1. spacer 21.2|5229569|25|NZ_CP022655|CRISPRCasFinder matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 2, identity: 0.92
cgtcggagccggacttgccgacggt CRISPR spacer
cgtcggagccggactcgccgacgga Protospacer
***************.********
2. spacer 20.1|5121354|25|NZ_CP022655|CRISPRCasFinder matches to MG945582 (UNVERIFIED: Microviridae sp. isolate 3819-1801, complete genome) position: , mismatch: 3, identity: 0.88
atgatgaaatccttgattttgagcc CRISPR spacer
atgatgaaagtcttgattttgagtc Protospacer
********* .************.*
3. spacer 21.2|5229569|25|NZ_CP022655|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 3, identity: 0.88
cgtcggagccggacttgccgacggt CRISPR spacer
cgtcggagtcggacttgccgacaat Protospacer
********.*************..*
4. spacer 21.2|5229569|25|NZ_CP022655|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 3, identity: 0.88
cgtcggagccggacttgccgacggt CRISPR spacer
cgtcggagtcggacttgccgacaat Protospacer
********.*************..*
5. spacer 21.2|5229569|25|NZ_CP022655|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 3, identity: 0.88
cgtcggagccggacttgccgacggt CRISPR spacer
cgtcggagtcggacttgccgacaat Protospacer
********.*************..*
6. spacer 21.2|5229569|25|NZ_CP022655|CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.88
cgtcggagccggacttgccgacggt CRISPR spacer
cgtcgaagccggccttgccgacgat Protospacer
*****.****** **********.*
7. spacer 1.1|49448|25|NZ_CP022655|CRISPRCasFinder matches to MF417945 (Uncultured Caudovirales phage clone 3S_15, partial genome) position: , mismatch: 4, identity: 0.84
ctcctaaaataggtttttcgcaaat CRISPR spacer
accctaaaagcggtttttcgcaaat Protospacer
.******* **************
8. spacer 20.1|5121354|25|NZ_CP022655|CRISPRCasFinder matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 4, identity: 0.84
atgatgaaatccttgattttgagcc CRISPR spacer
ctgatgaaatccctgattttgacca Protospacer
***********.********* *
9. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871
agccggcgc-gctgctcggcgtcggcgcgctg CRISPR spacer
-gctggggctgctgctgggcgtcggcgcgctg Protospacer
**.** ** ****** ***************
10. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.871
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgtcggcgcgctggtcggcggcggcgcgctg Protospacer
*.********** ****** **********
11. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871
agccggcgc-gctgctcggcgtcggcgcgctg CRISPR spacer
-gctggggctgctgctgggcgtcggcgcgctg Protospacer
**.** ** ****** ***************
12. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.871
agccggcgc-gctgctcggcgtcggcgcgctg CRISPR spacer
-gctggggctgctgctgggcgtcggcgcgctg Protospacer
**.** ** ****** ***************
13. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871
agccggcgc-gctgctcggcgtcggcgcgctg CRISPR spacer
-gctggggctgctgctgggcgtcggcgcgctg Protospacer
**.** ** ****** ***************
14. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871
agccggcgc-gctgctcggcgtcggcgcgctg CRISPR spacer
-gctggggctgctgctgggcgtcggcgcgctg Protospacer
**.** ** ****** ***************
15. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871
agccggcgc-gctgctcggcgtcggcgcgctg CRISPR spacer
-gctggggctgctgctgggcgtcggcgcgctg Protospacer
**.** ** ****** ***************
16. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871
agccggcgc-gctgctcggcgtcggcgcgctg CRISPR spacer
-gctggggctgctgctgggcgtcggcgcgctg Protospacer
**.** ** ****** ***************
17. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 4, identity: 0.871
agccg-gcgcgctgctcggcgtcggcgcgctg CRISPR spacer
-gctgcgcgcgctgctcggcggcggcgcgccg Protospacer
**.* *************** ********.*
18. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871
agccggcgc-gctgctcggcgtcggcgcgctg CRISPR spacer
-gctggggctgctgctgggcgtcggcgcgctg Protospacer
**.** ** ****** ***************
19. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.871
agccgg-cgcgctgctcggcgtcggcgcgctg CRISPR spacer
-gcaggtcgcgctgttcgccgtcggcgcgctg Protospacer
** ** *******.*** *************
20. spacer 21.2|5229569|25|NZ_CP022655|CRISPRCasFinder matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 4, identity: 0.84
cgtcggagccggacttgccgacggt CRISPR spacer
cgtcgtagccggacttgccgaccag Protospacer
***** **************** .
21. spacer 21.2|5229569|25|NZ_CP022655|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 4, identity: 0.84
cgtcggagccggacttgccgacggt CRISPR spacer
cgtcgtagccggacttgccgaccag Protospacer
***** **************** .
22. spacer 21.2|5229569|25|NZ_CP022655|CRISPRCasFinder matches to NZ_CP025809 (Sulfitobacter sp. SK025 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
cgtcggagccggacttgccgacggt CRISPR spacer
ggtcggggccggacttgccgatggc Protospacer
*****.**************.**.
23. spacer 21.2|5229569|25|NZ_CP022655|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.84
cgtcggagccggacttgccgacggt CRISPR spacer
ccacggaaccggacttgccgacgga Protospacer
* ****.****************
24. spacer 21.2|5229569|25|NZ_CP022655|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cgtcggagccggacttgccgacggt CRISPR spacer
cgtcatagccggacttgccgacgag Protospacer
****. *****************.
25. spacer 21.2|5229569|25|NZ_CP022655|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84
cgtcggagccggacttgccgacggt CRISPR spacer
gatcgttgccggacttgccgacggt Protospacer
.*** ******************
26. spacer 21.2|5229569|25|NZ_CP022655|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 4, identity: 0.84
cgtcggagccggacttgccgacggt CRISPR spacer
cgtcatagccggacttgccgacgag Protospacer
****. *****************.
27. spacer 5.1|868895|26|NZ_CP022655|CRISPRCasFinder matches to NZ_LR699556 (Paraburkholderia sp. Msb3 isolate PDMSB31 plasmid pII) position: , mismatch: 5, identity: 0.808
aatgccaaaagcttcgaattcggcca CRISPR spacer
aatgccaaccgcttcgaattcggtac Protospacer
******** *************.
28. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
29. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
30. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
31. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
32. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
33. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
34. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
35. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
36. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
37. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
38. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
39. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
40. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
41. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
42. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
43. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
44. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
45. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
46. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
47. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
48. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
49. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
50. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
51. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
52. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
53. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
54. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
55. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
56. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
57. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
58. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
59. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
60. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
61. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
62. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
63. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
64. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
65. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
66. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
67. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
68. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
69. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
70. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
71. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
72. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
73. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
74. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
75. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
76. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
77. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
78. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
79. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
80. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
81. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
82. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
83. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
84. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
85. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
86. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
87. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
88. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
89. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
90. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
91. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
92. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
93. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
94. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
95. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
96. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
97. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
98. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
99. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
100. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
101. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
102. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctcggcgtcggcgcgcac Protospacer
...**************************
103. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to AY328852 (Vibrio parahaemolyticus phage VP16T, partial sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
agccgacgcgctgctcggcgtaggcggggcg Protospacer
*****.*************** **** * .*
104. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg- CRISPR spacer
cggcggcgcgctgctcggcttcggcg-gcggc Protospacer
* **************** ****** ** *
105. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggc-gcgctg CRISPR spacer
cgcccgggcgctgctcggcgtcggcggcgcc- Protospacer
*** * ****************** ****.
106. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggc-gcgctg CRISPR spacer
cgcccgggcgctgctcggcgtcggcggcgcc- Protospacer
*** * ****************** ****.
107. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggc-gcgctg CRISPR spacer
cgcccgggcgctgctcggcgtcggcggcgcc- Protospacer
*** * ****************** ****.
108. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcg-cgctgctcggcgtcggcgcgctg CRISPR spacer
-gctcgcgtcgcggctcggcgccggcgcgctg Protospacer
**. *** *** ********.**********
109. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_MN366361 (Bacterium plasmid pALTS33, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggcat---cgcgctggct Protospacer
.******************.* *******
110. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggcat---cgcgctggct Protospacer
.******************.* *******
111. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 5, identity: 0.839
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggcat---cgcgctggct Protospacer
.******************.* *******
112. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 5, identity: 0.839
agccggc-gcgctgctcggcgtcggcgcgctg CRISPR spacer
-cccggtggcgctgatcggcgtcggtgcgctg Protospacer
****. ****** **********.******
113. spacer 21.2|5229569|25|NZ_CP022655|CRISPRCasFinder matches to NZ_CP030829 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence) position: , mismatch: 5, identity: 0.8
cgtcggagccggacttgccgacggt CRISPR spacer
gctcggagccggacttgtcgacgcg Protospacer
***************.*****
114. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
115. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
116. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
117. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
118. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
119. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
120. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
121. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
122. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
123. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
124. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
125. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
126. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
127. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
128. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
129. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
130. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
131. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
132. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
133. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
134. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
135. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
136. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
137. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
138. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
139. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
140. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
141. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
142. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
143. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
144. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
145. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
146. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
147. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
148. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
149. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
150. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
151. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
152. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
153. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
154. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
155. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
156. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
157. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
158. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
159. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
160. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
161. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
162. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
163. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
164. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
165. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
166. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
167. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
168. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
169. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
170. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
171. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
172. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
173. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
174. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
175. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
176. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctgggcgtcggcgcgcac Protospacer
...************ *************
177. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggcggcgcgctgctcggcgtgggcgtggcg Protospacer
.* ****************** ****.* .*
178. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cggcttcacgctgctcggcgtcggcgggctg Protospacer
* * *.****************** ****
179. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.806
-agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
catgctgc-cgctgctcggcgtcggcgtgctc Protospacer
* * ** ******************.***
180. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctgggcgtcggcgcgcac Protospacer
...************ *************
181. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctgggcgtcggcgcgcac Protospacer
...************ *************
182. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctgggcgtcggcgcgcac Protospacer
...************ *************
183. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctgggcgtcggcgcgcac Protospacer
...************ *************
184. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctgggcgtcggcgcgcac Protospacer
...************ *************
185. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctgggcgtcggcgcgcac Protospacer
...************ *************
186. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcgctgctgggcgtcggcgcgcac Protospacer
...************ *************
187. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP006370 (Aureimonas sp. AU20 plasmid pAU20c, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
tttcggcgcgctgatcggcggcggcgcgctc Protospacer
.********** ****** *********
188. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg- CRISPR spacer
cgaaggcgcgctgctcggcgtcgtcg-gcggc Protospacer
* ******************* ** ** *
189. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg--- CRISPR spacer
ggccggcgcgctgctcggctt---cgtgctgacc Protospacer
.****************** * **.****
190. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to MF377440 (Mycobacterium phage Bella96, complete genome) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cctcggcgggctgctcggcggcggcgcgcgg Protospacer
.***** *********** ******** *
191. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP018476 (Xanthomonas perforans strain LH3 plasmid pLH3.2, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
192. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP018476 (Xanthomonas perforans strain LH3 plasmid pLH3.2, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
193. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP030170 (Xanthomonas citri pv. punicae strain BD0025 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
194. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP030162 (Xanthomonas citri pv. punicae strain BD0023 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
195. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP017191 (Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
196. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP017191 (Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
197. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP017324 (Xanthomonas campestris pv. campestris str. CN15 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
198. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP018463 (Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.2, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
199. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP018463 (Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.2, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
200. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP030165 (Xanthomonas citri pv. punicae strain LMG7439 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
201. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP030165 (Xanthomonas citri pv. punicae strain LMG7439 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
202. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NC_016053 (Xanthomonas arboricola pv. pruni str. CFBP 5530 plasmid pXap41, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
203. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP026110 (Paraburkholderia hospita strain DSM 17164 plasmid pEMT1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
aaacggggcgctgctcgtcgtcggcgcgttc Protospacer
*. *** ********** **********.*
204. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcg-cgctg CRISPR spacer
tgccgacgcgctgctcggcgacggcgacacc- Protospacer
****.************** ***** *.*.
205. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggcggcgcgctgttcggcgtaggcgcgtag Protospacer
.* **********.******* ******. *
206. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgccggcgcgctgctcggcggcgccggcctc Protospacer
******************* ** ** **
207. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to AP019683 (Xanthomonas campestris pv. campestris MAFF106712 pXcc1 plasmid DNA, complete genome) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
208. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to AP019683 (Xanthomonas campestris pv. campestris MAFF106712 pXcc1 plasmid DNA, complete genome) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
209. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP018472 (Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
210. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022994 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN4, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
aaacggggcgctgctcgtcgtcggcgcgttc Protospacer
*. *** ********** **********.*
211. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP030179 (Xanthomonas citri pv. punicae strain LMG 859 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
212. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cggcctcgcgctgctcgtcctcggcgcgctg Protospacer
* * *********** * ***********
213. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP030160 (Xanthomonas citri pv. punicae strain BD0022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
214. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP017322 (Xanthomonas campestris pv. campestris str. CN18 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
215. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP017322 (Xanthomonas campestris pv. campestris str. CN18 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
216. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022266 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plB, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
217. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcg-cgctg CRISPR spacer
cgccgacgcgctgctcggcggcggcgacacc- Protospacer
****.************** ***** *.*.
218. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP030167 (Xanthomonas citri pv. punicae strain LMG7504 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
219. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NC_007507 (Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid pXCV183, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
220. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NC_007507 (Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid pXCV183, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
221. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP017309 (Xanthomonas campestris pv. campestris str. CN03 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
222. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP017309 (Xanthomonas campestris pv. campestris str. CN03 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgcgctcgcgctgctgggcgtcggcccgctg Protospacer
** ********* ********* *****
223. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
agccggcgcgctgctcggcctcctgccgcag Protospacer
******************* ** *** *
224. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP032928 (Agrobacterium tumefaciens strain 1D1460 plasmid pAt1D1460, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggcgcggcgctgctcggcgttcgcgcgctg Protospacer
.* ** **************. ********
225. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806
--agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgggctg--gcgatgctcggcgccggcgcgctg Protospacer
.**.* *** *********.**********
226. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcgg-cgcgctg CRISPR spacer
ggccggcgcgctgctcggcgccagcctcgcc- Protospacer
.*******************.*.* * ***.
227. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806
--agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgggctg--gcgatgctcggcgccggcgcgctg Protospacer
.**.* *** *********.**********
228. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to MT521991 (Streptomyces phage Eklok, complete genome) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggcggcgcggtgctcggcgtcggcaggttg Protospacer
.* ******* **************. *.**
229. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to MT521991 (Streptomyces phage Eklok, complete genome) position: , mismatch: 6, identity: 0.806
agccggc--gcgctgctcggcgtcggcgcgctg CRISPR spacer
--cctgcttgccctgctcggcggcggcgcgctt Protospacer
** ** ** ********** *********
230. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to MT451981 (Streptomyces phage Vondra, complete genome) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggcggcgcggtgctcggcgtcggcaggttg Protospacer
.* ******* **************. *.**
231. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to MT451982 (Streptomyces phage Cumberbatch, complete genome) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggcggcgcggtgctcggcgtcggcaggttg Protospacer
.* ******* **************. *.**
232. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP019938 (Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cggcgcagcgctgctcggcgcaggcgcgctg Protospacer
* ** *************. *********
233. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
ggctgttgcgctgctcgccgccggcgcgctg Protospacer
.**.* .********** **.**********
234. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP045385 (Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgc-gctg CRISPR spacer
catcggcgcgttgcccggcgtcggcgctgct- Protospacer
..*******.***.************ ***
235. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcggcgc-gctg CRISPR spacer
catcggcgcgttgcccggcgtcggcgctgct- Protospacer
..*******.***.************ ***
236. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.806
agccgg--cgcgctgctcggcgtcggcgcgctg CRISPR spacer
--ccgggtagcgctgctcggtgtcggcgccctc Protospacer
**** ***********.******** **
237. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 6, identity: 0.806
-agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
tgacccgc-cgctgctcggcgtcgacgcgatg Protospacer
..** ** ***************.**** **
238. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP034087 (Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence) position: , mismatch: 6, identity: 0.806
agccggcgcgctgctcggcgtcg----gcgcgctg CRISPR spacer
agccggcgagatgctcggcgtcgcgcagcgc---- Protospacer
******** * ************ ****
239. spacer 6.2|897367|30|NZ_CP022655|CRT matches to NZ_CP050096 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b3, complete sequence) position: , mismatch: 7, identity: 0.767
tagaaattcggatggacgccgtggc---tccag CRISPR spacer
gcgaaattcggatcgacgccctggcggatc--- Protospacer
*********** ****** **** **
240. spacer 6.2|897367|30|NZ_CP022655|CRT matches to NZ_CP050102 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b2, complete sequence) position: , mismatch: 7, identity: 0.767
tagaaattcggatggacgccgtggc---tccag CRISPR spacer
gcgaaattcggatcgacgccctggcggatc--- Protospacer
*********** ****** **** **
241. spacer 6.2|897367|30|NZ_CP022655|CRT matches to NZ_CP050107 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b1, complete sequence) position: , mismatch: 7, identity: 0.767
tagaaattcggatggacgccgtggc---tccag CRISPR spacer
gcgaaattcggatcgacgccctggcggatc--- Protospacer
*********** ****** **** **
242. spacer 6.2|897367|30|NZ_CP022655|CRT matches to NZ_CP050112 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b5, complete sequence) position: , mismatch: 7, identity: 0.767
tagaaattcggatggacgccgtggc---tccag CRISPR spacer
gcgaaattcggatcgacgccctggcggatc--- Protospacer
*********** ****** **** **
243. spacer 6.2|897367|30|NZ_CP022655|CRT matches to NZ_CP053444 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eB, complete sequence) position: , mismatch: 7, identity: 0.767
tagaaattcggatggacgccgtggc---tccag CRISPR spacer
gcgaaattcggatcgacgccctggcggatc--- Protospacer
*********** ****** **** **
244. spacer 6.4|897468|28|NZ_CP022655|CRT matches to NC_012849 (Ralstonia pickettii 12D plasmid pRp12D02, complete sequence) position: , mismatch: 7, identity: 0.75
ttgagagggaacacaactgcggctccgg CRISPR spacer
gcttgagagaacacaagtgcggctccgt Protospacer
. ***.******** **********
245. spacer 16.21|4795498|35|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015372 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.8
gcgccagcagggagagatcgagcgcctacagcaag- CRISPR spacer
gctccagcagggcgagatcgagcgcgt-cggcgata Protospacer
** ********* ************ * *.**.*
246. spacer 16.23|4795633|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 7, identity: 0.794
tccatctac-caagcttttggactgggccaaaggt CRISPR spacer
-agatatatacaagcttttggactgacccaaaggt Protospacer
** **. ***************. ********
247. spacer 16.39|4796709|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ggaaggcgcgatcaatgaggtgctgagcgatgac- CRISPR spacer
gaaaggcgcgacaaatgaggtgctgatccg-gaca Protospacer
*.*********. ************* * . ***
248. spacer 17.28|4807303|34|NZ_CP022655|PILER-CR,CRISPRCasFinder,CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 7, identity: 0.794
aagctcggcgacctgatcgtcacga----cgcacatcc CRISPR spacer
aagctcgccgacctgatcgtcgcgaacgccgaac---- Protospacer
******* *************.*** ** **
249. spacer 17.32|4807570|33|NZ_CP022655|PILER-CR,CRISPRCasFinder,CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 7, identity: 0.788
tccaccagttcccgaagggcaaactctgcttta CRISPR spacer
tccaccaggtcccgaagggccaacaggacttca Protospacer
******** *********** *** .***.*
250. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcactgctgggcgtcggcgcgcac Protospacer
...******.***** *************
251. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcactgctgggcgtcggcgcgcac Protospacer
...******.***** *************
252. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcactgctgggcgtcggcgcgcac Protospacer
...******.***** *************
253. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcactgctgggcgtcggcgcgcac Protospacer
...******.***** *************
254. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gttcggcgcgctgctgggcggcggcgcgcgc Protospacer
. .************ **** ********
255. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggcgcactgctgggcgtcggcgcgcac Protospacer
...******.***** *************
256. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gttcggcgcgctgctgggcggcggcgcgcgc Protospacer
. .************ **** ********
257. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gttcggcgcgctgctgggcggcggcgcgcgc Protospacer
. .************ **** ********
258. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cctcggcgagctgctcgtcgtcggcgcgcgt Protospacer
.***** ******** ***********
259. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
aggcggcgcgctgctcggcgtcgtggcaggc Protospacer
** ******************** **.
260. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gttcggcgcgctgctgggcggcggcgcgcgc Protospacer
. .************ **** ********
261. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcggagcgctgctcggcgtcggcgcacat Protospacer
...*** ********************.*
262. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gttcggcgcgctgctgggcggcggcgcgcgc Protospacer
. .************ **** ********
263. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gttcggcgcgctgctgggcggcggcgcgcgc Protospacer
. .************ **** ********
264. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cggcggcgcgctgctcggcctcggctggaag Protospacer
* **************** ***** * *
265. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gaacggcgcgctgcttgtcgtcggcgcgttc Protospacer
.. ************.* **********.*
266. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP058906 (Micromonospora phage pMLP1, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cggcggcgtgctgctcggcggcggcgcgacc Protospacer
* *****.*********** ******* .
267. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcg-cgctg CRISPR spacer
ctacgccgcgctgctcggcgtccgcgtcgcc- Protospacer
** **************** *** ***.
268. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to AY328853 (Vibrio parahaemolyticus phage VP16C, partial sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
ggccgacgcgctgctcggcgtaggcggcgcg Protospacer
.****.*************** **** .*
269. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to KF854250 (UNVERIFIED: Vibrio phage VP_EVC_2013, partial genome) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
ggccgacgcgctgctcggcgtaggcggcgcg Protospacer
.****.*************** **** .*
270. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022317 (Brachybacterium avium strain VR2415 plasmid unnamed1) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cggcatcgccctgctcgtcgtcggcgcgctc Protospacer
* *. *** ******* ************
271. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cggcggagcgctgttcggcgtcggcgagttc Protospacer
* *** ******.************ *.*
272. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cggcggagcgctgttcggcgtcggcgagttc Protospacer
* *** ******.************ *.*
273. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cggcggcgcgctgctcggcttcggctggaag Protospacer
* **************** ***** * *
274. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggc------gtcggcgcgctg CRISPR spacer
ggccggcgcgctgctcggcggcgtggtcggc------ Protospacer
.****************** ******
275. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP008890 (Dermacoccus nishinomiyaensis strain M25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gaccatcccgctgctcggcgccggcgcgctc Protospacer
..**. * ************.*********
276. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP032357 (Klebsiella variicola strain 15WZ-82 plasmid p15WZ-82_res, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
atgcagcgcgctgctcggcgtcgtcgccata Protospacer
* *.****************** *** *.
277. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP009293 (Novosphingobium pentaromativorans US6-1 plasmid pLA4, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggc-gcgctg CRISPR spacer
ttgcggcgcgctgctcggcgttggcttcgcc- Protospacer
******************.*** ***.
278. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
ggcgagcgcgctgcccggcggcggcgcggcg Protospacer
.** .*********.***** ******* .*
279. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
ctccggcgcgctgatcggcgtccgcaagcgg Protospacer
*********** ******** **. ** *
280. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP048816 (Caulobacter rhizosphaerae strain KCTC 52515 plasmid unnamed) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg- CRISPR spacer
gaacggcaagctgctcggcgtcggcg-gcgga Protospacer
.. ****. ***************** ** *
281. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP017148 (Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
agccgg--cgcgctgctcggcgtcggcgcgctg CRISPR spacer
--gcggttcgcgctgctcggcgacggctcgcgt Protospacer
*** ************** **** ***
282. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP009547 (Burkholderia sp. 2002721687 plasmid pBTU, complete sequence) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgacagcgcgctgttcggcgtcgccgcgtcg Protospacer
* *.********.********* ****..*
283. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to MN813676 (Arthrobacter phage Adolin, complete genome) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcg-cgctg CRISPR spacer
gagcggcgcggtcctcggcgtcggcgacgtt- Protospacer
.. ******* * ************* **.*
284. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 7, identity: 0.774
agccg--gcgcgctgctcggcgtcggcgcgctg CRISPR spacer
--tcggtgcgcgctgctcgtcgtcgtcgcggcg Protospacer
.** ************ ***** **** .*
285. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to MN908689 (Arthrobacter phage DrSierra, complete genome) position: , mismatch: 7, identity: 0.774
agccggcgcgctgctcggcgtcggcg-cgctg CRISPR spacer
gcgcggcgcggtcctcggcgtcggcgacgtt- Protospacer
. ******* * ************* **.*
286. spacer 6.2|897367|30|NZ_CP022655|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.733
tagaaattcggatggacgccgtggctccag CRISPR spacer
gccgagatcggatggacaccgtggctgcag Protospacer
.*. **********.******** ***
287. spacer 6.2|897367|30|NZ_CP022655|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 8, identity: 0.733
tagaaattcggatggacgccgtggctccag CRISPR spacer
gccgagatcggatggacaccgtggctgcag Protospacer
.*. **********.******** ***
288. spacer 16.7|4794553|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to AF493143 (Pseudomonas phage gh-1, complete sequence) position: , mismatch: 8, identity: 0.765
tgtcgttgtaggctgcgagttcgtccttcggtag CRISPR spacer
tgtcgttgatggctgcgagttcgtcatctgtttc Protospacer
******** *************** *..* *
289. spacer 16.7|4794553|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to MN729598 (Pseudomonas phage CHF21, complete genome) position: , mismatch: 8, identity: 0.765
tgtcgttgtaggctgcgagttcgtccttcggtag CRISPR spacer
tgtcgttgatggctgcgagttcgtcatctgtttc Protospacer
******** *************** *..* *
290. spacer 16.7|4794553|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to MN729595 (Pseudomonas phage CHF1, complete genome) position: , mismatch: 8, identity: 0.765
tgtcgttgtaggctgcgagttcgtccttcggtag CRISPR spacer
tgtcgttgatggctgcgagttcgtcatctgtttc Protospacer
******** *************** *..* *
291. spacer 16.7|4794553|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to MN729596 (Pseudomonas phage CHF7, complete genome) position: , mismatch: 8, identity: 0.765
tgtcgttgtaggctgcgagttcgtccttcggtag CRISPR spacer
tgtcgttgatggctgcgagttcgtcatctgtttc Protospacer
******** *************** *..* *
292. spacer 16.7|4794553|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to NC_047826 (Pseudomonas virus WRT, complete genome) position: , mismatch: 8, identity: 0.765
tgtcgttgtaggctgcgagttcgtccttcggtag CRISPR spacer
tgtcgttgatggctgcgagttcgtcatctgtttc Protospacer
******** *************** *..* *
293. spacer 16.7|4794553|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to MT104466 (Pseudomonas phage MR2, complete genome) position: , mismatch: 8, identity: 0.765
tgtcgttgtaggctgcgagttcgtccttcggtag CRISPR spacer
tgtcgttgatggctgcgagttcgtcatctgtttc Protospacer
******** *************** *..* *
294. spacer 16.7|4794553|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to MG250485 (Pseudomonas virus Pf1 ERZ-2017, complete genome) position: , mismatch: 8, identity: 0.765
tgtcgttgtaggctgcgagttcgtccttcggtag CRISPR spacer
tgtcgttgatggctgcgagttcgtcatctgtttc Protospacer
******** *************** *..* *
295. spacer 16.7|4794553|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to NC_004665 (Pseudomonas phage gh-1, complete genome) position: , mismatch: 8, identity: 0.765
tgtcgttgtaggctgcgagttcgtccttcggtag CRISPR spacer
tgtcgttgatggctgcgagttcgtcatctgtttc Protospacer
******** *************** *..* *
296. spacer 16.7|4794553|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to NC_047827 (Pseudomonas virus KNP, complete genome) position: , mismatch: 8, identity: 0.765
tgtcgttgtaggctgcgagttcgtccttcggtag CRISPR spacer
tgtcgttgatggctgcgagttcgtcatctgtttc Protospacer
******** *************** *..* *
297. spacer 16.7|4794553|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to LN913017 (Pseudomonas phage HC15b2 genome assembly HC15b2, chromosome : 1) position: , mismatch: 8, identity: 0.765
tgtcgttgtaggctgcgagttcgtccttcggtag CRISPR spacer
tgtcgttgatggctgcgagttcgtcatctgtttc Protospacer
******** *************** *..* *
298. spacer 16.7|4794553|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to MG775258 (Pseudomonas phage Henninger, complete genome) position: , mismatch: 8, identity: 0.765
tgtcgttgtaggctgcgagttcgtccttcggtag CRISPR spacer
tgtcgttgatggctgcgagttcgtcatctgtttc Protospacer
******** *************** *..* *
299. spacer 16.7|4794553|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to KU064779 (Pseudomonas phage PPPL-1, complete genome) position: , mismatch: 8, identity: 0.765
tgtcgttgtaggctgcgagttcgtccttcggtag CRISPR spacer
tgtcgttgatggctgcgagttcgtcatctgtttc Protospacer
******** *************** *..* *
300. spacer 16.7|4794553|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to NC_047747 (Pseudomonas phage phiPsa17, complete genome) position: , mismatch: 8, identity: 0.765
tgtcgttgtaggctgcgagttcgtccttcggtag CRISPR spacer
tgtcgttgatggctgcgagttcgtcatctgtttc Protospacer
******** *************** *..* *
301. spacer 16.7|4794553|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to MN729599 (Pseudomonas phage CHF33, complete genome) position: , mismatch: 8, identity: 0.765
tgtcgttgtaggctgcgagttcgtccttcggtag CRISPR spacer
tgtcgttgatggctgcgagttcgtcatctgtttc Protospacer
******** *************** *..* *
302. spacer 16.7|4794553|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to LN889756 (Pseudomonas phage shl2 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.765
tgtcgttgtaggctgcgagttcgtccttcggtag CRISPR spacer
tgtcgttgatggctgcgagttcgtcatctgtttc Protospacer
******** *************** *..* *
303. spacer 16.27|4795902|33|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to JQ807255 (Environmental Halophage eHP-36, partial genome) position: , mismatch: 8, identity: 0.758
actatctgcgtatgagcgaaacctctacctcat CRISPR spacer
actatatgcgtatgagcgagacctccccgttgc Protospacer
***** *************.*****. * *...
304. spacer 17.28|4807303|34|NZ_CP022655|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034431 (Bradyrhizobium sp. LCT2 plasmid pLCT2, complete sequence) position: , mismatch: 8, identity: 0.765
aagctcggcgacctgatcgtcacg-acgcacatcc CRISPR spacer
gaggtcgtcgacctgatcgtcacgaatgaacagg- Protospacer
.** *** **************** *.* ***
305. spacer 17.32|4807570|33|NZ_CP022655|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 8, identity: 0.758
tccaccagttcccgaagggcaaactctgcttta CRISPR spacer
tccaccaggtcccgaagggccaacaggtattca Protospacer
******** *********** *** **.*
306. spacer 17.38|4807977|35|NZ_CP022655|PILER-CR,CRISPRCasFinder,CRT matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 8, identity: 0.771
aatcctatcaacgatgaattggaccaaattgaagc CRISPR spacer
catctgttcaacgatgaagtggaccagattgaact Protospacer
***. *********** *******.****** .
307. spacer 17.59|4809399|34|NZ_CP022655|CRT matches to MN694666 (Marine virus AFVG_250M184, complete genome) position: , mismatch: 8, identity: 0.765
aacatctatgtcaccgagggcggtgtgctaatga CRISPR spacer
agcatctatgcccccgagggcggtgttgacctga Protospacer
*.********.* ************* ***
308. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcttgggctgctgctgggcgtcggcgcgctg Protospacer
. ..** .****** ***************
309. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcttgggctgctgctgggcgtcggcgcgctg Protospacer
. ..** .****** ***************
310. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcttgggctgctgctgggcgtcggcgcgctg Protospacer
. ..** .****** ***************
311. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcttgggctgctgctgggcgtcggcgcgctg Protospacer
. ..** .****** ***************
312. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcttgggctgctgctgggcgtcggcgcgctg Protospacer
. ..** .****** ***************
313. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcttgggctgctgctgggcgtcggcgcgctg Protospacer
. ..** .****** ***************
314. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcttgggctgctgctgggcgtcggcgcgctg Protospacer
. ..** .****** ***************
315. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcttgggctgctgctgggcgtcggcgcgctg Protospacer
. ..** .****** ***************
316. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcttgggctgctgctgggcgtcggcgcgctg Protospacer
. ..** .****** ***************
317. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcttgggctgctgctgggcgtcggcgcgctg Protospacer
. ..** .****** ***************
318. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcttgggctgctgctgggcgtcggcgcgctg Protospacer
. ..** .****** ***************
319. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcttgggctgctgctgggcgtcggcgcgctg Protospacer
. ..** .****** ***************
320. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcttgggctgctgctgggcgtcggcgcgctg Protospacer
. ..** .****** ***************
321. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gccgagcgcgctgctcgtcgtcgccgcggcg Protospacer
. * .************ ***** **** .*
322. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgtcggcgcgctgctcgtcctcggcgacgcg Protospacer
*.************** * ****** .*
323. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgccggcgcgctcctccgcgtcggtgaacgt Protospacer
*********** *** *******.* .*
324. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gctcggcgcgctgctcggcgcgggcgaccgg Protospacer
. .*****************. **** * *
325. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_AP018720 (Sterolibacteriaceae bacterium J5B plasmid pSTJ2, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
catgggcgcgctgctcgtcgtcggcgcggca Protospacer
.. ************* ********** ..
326. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP030170 (Xanthomonas citri pv. punicae strain BD0025 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gaacggcgcgctgcttgtcgtcggcgccttc Protospacer
.. ************.* ********* .*
327. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP030162 (Xanthomonas citri pv. punicae strain BD0023 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gaacggcgcgctgcttgtcgtcggcgccttc Protospacer
.. ************.* ********* .*
328. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP030165 (Xanthomonas citri pv. punicae strain LMG7439 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gaacggcgcgctgcttgtcgtcggcgccttc Protospacer
.. ************.* ********* .*
329. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP030165 (Xanthomonas citri pv. punicae strain LMG7439 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gaacggcgcgctgcttgtcgtcggcgccttc Protospacer
.. ************.* ********* .*
330. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
agccggcgcgctgcaccgcgtcggcctcgac Protospacer
************** * ******** .
331. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP030179 (Xanthomonas citri pv. punicae strain LMG 859 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gaacggcgcgctgcttgtcgtcggcgccttc Protospacer
.. ************.* ********* .*
332. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP030160 (Xanthomonas citri pv. punicae strain BD0022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gaacggcgcgctgcttgtcgtcggcgccttc Protospacer
.. ************.* ********* .*
333. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cggcggcgcgctcgtcggcgtcggcgacacg Protospacer
* ********* ************ .*
334. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
tctccgcgcgcagctcgtcgtcggcgcggtc Protospacer
.* ****** ***** ********** *
335. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP030167 (Xanthomonas citri pv. punicae strain LMG7504 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gaacggcgcgctgcttgtcgtcggcgccttc Protospacer
.. ************.* ********* .*
336. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP034654 (Xanthomonas vasicola pv. arecae strain NCPPB 2649 plasmid pXCARECAE29, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gaacggcgcgctgcttgtcgtcggcgccttc Protospacer
.. ************.* ********* .*
337. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gctcggcgtgctgctcggcgtcggccacccg Protospacer
. .*****.**************** *.*
338. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cctcggcgcgctgcctggcgtcggcgaccag Protospacer
.***********..********** * *
339. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP018464 (Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.1, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gaacggcgcgctgcttgtcgtcggcgccttc Protospacer
.. ************.* ********* .*
340. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP045481 (Amycolatopsis sp. YIM 10 plasmid pAmyYIM10, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gctcggcgcgctgctcggcggcggcaccgtc Protospacer
. .***************** ****.* *
341. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
catcggcgcggcgctcggcgtcggcgccatc Protospacer
..******* .*************** *
342. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
catcggcgcggcgctcggcgtcggcgccatc Protospacer
..******* .*************** *
343. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
ggccggcgcgctgttcggcgtcgtctggggc Protospacer
.************.********* * *
344. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
ggccggcgcgctgttcggcgtcgtctggggc Protospacer
.************.********* * *
345. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gttcaacgcgctgctcggcgtcgccccgctc Protospacer
. .*..***************** * ****
346. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gttcaacgcgctgctcggcgtcgccccgctc Protospacer
. .*..***************** * ****
347. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
ggccggcgcgctgctgggcgtcgcgttccag Protospacer
.************** ******* . * *
348. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP024936 (Paraburkholderia graminis strain PHS1 plasmid pPHS1_P, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
ctcgttcgcgctgctcggcggcgacgcgccg Protospacer
* ************** **.*****.*
349. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NC_022044 (Paracoccus aminophilus JCM 7686 plasmid pAMI6, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
tccgggcgcgctgcgcggcgtcggcggtgta Protospacer
* ********** *********** *.
350. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to MH371111 (Microbacterium phage Quaker, complete genome) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgccggcgcgcagctcggcgtcgtgacagtt Protospacer
********** *********** .*. *
351. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to MT498040 (Microbacterium phage Livingwater, complete genome) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgccggcgcgcagctcggcgtcgtgacagtt Protospacer
********** *********** .*. *
352. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to MH371118 (Microbacterium phage KayPaulus, complete genome) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgccggcgcgcagctcggcgtcgtgacagtt Protospacer
********** *********** .*. *
353. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to MT952850 (Microbacterium phage Sippinontea, complete genome) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgccggcgcgcagctcggcgtcgtgacagtt Protospacer
********** *********** .*. *
354. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cgttgaaccgctgctcgacgtcggcgcgttg Protospacer
*..*. *********.**********.**
355. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP025962 (Rhodococcus qingshengii strain djl-6-2 plasmid pDJL3, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
tgccggcgctctgctcggtgtcggtgtcatc Protospacer
******** ********.*****.*. *
356. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cggcaagacgctgcgcgacgtcggcgcgctg Protospacer
* *.. .****** **.*************
357. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cggcaagacgctgcgcgacgtcggcgcgctg Protospacer
* *.. .****** **.*************
358. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
agacggcgcgctgctcgccgtcgaggccgga Protospacer
** ************** *****. ** .
359. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to MH727545 (Mycobacterium phage DismalStressor, complete genome) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
caccggcgcgctgcgcggcctcggccgccag Protospacer
.************ **** ***** * *
360. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to MK524505 (Gordonia phage Dogfish, complete genome) position: , mismatch: 8, identity: 0.742
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
ccgcggcgcgcagcgcggcgtcggcggtctc Protospacer
******** ** *********** **
361. spacer 16.7|4794553|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to MT104465 (Pseudomonas phage MR1, complete genome) position: , mismatch: 9, identity: 0.735
tgtcgttgtaggctgcgagttcgtccttcggtag CRISPR spacer
tgtcgttgatggctgcgagttcgtctcctgtttc Protospacer
******** ***************....* *
362. spacer 16.14|4795023|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014865 (Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK1, complete sequence) position: , mismatch: 9, identity: 0.735
---cagatttccgcgcgttacaaacattaccattttg CRISPR spacer
aaataaaat---gctcgttacaaacattacaattttc Protospacer
.*.* * ** *************** *****
363. spacer 16.29|4796034|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015587 (Roseomonas gilardii strain U14-5 plasmid 3, complete sequence) position: , mismatch: 9, identity: 0.735
atctgaggtggcagagatcaagacccggcacctt CRISPR spacer
atctgacgtggcagggatcaagaccaatgcggtt Protospacer
****** *******.********** . **
364. spacer 16.38|4796642|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to MN693448 (Marine virus AFVG_25M325, complete genome) position: , mismatch: 9, identity: 0.735
ctgttccgtatgaccccgagcaatttcacaatca CRISPR spacer
agtatagatatgaccacgagcaatttcaccatca Protospacer
* .******* ************* ****
365. spacer 17.5|4805758|33|NZ_CP022655|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049906 (Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
ggcttgatcgtcccgaaattgcgccgcctcttc CRISPR spacer
tgcttgttcttcccgaaattgcgccagtagtcc Protospacer
***** ** ***************. . *.*
366. spacer 17.33|4807636|34|NZ_CP022655|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.735
acattttcggcggtgacaccgtgacggagaagtt CRISPR spacer
gcggcttcagcggcgacaccgtgacggaggattg Protospacer
.*. .***.****.***************.* *
367. spacer 17.59|4809399|34|NZ_CP022655|CRT matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 9, identity: 0.735
aacatctatgtcaccgagggcggtgtgctaatga CRISPR spacer
cccaccgatgtcaccgagggcggtgtggccaagg Protospacer
**.* ******************** . * *.
368. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
369. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
370. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
371. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
372. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
373. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
374. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
375. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
376. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
377. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
378. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
379. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
380. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
381. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
382. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
383. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
384. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
385. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
386. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
387. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
388. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
389. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
390. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
391. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
392. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
393. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
394. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
395. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
396. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
397. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
398. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
399. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
400. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
401. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
402. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
403. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
404. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
405. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
406. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
407. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
408. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
409. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
410. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
411. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
412. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
413. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
414. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
415. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
416. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
417. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
418. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
419. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
420. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
catcggggcgctgctcggcgccggcggtatc Protospacer
..*** *************.***** *
421. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
catcggggcgctgctcggcgccggcggtatc Protospacer
..*** *************.***** *
422. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
catcggggcgctgctcggcgccggcggtatc Protospacer
..*** *************.***** *
423. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
catcggggcgctgctcggcgccggcggtatc Protospacer
..*** *************.***** *
424. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gggtaccgcgcggcgcggcgtcggcgcgcgc Protospacer
.* .. ***** ** **************
425. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to MF377440 (Mycobacterium phage Bella96, complete genome) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
tctcggcgcgcttctcggcctcggcggcacg Protospacer
.********* ****** ****** .*
426. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to JX182371 (Streptomyces phage SV1, complete genome) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
tctgggcgcgctgctcggcggcggcgagggc Protospacer
. **************** ***** *
427. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP015586 (Roseomonas gilardii strain U14-5 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcccggcgcgcagctcggcatcggcgaaggt Protospacer
. ********* *******.****** .
428. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to KY092482 (Streptomyces phage Mojorita, complete genome) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cctgggcgcgctgctcggcggcggcgagggc Protospacer
. **************** ***** *
429. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
ctcgatcgcgctgctcggcatcggcgcgacc Protospacer
* . *************.******** .
430. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
ccgcggcgcgctcctcggcgtcgccgccgat Protospacer
********* ********** ***
431. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcgcggcgacctgctcggcgtcggcgacgtc Protospacer
. ***** **************** *
432. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP033874 (Caulobacter sp. FWC26 plasmid p2) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
tcgcggcgtggtgctcggcgtcggcgaaaag Protospacer
*****.* *************** . *
433. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to AP018707 (Uncultured bacterium plasmid pSN1104-11 DNA, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gctcggcgtgctgctcggcctcggcggccat Protospacer
. .*****.********** ****** *
434. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to AP018708 (Uncultured bacterium plasmid pSN1104-34 DNA, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gctcggcgtgctgctcggcctcggcggccat Protospacer
. .*****.********** ****** *
435. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
cggcggctcgctgctcggcgccggcgtcacc Protospacer
* **** ************.*****. .
436. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP013419 (Burkholderia sp. MSMB0266 plasmid pMSMB0266, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gatcgtcgcgctgctcgacgtcggcgatcgc Protospacer
...** ***********.******** *
437. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
catgtccccgctgctcgccgtcgccgcgctg Protospacer
.. * ********* ***** *******
438. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gacgcgcgcgctgctcgacgccggcgcggcc Protospacer
..* ************.**.******* .
439. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to MT855965 (Microcystis phage vB_MaeS-yong1, complete genome) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gacgggcgcgctgctgggcgccggcgcaggt Protospacer
..* *********** ****.******.
440. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to MF140416 (Mycobacterium phage LastHope, complete genome) position: , mismatch: 9, identity: 0.71
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
tctcggcgcgcttctcggcctcggcggcacg Protospacer
.********* ****** ****** .*
441. spacer 16.30|4796101|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 10, identity: 0.706
agacattttcaacctgatcaacaacctggacttc CRISPR spacer
gctggttgagaacctggtcaacaacatggacttc Protospacer
. .** ******.******** ********
442. spacer 16.33|4796305|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024309 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3b, complete sequence) position: , mismatch: 10, identity: 0.706
cccggctggccggcttgtccacaagccggcgtaa CRISPR spacer
tgcggctcgccggcttgtcctcaagcacatctag Protospacer
. ***** ************ ***** .. **.
443. spacer 17.33|4807636|34|NZ_CP022655|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021374 (Rhizobium sp. ACO-34A plasmid pRACO34Ab, complete sequence) position: , mismatch: 10, identity: 0.706
acattttcggcggtgacaccgtgacggagaagtt CRISPR spacer
gacttttcgacggtgacaccctgacgggtaaccg Protospacer
. ******.********** ******. ** .
444. spacer 17.40|4808114|34|NZ_CP022655|PILER-CR,CRISPRCasFinder,CRT matches to NC_021229 (Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919) position: , mismatch: 10, identity: 0.706
aatacaggtgcctgctgataatgatcggatggct CRISPR spacer
accgggcgcccctgctgaccatgatcggatggct Protospacer
* .. . *. ********. **************
445. spacer 17.41|4808181|34|NZ_CP022655|PILER-CR,CRISPRCasFinder,CRT matches to MK448601 (Streptococcus satellite phage Javan653, complete genome) position: , mismatch: 10, identity: 0.706
tgctgtctttgtggtgatacgcttgttttctgca CRISPR spacer
caatttctttgttgtgatacgtttgttttgttat Protospacer
.. * ******* ********.******* *
446. spacer 17.42|4808248|34|NZ_CP022655|PILER-CR,CRISPRCasFinder,CRT matches to MK448601 (Streptococcus satellite phage Javan653, complete genome) position: , mismatch: 10, identity: 0.706
tgctgtctttgtggtgatacgcttgttttctgca CRISPR spacer
caatttctttgttgtgatacgtttgttttgttat Protospacer
.. * ******* ********.******* *
447. spacer 17.57|4809266|33|NZ_CP022655|CRISPRCasFinder,CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 10, identity: 0.697
gtttcgttgaccacgcgggcgggcagcgttaga CRISPR spacer
acgacgttcaccacgccggcgggcagcgccgca Protospacer
.. **** ******* ***********... *
448. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.677
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcacggcgcgctgctcggcatcgacgaatgc Protospacer
. ****************.***.** ..
449. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.677
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcacggcgcgctgctcggcatcgacgaatgc Protospacer
. ****************.***.** ..
450. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.677
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcacggcgcgctgctcggcatcgacgaatgc Protospacer
. ****************.***.** ..
451. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.677
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcacggcgcgctgctcggcatcgacgaatgc Protospacer
. ****************.***.** ..
452. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.677
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcacggcgcgctgctcggcatcgacgaatgc Protospacer
. ****************.***.** ..
453. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.677
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gttcggcgcgctgctcggcatcgacgaatgc Protospacer
. .****************.***.** ..
454. spacer 21.1|5229515|31|NZ_CP022655|CRISPRCasFinder matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 10, identity: 0.677
agccggcgcgctgctcggcgtcggcgcgctg CRISPR spacer
gcagggcgcgctcttcggcgtcggcgcctat Protospacer
. ******** .************* .
455. spacer 16.33|4796305|34|NZ_CP022655|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009431 (Sphingopyxis macrogoltabida strain 203 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676
cccggctggccggcttgtccacaagccggcgtaa CRISPR spacer
gagtgctggcccgcttgtccacaaaccgagcgga Protospacer
******* ************.***. .*
456. spacer 17.28|4807303|34|NZ_CP022655|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014659 (Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6a, complete sequence) position: , mismatch: 11, identity: 0.676
aagctcggcgacctgatcgtcacgacgcacatcc CRISPR spacer
gaggtcgtcgacctgatcgtcacgaatgaagagg Protospacer
.** *** ***************** * .
457. spacer 17.55|4809130|35|NZ_CP022655|CRISPRCasFinder,CRT matches to MG969411 (UNVERIFIED: Salmonella phage GE_vB_MG, complete genome) position: , mismatch: 11, identity: 0.686
cggctcgaaatgatctggacgagctcaagactacg CRISPR spacer
tacagagaaatgatcaggacgagctcaacacacag Protospacer
.. ********* ************ ** *
