggcagccagat-cagtggcggcg	CRISPR spacer
ctcgccgagcgcggcatcccgatcctctccctgc-	Protospacer
**************** ** *** *  *  * ** 

8. spacer 1.14|27640|31|NZ_CP023159|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 8, identity: 0.742

gggctggtgggaaccgagctcggcaagggca	CRISPR spacer
ctgctggtgggaatcgagttcggcaccgcaa	Protospacer
  ***********.****.******  *  *

9. spacer 1.5|27577|38|NZ_CP023159|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.737

agcatcctcgccgagcgcggcagccagatcagtggcgg	CRISPR spacer
atgttcttcgtcgagcgcggcagccagatcatggggct	Protospacer
*   **.***.********************  **   

10. spacer 1.6|27634|35|NZ_CP023159|CRT matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

agcatcgggctggtgggaaccgagctcggcaaggg	CRISPR spacer
agcatcgggcgggtgggcaccgagccgaccatcat	Protospacer
********** ****** *******. . **  . 

11. spacer 1.13|27583|34|NZ_CP023159|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 11, identity: 0.676

ctcgccgagcgcggcagccagatcagtggcggcg	CRISPR spacer
ctcggcgagcgcggcggccagatcctcctccatc	Protospacer
**** **********.********  .  * .. 

12. spacer 1.13|27583|34|NZ_CP023159|CRISPRCasFinder matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 12, identity: 0.647

ctcgccgagcgcggcagccagatcagtggcggcg	CRISPR spacer
gccgccgagcgcagcagcccgatcagcccgtaga	Protospacer
 .**********.****** ******.    . .

13. spacer 1.13|27583|34|NZ_CP023159|CRISPRCasFinder matches to NZ_CP023152 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence) position: , mismatch: 12, identity: 0.647

ctcgccgagcgcggcagccagatcagtggcggcg	CRISPR spacer
gccgccgagcgcagcagcccgatcagcccgtaga	Protospacer
 .**********.****** ******.    . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1179658 : 1306084 103 Stenotrophomonas_phage(25.93%) transposase,holin,terminase,head,tail,capsid NA
DBSCAN-SWA_2 1781479 : 1850685 49 Staphylococcus_phage(12.5%) transposase,tRNA,protease NA
DBSCAN-SWA_3 2509886 : 2565938 42 uncultured_Mediterranean_phage(11.11%) transposase,tRNA,protease NA
DBSCAN-SWA_4 2617127 : 2643146 39 Xanthomonas_phage(51.85%) transposase,coat NA
DBSCAN-SWA_5 2808878 : 2880455 36 Tupanvirus(33.33%) transposase,tRNA,integrase attL 2824657:2824716|attR 2872576:2873771
DBSCAN-SWA_6 2962921 : 2973699 7 uncultured_Caudovirales_phage(16.67%) tRNA NA
DBSCAN-SWA_7 3743140 : 3780322 32 Leptospira_phage(28.57%) transposase,protease,integrase attL 3752467:3752482|attR 3785086:3785101
DBSCAN-SWA_8 4158200 : 4169969 11 Enterobacteria_phage(37.5%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage