Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP022670 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR5, complete sequence 0 crisprs RT 0 0 0 0
NZ_CP022669 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR4, complete sequence 1 crisprs DEDDh 0 1 0 0
NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 0 crisprs csa3,WYL 0 0 0 0
NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 0 crisprs DEDDh,csa3 0 0 0 0
NZ_CP022671 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR6, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP022665 Rhizobium leguminosarum bv. viciae strain BIHB 1217 chromosome, complete genome 3 crisprs WYL,csa3,cas3,DEDDh,Cas9_archaeal,PD-DExK 0 3 9 0

Results visualization

1. NZ_CP022668
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 537397 : 546506 9 Planktothrix_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP022671
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4165 : 12380 17 Sinorhizobium_phage(50.0%) integrase attL 4381:4394|attR 13993:14006
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP022665
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022665_1 1188880-1188959 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022665_2 1241034-1241121 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022665_3 1678963-1679036 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 954009-954036 4 0.857
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 706492-706519 5 0.821
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 181656-181683 5 0.821
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 704241-704268 5 0.821
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 222756-222783 5 0.821
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1493215-1493242 5 0.821
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1944454-1944481 5 0.821
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1372448-1372475 5 0.821
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 367050-367077 5 0.821
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 865856-865883 5 0.821
NZ_CP022665_3 3.1|1678986|28|NZ_CP022665|CRISPRCasFinder 1678986-1679013 28 NZ_CP011518 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence 168375-168402 5 0.821
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1350916-1350943 6 0.786
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 1321840-1321867 6 0.786
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 1324318-1324345 6 0.786
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 622202-622229 6 0.786
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP021029 Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence 258416-258443 6 0.786
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 30844-30871 6 0.786
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 29755-29782 6 0.786
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP013515 Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence 253950-253977 6 0.786
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP013605 Rhizobium sp. N731 plasmid pRspN731d, complete sequence 253944-253971 6 0.786
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 399798-399825 6 0.786
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 898771-898798 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 627482-627509 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 163510-163537 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 899770-899797 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 163305-163332 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 224931-224958 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 530981-531008 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 1398593-1398620 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 157355-157382 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 627484-627511 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 524866-524893 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 203335-203362 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 41479-41506 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 106596-106623 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 412720-412747 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 501809-501836 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 408468-408495 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1268104-1268131 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 37297-37324 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 806481-806508 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 946149-946176 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 858468-858495 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 160074-160101 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 111114-111141 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 1474887-1474914 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP050087 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence 224942-224969 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP050087 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence 529765-529792 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 104502-104529 7 0.75
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 311183-311210 8 0.714
NZ_CP022665_2 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder 1241064-1241091 28 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 2033659-2033686 8 0.714
NZ_CP022665_1 1.1|1188903|34|NZ_CP022665|CRISPRCasFinder 1188903-1188936 34 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 179879-179912 9 0.735

1. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 4, identity: 0.857

cacacttttcctggaattgcctctaacc	CRISPR spacer
cgcacttttcctggaattgcttctagct	Protospacer
*.******************.****.*.

2. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 5, identity: 0.821

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaagtgccctaatcc	Protospacer
**************** ****.. * **

3. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821

cacacttttcctggaattgcctctaacc	CRISPR spacer
cgcacttttcctggaattgcttttaata	Protospacer
*.******************.*.***. 

4. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 5, identity: 0.821

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaagtgccctaatcc	Protospacer
**************** ****.. * **

5. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.821

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaagtgccctaatcc	Protospacer
**************** ****.. * **

6. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.821

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaagtgccctaatcc	Protospacer
**************** ****.. * **

7. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.821

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctccaagcg	Protospacer
********************..* *.* 

8. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.821

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaagtgccctaatcc	Protospacer
**************** ****.. * **

9. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 5, identity: 0.821

cacacttttcctggaattgcctctaacc	CRISPR spacer
cgcacttttcctggaattgcttcagccc	Protospacer
*.******************.** . **

10. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 5, identity: 0.821

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaagtgccctaatcc	Protospacer
**************** ****.. * **

11. spacer 3.1|1678986|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 5, identity: 0.821

gattgatttgaagtacgcaatcccggac	CRISPR spacer
ccgtgatttgaagtgcggaatcccggac	Protospacer
   ***********.** **********

12. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 6, identity: 0.786

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgccccagggt	Protospacer
*********************.* .. .

13. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 6, identity: 0.786

cacacttttcctggaattgcctctaacc	CRISPR spacer
cgcacttttcctgaaattgcctcagaga	Protospacer
*.***********.********* .*  

14. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 6, identity: 0.786

cacacttttcctggaattgcctctaacc	CRISPR spacer
cgcacttttcctgaaattgcctcagaga	Protospacer
*.***********.********* .*  

15. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 6, identity: 0.786

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctaagcg	Protospacer
********************... *.* 

16. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP021029 (Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence) position: , mismatch: 6, identity: 0.786

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctgaaag	Protospacer
********************... **  

17. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 6, identity: 0.786

cacacttttcctggaattgcctctaacc--	CRISPR spacer
cacacttttcctggaattgc--tcaattga	Protospacer
********************  ..**..  

18. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 6, identity: 0.786

cacacttttcctggaattgcctctaacc--	CRISPR spacer
cacacttttcctggaattgc--tcaattga	Protospacer
********************  ..**..  

19. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP013515 (Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence) position: , mismatch: 6, identity: 0.786

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctgaaag	Protospacer
********************... **  

20. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP013605 (Rhizobium sp. N731 plasmid pRspN731d, complete sequence) position: , mismatch: 6, identity: 0.786

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctgaaag	Protospacer
********************... **  

21. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 6, identity: 0.786

cacacttttcctggaattgcctctaacc	CRISPR spacer
cgcacttttcctggaattgcttttagaa	Protospacer
*.******************.*.**.  

22. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cgcacttttcctggaattgcctgaggat	Protospacer
*.********************  .. .

23. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctgaggg	Protospacer
********************... *.  

24. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctagttc	Protospacer
********************... . .*

25. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cgcacttttcctggaattgcctgaggat	Protospacer
*.********************  .. .

26. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctaggtc	Protospacer
********************... ...*

27. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctaggtc	Protospacer
********************... ...*

28. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctgaggg	Protospacer
********************... *.  

29. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctagttc	Protospacer
********************... . .*

30. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctagttc	Protospacer
********************... . .*

31. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctgaggg	Protospacer
********************... *.  

32. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctgaggg	Protospacer
********************... *.  

33. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctgaggg	Protospacer
********************... *.  

34. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctggatg	Protospacer
********************... .*. 

35. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctgaggg	Protospacer
********************... *.  

36. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctaggtc	Protospacer
********************... ...*

37. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctagttc	Protospacer
********************... . .*

38. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctagttc	Protospacer
********************... . .*

39. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctagttc	Protospacer
********************... . .*

40. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctagttc	Protospacer
********************... . .*

41. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctagttc	Protospacer
********************... . .*

42. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctagttc	Protospacer
********************... . .*

43. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctagttc	Protospacer
********************... . .*

44. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctaggtc	Protospacer
********************... ...*

45. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctagttc	Protospacer
********************... . .*

46. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctagttc	Protospacer
********************... . .*

47. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctaggtc	Protospacer
********************... ...*

48. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctctgaggg	Protospacer
********************... *.  

49. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.75

cacacttttcctggaattgcctctaacc	CRISPR spacer
tacacttttcctggaagtgcctagcttc	Protospacer
.*************** *****    .*

50. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.714

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctggaggag	Protospacer
********************.   ..  

51. spacer 2.1|1241064|28|NZ_CP022665|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.714

cacacttttcctggaattgcctctaacc	CRISPR spacer
cacacttttcctggaattgctggaggag	Protospacer
********************.   ..  

52. spacer 1.1|1188903|34|NZ_CP022665|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 9, identity: 0.735

ccatgctttaatagtgggagcatgatgttgcccg	CRISPR spacer
tctaaattatatagttggagcatgatgttgtccg	Protospacer
.*  . **  ***** **************.***

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5490 : 12469 13 uncultured_Caudovirales_phage(16.67%) integrase attL 4854:4868|attR 19522:19536
DBSCAN-SWA_2 59892 : 73274 13 uncultured_Mediterranean_phage(90.91%) tRNA NA
DBSCAN-SWA_3 418997 : 429707 7 Synechococcus_phage(16.67%) protease NA
DBSCAN-SWA_4 2787634 : 2797567 9 Mycobacterium_phage(25.0%) NA NA
DBSCAN-SWA_5 3135011 : 3150804 27 Sinorhizobium_phage(16.67%) NA NA
DBSCAN-SWA_6 3693507 : 3707310 9 Vibrio_phage(25.0%) NA NA
DBSCAN-SWA_7 4226850 : 4284123 74 Rhizobium_phage(30.77%) terminase,portal,capsid,integrase,protease,plate,tail,tRNA,head attL 4223687:4223702|attR 4238141:4238156
DBSCAN-SWA_8 4830926 : 4841192 9 uncultured_Mediterranean_phage(83.33%) NA NA
DBSCAN-SWA_9 5034677 : 5064097 42 Sinorhizobium_phage(75.0%) tail,terminase,coat,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP022669
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022669_1 136387-136494 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP022669_1 1.1|136413|56|NZ_CP022669|CRISPRCasFinder 136413-136468 56 NZ_CP022669 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR4, complete sequence 136413-136468 0 1.0
NZ_CP022669_1 1.1|136413|56|NZ_CP022669|CRISPRCasFinder 136413-136468 56 NZ_CP016292 Rhizobium leguminosarum strain Vaf10 plasmid unnamed4, complete sequence 228302-228357 2 0.964
NZ_CP022669_1 1.1|136413|56|NZ_CP022669|CRISPRCasFinder 136413-136468 56 NZ_CP018231 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed3 237420-237475 5 0.911

1. spacer 1.1|136413|56|NZ_CP022669|CRISPRCasFinder matches to NZ_CP022669 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR4, complete sequence) position: , mismatch: 0, identity: 1.0

cgctctagttcagtatcagacatctttaatctccttcacgtattccagcaggctga	CRISPR spacer
cgctctagttcagtatcagacatctttaatctccttcacgtattccagcaggctga	Protospacer
********************************************************

2. spacer 1.1|136413|56|NZ_CP022669|CRISPRCasFinder matches to NZ_CP016292 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.964

cgctctagttcagtatcagacatctttaatctccttcacgtattccagcaggctga	CRISPR spacer
cgctctagttcaatatcagacatgtttaatctccttcacgtattccagcaggctga	Protospacer
************.********** ********************************

3. spacer 1.1|136413|56|NZ_CP022669|CRISPRCasFinder matches to NZ_CP018231 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed3) position: , mismatch: 5, identity: 0.911

cgctctagttcagtatcagacatctttaatctccttcacgtattccagcaggctga	CRISPR spacer
ggtactagttcaatatcagacatgtttaatctccttcacgtattccagcaggctga	Protospacer
 *. ********.********** ********************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage