Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP023153 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence 0 crisprs c2c9_V-U4 0 0 0 0
NZ_CP023152 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence 1 crisprs csa3,c2c4_V-U1,c2c9_V-U4 0 1 0 0
NZ_CP023151 Mycobacterium chimaera strain FLAC0070 chromosome, complete genome 4 crisprs DEDDh,cas3,csa3,DinG,cas4,WYL,c2c9_V-U4 0 0 5 0

Results visualization

1. NZ_CP023152
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023152_1 135428-135532 TypeV-U1 NA
1 spacers
c2c4_V-U1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP023152_1 1.1|135457|47|NZ_CP023152|CRISPRCasFinder 135457-135503 47 NZ_CP023152 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence 135457-135503 0 1.0

1. spacer 1.1|135457|47|NZ_CP023152|CRISPRCasFinder matches to NZ_CP023152 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence) position: , mismatch: 0, identity: 1.0

gggtcattccatgggatgcctaccagacggactacgataagcgcctt	CRISPR spacer
gggtcattccatgggatgcctaccagacggactacgataagcgcctt	Protospacer
***********************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP023151
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023151_1 607217-607294 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023151_2 1424849-1424931 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023151_3 2252146-2252259 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP023151_4 5235078-5235163 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2251006 : 2278181 25 Enterobacteria_phage(50.0%) holin,transposase NA
DBSCAN-SWA_2 2286161 : 2325168 27 uncultured_virus(66.67%) transposase NA
DBSCAN-SWA_3 3265416 : 3274506 8 Shahe_endorna-like_virus(50.0%) NA NA
DBSCAN-SWA_4 3941125 : 3948223 8 Bacillus_phage(28.57%) NA NA
DBSCAN-SWA_5 4471005 : 4479688 8 Burkholderia_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage