Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023073 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666d, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 2 crisprs csa3 0 5 2 0
NZ_CP023070 Sinorhizobium fredii CCBAU 83666 chromosome, complete genome 1 crisprs csa3,WYL,cas3,RT,DEDDh 0 0 4 0
NZ_CP023072 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence 0 crisprs RT 0 0 7 0

Results visualization

1. NZ_CP023073
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 40019 : 47493 11 Sinorhizobium_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP023071
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023071_1 834165-834350 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023071_2 834510-834640 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023071_1 1.1|834188|31|NZ_CP023071|CRISPRCasFinder 834188-834218 31 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 834188-834218 0 1.0
NZ_CP023071_1 1.2|834242|31|NZ_CP023071|CRISPRCasFinder 834242-834272 31 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 874901-874931 0 1.0
NZ_CP023071_1 1.2|834242|31|NZ_CP023071|CRISPRCasFinder 834242-834272 31 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 834242-834272 0 1.0
NZ_CP023071_1 1.2|834242|31|NZ_CP023071|CRISPRCasFinder 834242-834272 31 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1237639-1237669 0 1.0
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1158650-1158680 0 1.0
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 874955-874985 0 1.0
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 365330-365360 0 1.0
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 1281307-1281337 0 1.0
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 834296-834326 0 1.0
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 481980-482010 0 1.0
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 1697894-1697924 0 1.0
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 949245-949275 0 1.0
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1237585-1237615 0 1.0
NZ_CP023071_2 2.1|834533|31|NZ_CP023071|CRISPRCasFinder 834533-834563 31 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1158887-1158917 0 1.0
NZ_CP023071_2 2.1|834533|31|NZ_CP023071|CRISPRCasFinder 834533-834563 31 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 875192-875222 0 1.0
NZ_CP023071_2 2.1|834533|31|NZ_CP023071|CRISPRCasFinder 834533-834563 31 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 834533-834563 0 1.0
NZ_CP023071_2 2.1|834533|31|NZ_CP023071|CRISPRCasFinder 834533-834563 31 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1237348-1237378 0 1.0
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1237294-1237324 0 1.0
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 875246-875276 0 1.0
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 834587-834617 0 1.0
NZ_CP023071_1 1.1|834188|31|NZ_CP023071|CRISPRCasFinder 834188-834218 31 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1237693-1237723 1 0.968
NZ_CP023071_1 1.1|834188|31|NZ_CP023071|CRISPRCasFinder 834188-834218 31 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 874847-874877 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 943777-943807 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 1072161-1072191 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 793644-793674 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 763409-763439 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 835280-835310 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 928192-928222 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 861189-861219 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 524661-524691 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 937645-937675 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 925108-925138 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1595235-1595265 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1188879-1188909 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1559764-1559794 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 850702-850732 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 49004-49034 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 81325-81355 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 1088897-1088927 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 935195-935225 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 1053140-1053170 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 708988-709018 1 0.968
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 793648-793678 1 0.968
NZ_CP023071_2 2.1|834533|31|NZ_CP023071|CRISPRCasFinder 834533-834563 31 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 1225712-1225742 1 0.968
NZ_CP023071_2 2.1|834533|31|NZ_CP023071|CRISPRCasFinder 834533-834563 31 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 1044545-1044575 1 0.968
NZ_CP023071_1 1.1|834188|31|NZ_CP023071|CRISPRCasFinder 834188-834218 31 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 1226057-1226087 2 0.935
NZ_CP023071_1 1.1|834188|31|NZ_CP023071|CRISPRCasFinder 834188-834218 31 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1559872-1559902 2 0.935
NZ_CP023071_1 1.1|834188|31|NZ_CP023071|CRISPRCasFinder 834188-834218 31 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 1044890-1044920 2 0.935
NZ_CP023071_1 1.1|834188|31|NZ_CP023071|CRISPRCasFinder 834188-834218 31 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1158542-1158572 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 896619-896649 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 749148-749178 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1019367-1019397 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 559967-559997 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 406319-406349 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 408206-408236 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1333334-1333364 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1295518-1295548 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 394493-394523 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1399557-1399587 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 1646071-1646101 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 403209-403239 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 389446-389476 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1022543-1022573 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 655053-655083 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 284566-284596 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1178240-1178270 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 610986-611016 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 543363-543393 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1451787-1451817 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1228080-1228110 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1333340-1333370 2 0.935
NZ_CP023071_2 2.1|834533|31|NZ_CP023071|CRISPRCasFinder 834533-834563 31 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 835517-835547 2 0.935
NZ_CP023071_2 2.1|834533|31|NZ_CP023071|CRISPRCasFinder 834533-834563 31 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1559527-1559557 2 0.935
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1559473-1559503 2 0.935
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 7145-7175 3 0.903
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1158941-1158971 3 0.903
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1155315-1155345 4 0.871
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1023255-1023285 4 0.871
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NC_009926 Acaryochloris marina MBIC11017 plasmid pREB1, complete sequence 291906-291936 5 0.839
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 770544-770574 5 0.839
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 20057-20087 6 0.806
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 18970-19000 6 0.806
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 703951-703981 6 0.806
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 339182-339212 6 0.806
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 165927-165957 6 0.806
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1063335-1063365 6 0.806
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 381109-381139 6 0.806
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 20057-20087 6 0.806
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 1398212-1398242 6 0.806
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021821 Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence 164696-164726 6 0.806
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 505619-505649 6 0.806
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP031955 Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence 53455-53485 6 0.806
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NC_018422 Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence 53219-53249 6 0.806
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP010605 Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence 18410-18440 6 0.806
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP010711 Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence 18410-18440 6 0.806
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 122725-122755 6 0.806
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 907655-907685 6 0.806
NZ_CP023071_1 1.1|834188|31|NZ_CP023071|CRISPRCasFinder 834188-834218 31 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 241575-241605 7 0.774
NZ_CP023071_1 1.1|834188|31|NZ_CP023071|CRISPRCasFinder 834188-834218 31 NZ_CP026928 Agrobacterium tumefaciens strain 1D1609 plasmid pAt1D1609b, complete sequence 105885-105915 7 0.774
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 590396-590426 7 0.774
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 580821-580851 7 0.774
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP030829 Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence 408433-408463 7 0.774
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP010739 Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence 18321-18351 7 0.774
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1154835-1154865 7 0.774
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 761771-761801 7 0.774
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP025433 Paracoccus zhejiangensis strain J6 plasmid pPZ03, complete sequence 136432-136462 8 0.742
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_015065 Granulicella tundricola MP5ACTX9 plasmid pACIX902, complete sequence 79975-80005 8 0.742
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1232211-1232241 8 0.742
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP020613 Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T plasmid unnamed, complete sequence 3267-3297 8 0.742
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP042824 Rhizobium sp. WL3 plasmid unnamed1, complete sequence 74358-74388 8 0.742
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP048637 Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence 171629-171659 8 0.742
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP039912 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence 203289-203319 8 0.742
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 290256-290286 8 0.742
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 486645-486675 8 0.742
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 MT684587 Microbacterium phage Fede, complete genome 53287-53317 8 0.742
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 311994-312024 8 0.742
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 120127-120157 8 0.742
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP006370 Aureimonas sp. AU20 plasmid pAU20c, complete sequence 191609-191639 8 0.742
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 MK016504 Mycobacterium phage Whouxphf, complete genome 25291-25321 8 0.742
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 MH230876 Mycobacterium phage ConceptII, complete genome 29892-29922 8 0.742
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NC_022056 Mycobacterium phage Hamulus, complete genome 25198-25228 8 0.742
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP023072 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence 79111-79141 9 0.71
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NC_000914 Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence 401796-401826 9 0.71
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 615103-615133 9 0.71
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 CP000663 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence 127888-127918 9 0.71
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP031752 Rhodobacter sphaeroides strain EBL0706 plasmid p.A, complete sequence 74055-74085 9 0.71
NZ_CP023071_1 1.3|834296|31|NZ_CP023071|CRISPRCasFinder 834296-834326 31 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 830976-831006 10 0.677
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP013069 Pannonibacter phragmitetus strain 31801 plasmid p.p-1, complete sequence 236561-236591 10 0.677
NZ_CP023071_2 2.2|834587|31|NZ_CP023071|CRISPRCasFinder 834587-834617 31 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 273467-273497 10 0.677

1. spacer 1.1|834188|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 0, identity: 1.0

gcgatgtcgttgccgttaccgaccgagatcc	CRISPR spacer
gcgatgtcgttgccgttaccgaccgagatcc	Protospacer
*******************************

2. spacer 1.2|834242|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 0, identity: 1.0

gcttcgtcgattccagtttcggaatcgagca	CRISPR spacer
gcttcgtcgattccagtttcggaatcgagca	Protospacer
*******************************

3. spacer 1.2|834242|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 0, identity: 1.0

gcttcgtcgattccagtttcggaatcgagca	CRISPR spacer
gcttcgtcgattccagtttcggaatcgagca	Protospacer
*******************************

4. spacer 1.2|834242|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 0, identity: 1.0

gcttcgtcgattccagtttcggaatcgagca	CRISPR spacer
gcttcgtcgattccagtttcggaatcgagca	Protospacer
*******************************

5. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 0, identity: 1.0

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacga	Protospacer
*******************************

6. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 0, identity: 1.0

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacga	Protospacer
*******************************

7. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacga	Protospacer
*******************************

8. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacga	Protospacer
*******************************

9. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 0, identity: 1.0

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacga	Protospacer
*******************************

10. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacga	Protospacer
*******************************

11. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacga	Protospacer
*******************************

12. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacga	Protospacer
*******************************

13. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 0, identity: 1.0

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacga	Protospacer
*******************************

14. spacer 2.1|834533|31|NZ_CP023071|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 0, identity: 1.0

atatattcttcgcctgctccaccgtagatct	CRISPR spacer
atatattcttcgcctgctccaccgtagatct	Protospacer
*******************************

15. spacer 2.1|834533|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 0, identity: 1.0

atatattcttcgcctgctccaccgtagatct	CRISPR spacer
atatattcttcgcctgctccaccgtagatct	Protospacer
*******************************

16. spacer 2.1|834533|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 0, identity: 1.0

atatattcttcgcctgctccaccgtagatct	CRISPR spacer
atatattcttcgcctgctccaccgtagatct	Protospacer
*******************************

17. spacer 2.1|834533|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 0, identity: 1.0

atatattcttcgcctgctccaccgtagatct	CRISPR spacer
atatattcttcgcctgctccaccgtagatct	Protospacer
*******************************

18. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 0, identity: 1.0

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
atgtggtcgtggccgtcaccaccgtcgatga	Protospacer
*******************************

19. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 0, identity: 1.0

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
atgtggtcgtggccgtcaccaccgtcgatga	Protospacer
*******************************

20. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 0, identity: 1.0

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
atgtggtcgtggccgtcaccaccgtcgatga	Protospacer
*******************************

21. spacer 1.1|834188|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 1, identity: 0.968

gcgatgtcgttgccgttaccgaccgagatcc	CRISPR spacer
gcgatgtcgttaccgttaccgaccgagatcc	Protospacer
***********.*******************

22. spacer 1.1|834188|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 1, identity: 0.968

gcgatgtcgttgccgttaccgaccgagatcc	CRISPR spacer
gcgatgtcgttaccgttaccgaccgagatcc	Protospacer
***********.*******************

23. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agaaagttgttcccgtcgccgccatcgacga	Protospacer
*** ***************************

24. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgtcgccgccatcgacga	Protospacer
***********.*******************

25. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacaa	Protospacer
*****************************.*

26. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacaa	Protospacer
*****************************.*

27. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcaccgccatcgacga	Protospacer
*****************.*************

28. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacaa	Protospacer
*****************************.*

29. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacaa	Protospacer
*****************************.*

30. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacaa	Protospacer
*****************************.*

31. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacaa	Protospacer
*****************************.*

32. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacaa	Protospacer
*****************************.*

33. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacaa	Protospacer
*****************************.*

34. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacaa	Protospacer
*****************************.*

35. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgatga	Protospacer
****************************.**

36. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacaa	Protospacer
*****************************.*

37. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacaa	Protospacer
*****************************.*

38. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacaa	Protospacer
*****************************.*

39. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacaa	Protospacer
*****************************.*

40. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacaa	Protospacer
*****************************.*

41. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccgtcgacga	Protospacer
***********************.*******

42. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacaa	Protospacer
*****************************.*

43. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 1, identity: 0.968

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgttcccgtcgccgccatcgacaa	Protospacer
*****************************.*

44. spacer 2.1|834533|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 1, identity: 0.968

atatattcttcgcctgctccaccgtagatct	CRISPR spacer
atatattcttcgcctgctccaccgtagattt	Protospacer
*****************************.*

45. spacer 2.1|834533|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 1, identity: 0.968

atatattcttcgcctgctccaccgtagatct	CRISPR spacer
atatattcttcgcctgctccaccgtagattt	Protospacer
*****************************.*

46. spacer 1.1|834188|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 2, identity: 0.935

gcgatgtcgttgccgttaccgaccgagatcc	CRISPR spacer
gcgatgtcgttgccgtcgccgaccgagatcc	Protospacer
****************..*************

47. spacer 1.1|834188|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 2, identity: 0.935

gcgatgtcgttgccgttaccgaccgagatcc	CRISPR spacer
gcgatgtcgttgccgtcgccgaccgagatcc	Protospacer
****************..*************

48. spacer 1.1|834188|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 2, identity: 0.935

gcgatgtcgttgccgttaccgaccgagatcc	CRISPR spacer
gcgatgtcgttgccgtcgccgaccgagatcc	Protospacer
****************..*************

49. spacer 1.1|834188|31|NZ_CP023071|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 2, identity: 0.935

gcgatgtcgttgccgttaccgaccgagatcc	CRISPR spacer
gcgatgtcgttgccgtcaccgaccgcgatcc	Protospacer
****************.******** *****

50. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

51. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

52. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

53. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

54. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

55. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

56. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

57. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

58. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

59. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

60. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

61. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

62. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

63. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

64. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

65. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

66. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

67. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

68. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

69. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

70. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

71. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.935

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtttccgttgccgccatcgacga	Protospacer
***********.****.**************

72. spacer 2.1|834533|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 2, identity: 0.935

atatattcttcgcctgctccaccgtagatct	CRISPR spacer
atgtactcttcgcctgctccaccgtagatct	Protospacer
**.**.*************************

73. spacer 2.1|834533|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 2, identity: 0.935

atatattcttcgcctgctccaccgtagatct	CRISPR spacer
atgtattcctcgcctgctccaccgtagatct	Protospacer
**.*****.**********************

74. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 2, identity: 0.935

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
atgtgatcgtggccgtccccaccgtcgatga	Protospacer
*****.*********** *************

75. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 3, identity: 0.903

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
aggtagttgttcccgtcgccgccgtcgacaa	Protospacer
**.********************.*****.*

76. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 3, identity: 0.903

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
atgtgatcgtggccgtcaccaccatcgatgg	Protospacer
*****.*****************.******.

77. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.871

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtcgccgtcgccgccatcgaccc	Protospacer
**********. *****************  

78. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.871

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagttgtcgccgtcgccgccatcgaccc	Protospacer
**********. *****************  

79. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NC_009926 (Acaryochloris marina MBIC11017 plasmid pREB1, complete sequence) position: , mismatch: 5, identity: 0.839

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
atgttgtcgtggccgtcaccaccgtggaccc	Protospacer
**** ******************** **.  

80. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 5, identity: 0.839

atgtggtcgtggccgtcaccaccgtcgatga-	CRISPR spacer
gggtgatcgtggccatcaccaccgt-gatgat	Protospacer
. ***.********.********** ***** 

81. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.806

agatagttgttcccgtcgccgcc-atcgacga	CRISPR spacer
agattgtcgttcccgtcgccgccgatcagcc-	Protospacer
**** **.*************** ***..*  

82. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.806

agatagttgttcccgtcgccgcc-atcgacga	CRISPR spacer
agattgtcgttcccgtcgccgccgatcagcc-	Protospacer
**** **.*************** ***..*  

83. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.806

agatagttgttcccgtcgccgcc-atcgacga	CRISPR spacer
agattgtcgttcccgtcgccgccgatcagcc-	Protospacer
**** **.*************** ***..*  

84. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 6, identity: 0.806

agatagttgttcccgtcgccgcc-atcgacga	CRISPR spacer
agattgtcgttcccgtcgccgccgatcagcc-	Protospacer
**** **.*************** ***..*  

85. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.806

agatagttgttcccgtcgccgcc-atcgacga	CRISPR spacer
agattgtcgttcccgtcgccgccgatcagcc-	Protospacer
**** **.*************** ***..*  

86. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.806

agatagttgttcccgtcgccgcc-atcgacga	CRISPR spacer
agattgtcgttcccgtcgccgccgatcagcc-	Protospacer
**** **.*************** ***..*  

87. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.806

agatagttgttcccgtcgccgcc-atcgacga	CRISPR spacer
agattgtcgttcccgtcgccgccgatcagcc-	Protospacer
**** **.*************** ***..*  

88. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.806

agatagttgttcccgtcgccgcc-atcgacga	CRISPR spacer
agattgtcgttcccgtcgccgccgatcagcc-	Protospacer
**** **.*************** ***..*  

89. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 6, identity: 0.806

agatagttgttcccgtcgccgcc-atcgacga	CRISPR spacer
agattgtcgttcccgtcgccgccgatcagcc-	Protospacer
**** **.*************** ***..*  

90. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 6, identity: 0.806

agatagttgttcccgtcgccgcc-atcgacga	CRISPR spacer
agattgtcgttcccgtcgccgccgatcagcc-	Protospacer
**** **.*************** ***..*  

91. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.806

agatagttgttcccgtcgccgcc-atcgacga	CRISPR spacer
agattgtcgttcccgtcgccgccgatcagcc-	Protospacer
**** **.*************** ***..*  

92. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP031955 (Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.806

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
aggatgtcgttgccttcaccaccgtcgatgt	Protospacer
* *  ***** *** *************** 

93. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NC_018422 (Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence) position: , mismatch: 6, identity: 0.806

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
aggatgtcgttgccttcaccaccgtcgatgt	Protospacer
* *  ***** *** *************** 

94. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP010605 (Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence) position: , mismatch: 6, identity: 0.806

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
aggatgtcgttgccttcaccaccgtcgatgt	Protospacer
* *  ***** *** *************** 

95. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP010711 (Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence) position: , mismatch: 6, identity: 0.806

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
aggatgtcgttgccttcaccaccgtcgatgt	Protospacer
* *  ***** *** *************** 

96. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.806

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
agggcgtcgttgccgtcgccaccgtcgatca	Protospacer
* *  ***** ******.*********** *

97. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.806

atgtg-gtcgtggccgtcaccaccgtcgatga	CRISPR spacer
-tgcgcttcgtggccgtcaagaccgtcgatca	Protospacer
 **.*  ************  ********* *

98. spacer 1.1|834188|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 7, identity: 0.774

gcgatgtcgttgccgttaccgaccgagatcc	CRISPR spacer
ccgatgtccttgccgttaccgaccttgtcac	Protospacer
 ******* ***************  * . *

99. spacer 1.1|834188|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP026928 (Agrobacterium tumefaciens strain 1D1609 plasmid pAt1D1609b, complete sequence) position: , mismatch: 7, identity: 0.774

gcgatgtcgttgccgttaccga-----ccgagatcc	CRISPR spacer
gccatgtcgttgccgttgccgacctgcccga-----	Protospacer
** **************.****     ****     

100. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.774

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agatagtcgttgccgtcgccgccttgcaggc	Protospacer
*******.*** *********** *  * * 

101. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.774

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
agggtatcgttgccgtcgccgccatcgatga	Protospacer
**.  .*.*** ****************.**

102. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP030829 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence) position: , mismatch: 7, identity: 0.774

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
tcatcgtcgtggccgtcaccatcctcgatgc	Protospacer
 ..* ****************.* ****** 

103. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP010739 (Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence) position: , mismatch: 7, identity: 0.774

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
agaacgtcgttgccgtcaccaccatcgatgg	Protospacer
* .  ***** ************.******.

104. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 7, identity: 0.774

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
atccggtcgttgccgtcgccaccgtcgagat	Protospacer
** .****** ******.********** . 

105. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 7, identity: 0.774

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
aggacgtcgttgccgtcaccgccgtcgatcg	Protospacer
* *  ***** *********.******** .

106. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP025433 (Paracoccus zhejiangensis strain J6 plasmid pPZ03, complete sequence) position: , mismatch: 8, identity: 0.742

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
atgacgttgttgccgtcgctgccatcgacat	Protospacer
* .  ****** *******.*********. 

107. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_015065 (Granulicella tundricola MP5ACTX9 plasmid pACIX902, complete sequence) position: , mismatch: 8, identity: 0.742

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
acgccattggtcccgtcgccgccatagacgc	Protospacer
* .. .*** *************** **** 

108. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.742

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
ccaagctggttcccgccgccgccatcgccga	Protospacer
  * . * *******.*********** ***

109. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP020613 (Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
gcctgatcgtggccgtcaccaccgtcgcgtt	Protospacer
.. **.*********************    

110. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP042824 (Rhizobium sp. WL3 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
tcggcgtcgtggccgtcaccaccttcgagac	Protospacer
 .*  ****************** **** . 

111. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP048637 (Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.742

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
tcggcgtcgtggccgtcaccaccttcgagac	Protospacer
 .*  ****************** **** . 

112. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP039912 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence) position: , mismatch: 8, identity: 0.742

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
tcggcgtcgtggccgtcaccaccttcgagac	Protospacer
 .*  ****************** **** . 

113. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 8, identity: 0.742

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
gtccggtcgtggccgtgaccaccttcgagac	Protospacer
.* .************ ****** **** . 

114. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
atcgtatcgttgccgtcaccaccgtcgacag	Protospacer
**   .**** *****************...

115. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to MT684587 (Microbacterium phage Fede, complete genome) position: , mismatch: 8, identity: 0.742

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
gcacgtccgtggccctcaccacagtcgatga	Protospacer
....* .******* ******* ********

116. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.742

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
accgtatcgttgccgtcgccaccgtcgatgg	Protospacer
*.   .**** ******.************.

117. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.742

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
cggcggtcgtcgccgtcaccaccctcgaccg	Protospacer
  *.****** ************ ****. .

118. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP006370 (Aureimonas sp. AU20 plasmid pAU20c, complete sequence) position: , mismatch: 8, identity: 0.742

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
ccgtggtcgaggccgtcaccaccgcctcgaa	Protospacer
 .******* **************.*   .*

119. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to MK016504 (Mycobacterium phage Whouxphf, complete genome) position: , mismatch: 8, identity: 0.742

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
atcaggacgtagccgtcaccaccgtcgccac	Protospacer
**  ** ***.**************** .. 

120. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to MH230876 (Mycobacterium phage ConceptII, complete genome) position: , mismatch: 8, identity: 0.742

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
atcaggacgtagccgtcaccaccgtcgccac	Protospacer
**  ** ***.**************** .. 

121. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NC_022056 (Mycobacterium phage Hamulus, complete genome) position: , mismatch: 8, identity: 0.742

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
atcaggacgtagccgtcaccaccgtcgccac	Protospacer
**  ** ***.**************** .. 

122. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 9, identity: 0.71

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
tttcgactgttccggtcgccgccaacgacga	Protospacer
   ....****** ********** ******

123. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NC_000914 (Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence) position: , mismatch: 9, identity: 0.71

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
tttcgactgttccggtcgccgccaacgacga	Protospacer
   ....****** ********** ******

124. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 9, identity: 0.71

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
agaacatcgttgccgtcgccaccgtcgatcc	Protospacer
* .  .**** ******.***********  

125. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to CP000663 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence) position: , mismatch: 9, identity: 0.71

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
tcggcgtcgtggccgtcaccgccgacgaccg	Protospacer
 .*  ***************.*** ***. .

126. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP031752 (Rhodobacter sphaeroides strain EBL0706 plasmid p.A, complete sequence) position: , mismatch: 9, identity: 0.71

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
tcggcgtcgtggccgtcaccgccgacgaccg	Protospacer
 .*  ***************.*** ***. .

127. spacer 1.3|834296|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 10, identity: 0.677

agatagttgttcccgtcgccgccatcgacga	CRISPR spacer
caggccctgttcccggcgccgccaccgacgc	Protospacer
 ..   .******** ********.***** 

128. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP013069 (Pannonibacter phragmitetus strain 31801 plasmid p.p-1, complete sequence) position: , mismatch: 10, identity: 0.677

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
gaccggtcgtggccctcaccaccgccgcctc	Protospacer
.  .********** *********.** .  

129. spacer 2.2|834587|31|NZ_CP023071|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.677

atgtggtcgtggccgtcaccaccgtcgatga	CRISPR spacer
tctccaccgtggcggtcaccaccggcgatgc	Protospacer
 . . ..****** ********** ***** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1108923 : 1148270 25 Leptospira_phage(33.33%) integrase,transposase attL 1144985:1145012|attR 1148359:1148386
DBSCAN-SWA_2 2064934 : 2146482 57 Planktothrix_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP023070
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023070_1 800313-800422 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1239470 : 1253599 14 uncultured_Mediterranean_phage(81.82%) tRNA NA
DBSCAN-SWA_2 1402776 : 1450967 57 Rhizobium_phage(21.62%) capsid,head,tail,terminase,portal,integrase attL 1449593:1449620|attR 1452651:1452678
DBSCAN-SWA_3 1848019 : 1859791 12 Sulfitobacter_phage(60.0%) portal,tail NA
DBSCAN-SWA_4 2341837 : 2397712 47 Klosneuvirus(14.29%) tRNA,transposase,holin,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP023072
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 16669 : 164288 93 Gordonia_phage(15.0%) transposase,integrase attL 100039:100098|attR 129020:129145
DBSCAN-SWA_2 229304 : 301688 53 Acidithiobacillus_phage(23.08%) transposase,integrase attL 237889:237907|attR 240110:240128
DBSCAN-SWA_3 325035 : 377351 28 Enterobacteria_phage(22.22%) transposase,integrase attL 369079:369106|attR 372453:372480
DBSCAN-SWA_4 425653 : 486194 52 Paenibacillus_phage(33.33%) transposase NA
DBSCAN-SWA_5 495388 : 562046 49 Acidithiobacillus_phage(15.0%) transposase,integrase attL 512289:512316|attR 515663:515690
DBSCAN-SWA_6 573143 : 592310 16 Lactococcus_phage(33.33%) transposase NA
DBSCAN-SWA_7 657490 : 702621 27 Paenibacillus_phage(20.0%) transposase,integrase attL 647777:647791|attR 660267:660281
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage