Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP022564 Rhizobium leguminosarum bv. viciae strain BIHB 1148 chromosome, complete genome 3 crisprs csa3,cas3,WYL,DEDDh,PD-DExK,RT 0 5 5 0
NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 0 crisprs csa3,DEDDh 0 0 0 0
NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP022570 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK06, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 0 crisprs DEDDh,csa3 0 0 1 0
NZ_CP022568 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP022564
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022564_1 2090671-2090969 Orphan NA
5 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022564_2 2184310-2184403 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022564_3 2231657-2231738 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 228336-228363 2 0.929
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 578195-578222 3 0.893
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 928234-928261 3 0.893
NZ_CP022564_1 1.2|2090769|28|NZ_CP022564|CRT 2090769-2090796 28 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 687279-687306 5 0.821
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP014580 Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence 266140-266167 5 0.821
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 331462-331489 5 0.821
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1628534-1628561 5 0.821
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 KR053194 Gordonia phage GAL1, complete genome 12310-12337 5 0.821
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 1344539-1344566 5 0.821
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP032686 Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence 352880-352907 5 0.821
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP032687 Rhizobium sp. CCGE531 plasmid pRCCGE531b, complete sequence 408264-408291 5 0.821
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP032688 Rhizobium sp. CCGE531 plasmid pRCCGE531a, complete sequence 277920-277947 5 0.821
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 131555-131582 5 0.821
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 555220-555247 5 0.821
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 419517-419544 5 0.821
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 493390-493417 5 0.821
NZ_CP022564_1 1.2|2090769|28|NZ_CP022564|CRT 2090769-2090796 28 NZ_CP023450 Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p1, complete sequence 76509-76536 6 0.786
NZ_CP022564_1 1.2|2090769|28|NZ_CP022564|CRT 2090769-2090796 28 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 826491-826518 6 0.786
NZ_CP022564_1 1.2|2090769|28|NZ_CP022564|CRT 2090769-2090796 28 NZ_CP010956 Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence 74743-74770 6 0.786
NZ_CP022564_1 1.2|2090769|28|NZ_CP022564|CRT 2090769-2090796 28 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 986637-986664 6 0.786
NZ_CP022564_1 1.2|2090769|28|NZ_CP022564|CRT 2090769-2090796 28 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 257612-257639 6 0.786
NZ_CP022564_1 1.2|2090769|28|NZ_CP022564|CRT 2090769-2090796 28 MH155867 Gordonia phage Easley, complete genome 33589-33616 6 0.786
NZ_CP022564_1 1.2|2090769|28|NZ_CP022564|CRT 2090769-2090796 28 NC_008759 Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence 146216-146243 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 928360-928387 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 670995-671022 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 464832-464859 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 506702-506729 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1197100-1197127 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2343250-2343277 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 47048-47075 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 1458828-1458855 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 637815-637842 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 616437-616464 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 627937-627964 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 480685-480712 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 537273-537300 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 CP051288 Salmonella phage ST-29, complete genome 33429-33456 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 775790-775817 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1389704-1389731 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 25152-25179 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 741033-741060 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 MK373773 Escherichia phage vB_EcoP_KAW1A4500, complete genome 28033-28060 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 KY295899 Escherichia phage vB_EcoP_R, complete genome 42072-42099 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NC_047807 Escherichia phage vB_EcoP_C, complete genome 19204-19231 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 MK814759 Gordonia phage Reyja, complete genome 14349-14376 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 KY295891 Escherichia phage vB_EcoP_B, complete genome 38097-38124 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 KY435490 Escherichia virus K1E, complete genome 14545-14572 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 KY295893 Escherichia phage vB_EcoP_D, complete genome 40483-40510 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 AM084415 Enterobacteria phage K1E, complete genome 28973-29000 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 AY370674 Enterobacteria phage K1-5, complete genome 27402-27429 6 0.786
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NC_047889 Escherichia virus mutPK1A2, complete genome 27944-27971 6 0.786
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 132219-132250 6 0.812
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 457543-457574 6 0.812
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 281522-281553 6 0.812
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 975709-975740 6 0.812
NZ_CP022564_1 1.2|2090769|28|NZ_CP022564|CRT 2090769-2090796 28 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 62081-62108 7 0.75
NZ_CP022564_1 1.2|2090769|28|NZ_CP022564|CRT 2090769-2090796 28 CP000385 Mycobacterium sp. MCS Plasmid1, complete sequence 133331-133358 7 0.75
NZ_CP022564_1 1.2|2090769|28|NZ_CP022564|CRT 2090769-2090796 28 NC_008704 Mycobacterium sp. KMS plasmid pMKMS02, complete sequence 159390-159417 7 0.75
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 548263-548290 7 0.75
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 125147-125174 7 0.75
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 294839-294866 7 0.75
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 424988-425015 7 0.75
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NC_008759 Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence 146216-146243 7 0.75
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP030128 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence 308591-308618 7 0.75
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1393833-1393860 7 0.75
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 KY798216 Mycobacterium phage Journey13, complete genome 24096-24123 7 0.75
NZ_CP022564_1 1.4|2090868|28|NZ_CP022564|CRT 2090868-2090895 28 EF057797 Vibrio phage VP882, complete genome 18797-18824 7 0.75
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013553 Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence 132399-132430 7 0.781
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013586 Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence 137764-137795 7 0.781
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013538 Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence 126290-126321 7 0.781
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013564 Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence 132399-132430 7 0.781
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 667883-667914 7 0.781
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 619457-619488 7 0.781
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 339707-339738 7 0.781
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 353737-353768 7 0.781
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 126621-126652 7 0.781
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 570440-570471 7 0.781
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 499980-500011 7 0.781
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 536035-536066 7 0.781
NZ_CP022564_1 1.3|2090817|31|NZ_CP022564|CRT 2090817-2090847 31 NZ_CP016084 Streptomyces sp. SAT1 plasmid unnamed4, complete sequence 77472-77502 8 0.742
NZ_CP022564_1 1.3|2090817|31|NZ_CP022564|CRT 2090817-2090847 31 KM659091 Ochrobactrum sp. LM19 plasmid pLM19O1, complete sequence 57554-57584 8 0.742
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 291101-291132 8 0.75
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 151236-151267 8 0.75
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 451023-451054 8 0.75
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 460207-460238 8 0.75
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 423818-423849 8 0.75
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 53011-53042 8 0.75
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 9646-9677 8 0.75
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 53017-53048 8 0.75
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 76555-76586 8 0.75
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 352510-352541 8 0.75
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1063682-1063713 8 0.75
NZ_CP022564_1 1.3|2090817|31|NZ_CP022564|CRT 2090817-2090847 31 MN961670 Pseudomonas putida strain 420352 plasmid p420352-IMP, complete sequence 510733-510763 9 0.71
NZ_CP022564_1 1.3|2090817|31|NZ_CP022564|CRT 2090817-2090847 31 MK496050 Pseudomonas sp. strain FFUP_PS_41 plasmid pJBCL41, complete sequence 115819-115849 9 0.71
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 291160-291191 9 0.719
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 303924-303955 9 0.719
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 291101-291132 9 0.719
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 310557-310588 9 0.719
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 475014-475045 9 0.719
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 305521-305552 9 0.719
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 303924-303955 9 0.719
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 310557-310588 9 0.719
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 475014-475045 9 0.719
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 447906-447937 9 0.719
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 456505-456536 9 0.719
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 461813-461844 9 0.719
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 182049-182080 9 0.719
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 182049-182080 9 0.719
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 180490-180521 9 0.719
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 184737-184768 9 0.719
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 178855-178886 9 0.719
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 182049-182080 9 0.719
NZ_CP022564_1 1.5|2090916|34|NZ_CP022564|CRT 2090916-2090949 34 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 417458-417491 10 0.706
NZ_CP022564_1 1.5|2090916|34|NZ_CP022564|CRT 2090916-2090949 34 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 270600-270633 10 0.706
NZ_CP022564_1 1.5|2090916|34|NZ_CP022564|CRT 2090916-2090949 34 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 372940-372973 10 0.706
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 145522-145553 10 0.688
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 260576-260607 10 0.688
NZ_CP022564_3 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder 2231682-2231713 32 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 147170-147201 10 0.688
NZ_CP022564_1 1.5|2090916|34|NZ_CP022564|CRT 2090916-2090949 34 MH617568 Microviridae sp. isolate ctce955, complete genome 1506-1539 11 0.676

1. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 2, identity: 0.929

gtcggccggcggcggcacctccagcagc	CRISPR spacer
gtcggccggcggcggcacccccagcggc	Protospacer
*******************.*****.**

2. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

gtcggccggcggcggcacctccagcagc	CRISPR spacer
ctcggccggcggcggcaccaccagcaac	Protospacer
 ****************** ******.*

3. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 3, identity: 0.893

gtcggccggcggcggcacctccagcagc	CRISPR spacer
ctctgccggcggcggcacgtccagcagc	Protospacer
 ** ************** *********

4. spacer 1.2|2090769|28|NZ_CP022564|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 5, identity: 0.821

atcggccggtggcggcacttcgagcagc	CRISPR spacer
cttgggcggtggcggcacttcgcgcagg	Protospacer
 *.** **************** **** 

5. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 5, identity: 0.821

gtcggccggcggcggcacctccagcagc	CRISPR spacer
gtaggccggcgccggcacctccagcgcg	Protospacer
** ******** *************.  

6. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 5, identity: 0.821

gtcggccggcggcggcacctccagcagc	CRISPR spacer
gtcggccagcagcggcacctccaccgcc	Protospacer
*******.**.************ *. *

7. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 5, identity: 0.821

gtcggccggcggcggcacctccagcagc	CRISPR spacer
gagcgccggcggcggaacgtccagcagc	Protospacer
*   *********** ** *********

8. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to KR053194 (Gordonia phage GAL1, complete genome) position: , mismatch: 5, identity: 0.821

gtcggc-cggcggcggcacctccagcagc	CRISPR spacer
-ccaacgcggcggcggcaccaccagcagc	Protospacer
 .*..* ************* ********

9. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 5, identity: 0.821

gtcgg--ccggcggcggcacctccagcagc	CRISPR spacer
--cgatcccggcggcgtcacctccagctgc	Protospacer
  **.  ********* ********** **

10. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 5, identity: 0.821

gtcgg--ccggcggcggcacctccagcagc	CRISPR spacer
--cgatcccggcggcgtcacctccagctgc	Protospacer
  **.  ********* ********** **

11. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP032687 (Rhizobium sp. CCGE531 plasmid pRCCGE531b, complete sequence) position: , mismatch: 5, identity: 0.821

gtcgg--ccggcggcggcacctccagcagc	CRISPR spacer
--cgatcccggcggcgtcacctccagctgc	Protospacer
  **.  ********* ********** **

12. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP032688 (Rhizobium sp. CCGE531 plasmid pRCCGE531a, complete sequence) position: , mismatch: 5, identity: 0.821

gtcgg--ccggcggcggcacctccagcagc	CRISPR spacer
--cgatcccggcggcgtcacctccagctgc	Protospacer
  **.  ********* ********** **

13. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 5, identity: 0.821

gtcggccggcggcggcacctccagcagc	CRISPR spacer
gtcggccagcagcggcacctccaccgcc	Protospacer
*******.**.************ *. *

14. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.821

gtcggccggcggcggcacctccagcagc	CRISPR spacer
gtcggccagcagcggcacctccaccgcc	Protospacer
*******.**.************ *. *

15. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.821

gtcggccggcggcggcacctccagcagc	CRISPR spacer
gtcggccagcagcggcacctccaccgcc	Protospacer
*******.**.************ *. *

16. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 5, identity: 0.821

gtcggccggcggcggcacctccagcagc	CRISPR spacer
gtcggccagcagcggcacctccaccgcc	Protospacer
*******.**.************ *. *

17. spacer 1.2|2090769|28|NZ_CP022564|CRT matches to NZ_CP023450 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.786

atcggccggtggcggcacttcgagcagc	CRISPR spacer
ctcggccggtggcggcgcttcgatcgag	Protospacer
 ***************.****** *.. 

18. spacer 1.2|2090769|28|NZ_CP022564|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 6, identity: 0.786

atcggccggtggcggcacttcgagcagc	CRISPR spacer
cccggccggtggcagcacgtcgagcacg	Protospacer
 .***********.**** *******  

19. spacer 1.2|2090769|28|NZ_CP022564|CRT matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 6, identity: 0.786

atcggccggtggcggcacttcgagcagc	CRISPR spacer
ctcggccggtggcggcgcttcgatcgag	Protospacer
 ***************.****** *.. 

20. spacer 1.2|2090769|28|NZ_CP022564|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 6, identity: 0.786

atcggccggtggcggcacttcgagcagc	CRISPR spacer
cccggccggtggcagcacgtcgagcacg	Protospacer
 .***********.**** *******  

21. spacer 1.2|2090769|28|NZ_CP022564|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 6, identity: 0.786

atcggccggtggcggcacttcgagcagc	CRISPR spacer
ctcggccggtggcggcacctcggtgcgc	Protospacer
 *****************.***.   **

22. spacer 1.2|2090769|28|NZ_CP022564|CRT matches to MH155867 (Gordonia phage Easley, complete genome) position: , mismatch: 6, identity: 0.786

atcggccggtggcggcacttcgagcagc	CRISPR spacer
gtcggccggtggcggcgcttcgccgagg	Protospacer
.***************.*****   ** 

23. spacer 1.2|2090769|28|NZ_CP022564|CRT matches to NC_008759 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence) position: , mismatch: 6, identity: 0.786

atcggccggtggcggcacttcgagcagc	CRISPR spacer
acaggccggcggcggcacttcaagcatg	Protospacer
*. ******.***********.****  

24. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cagcgccggcggcggtacgtccagcagc	Protospacer
    ***********.** *********

25. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cagcgccggcggcgggacctcaagcagc	Protospacer
    *********** ***** ******

26. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cgtgcccggcggcggcacctccagcgac	Protospacer
  .* ********************..*

27. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
ttcggccggcggcggcgtctccagcccg	Protospacer
 ***************..*******   

28. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
gcgtaccggcggcggcaactccagcaga	Protospacer
*.  .************ ********* 

29. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
ttcggccggcggcggcacctgcggcgtg	Protospacer
 ******************* *.**.  

30. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
ccgagccggcgcgggcacctccagcagc	Protospacer
 . .*******  ***************

31. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cagcgccggcggcggaacgtccagcagc	Protospacer
    *********** ** *********

32. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
ttcggccggcggcggcgcctgcagcgcg	Protospacer
 ***************.*** ****.  

33. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
gcgtaccggcggcggcaactccagcaga	Protospacer
*.  .************ ********* 

34. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cgtgcccggcggcggcacctccagcgac	Protospacer
  .* ********************..*

35. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cgtgcccggcggcggcacctccagcgac	Protospacer
  .* ********************..*

36. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cgtgcccggcggcggcacctccagcgac	Protospacer
  .* ********************..*

37. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to CP051288 (Salmonella phage ST-29, complete genome) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
gtcggcccgcggcggcaccgccaggttg	Protospacer
******* *********** ****    

38. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
gtcggccagcagcggcacctccaccgcg	Protospacer
*******.**.************ *.  

39. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
ttaccctggcggcggcgcctccagcagc	Protospacer
 *   *.*********.***********

40. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cccggccagcggcggcacctcccgcccc	Protospacer
 .*****.************** **  *

41. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
gaaatccgccggcggcaccgccagcagc	Protospacer
*  . *** ********** ********

42. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to MK373773 (Escherichia phage vB_EcoP_KAW1A4500, complete genome) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cgccacctgcggcagcacctccagcagc	Protospacer
  * .** *****.**************

43. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to KY295899 (Escherichia phage vB_EcoP_R, complete genome) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cgccacctgcggcagcacctccagcagc	Protospacer
  * .** *****.**************

44. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NC_047807 (Escherichia phage vB_EcoP_C, complete genome) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cgccacctgcggcagcacctccagcagc	Protospacer
  * .** *****.**************

45. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
gacggccggcggtggcacctccacggcc	Protospacer
* **********.**********  . *

46. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to KY295891 (Escherichia phage vB_EcoP_B, complete genome) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cgccacctgcggcagcacctccagcagc	Protospacer
  * .** *****.**************

47. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to KY435490 (Escherichia virus K1E, complete genome) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cgccacctgcggcagcacctccagcagc	Protospacer
  * .** *****.**************

48. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to KY295893 (Escherichia phage vB_EcoP_D, complete genome) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cgccacctgcggcagcacctccagcagc	Protospacer
  * .** *****.**************

49. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to AM084415 (Enterobacteria phage K1E, complete genome) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cgccacctgcggcagcacctccagcagc	Protospacer
  * .** *****.**************

50. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to AY370674 (Enterobacteria phage K1-5, complete genome) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cgccacctgcggcagcacctccagcagc	Protospacer
  * .** *****.**************

51. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NC_047889 (Escherichia virus mutPK1A2, complete genome) position: , mismatch: 6, identity: 0.786

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cgccacctgcggcagcacctccagcagc	Protospacer
  * .** *****.**************

52. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 6, identity: 0.812

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacacttccgggcgacatgcattggtatgg	Protospacer
* **************.******** **   *

53. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 6, identity: 0.812

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacacttccgggcgacatgcattagtcggc	Protospacer
* **************.******** **.*  

54. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 6, identity: 0.812

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacacttccgggcgacatgcattattgctg	Protospacer
* **************.********  *  **

55. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 6, identity: 0.812

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacacttccgggcgacatgcattattgctg	Protospacer
* **************.********  *  **

56. spacer 1.2|2090769|28|NZ_CP022564|CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 7, identity: 0.75

atcggccggtggcggcacttcgagcagc	CRISPR spacer
ggcggccggtggtggcacttcgagaccg	Protospacer
. **********.***********    

57. spacer 1.2|2090769|28|NZ_CP022564|CRT matches to CP000385 (Mycobacterium sp. MCS Plasmid1, complete sequence) position: , mismatch: 7, identity: 0.75

atcggccggtggcggcacttcgagcagc	CRISPR spacer
gcgcgccggcggcggctcttcgagcaga	Protospacer
..  *****.****** ********** 

58. spacer 1.2|2090769|28|NZ_CP022564|CRT matches to NC_008704 (Mycobacterium sp. KMS plasmid pMKMS02, complete sequence) position: , mismatch: 7, identity: 0.75

atcggccggtggcggcacttcgagcagc	CRISPR spacer
gcgcgccggcggcggctcttcgagcaga	Protospacer
..  *****.****** ********** 

59. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.75

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cgtgcccggcggcggcacctccagcgat	Protospacer
  .* ********************...

60. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 7, identity: 0.75

gtcggccggcggcggcacctccagcagc	CRISPR spacer
gagttccggcggcggcgcctccagcacg	Protospacer
*    ***********.*********  

61. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 7, identity: 0.75

gtcggccggcggcggcacctccagcagc	CRISPR spacer
cctcaccggcggcggcacgtccggcagc	Protospacer
 .. .************* ***.*****

62. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.75

gtcggccggcggcggcacctccagcagc	CRISPR spacer
gtcggccgtcggcggcacctcggcgttc	Protospacer
******** ************ .    *

63. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NC_008759 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence) position: , mismatch: 7, identity: 0.75

gtcggccggcggcggcacctccagcagc	CRISPR spacer
acaggccggcggcggcacttcaagcatg	Protospacer
.. ***************.** ****  

64. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP030128 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.75

gtcggccggcggcggcacctccagcagc	CRISPR spacer
agcggccggcgcctgcacctccagcctg	Protospacer
. ********* * ***********   

65. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

gtcggccggcggcggcacctccagcagc	CRISPR spacer
gtcggccagcggcggcacctcggtctcg	Protospacer
*******.************* . *   

66. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to KY798216 (Mycobacterium phage Journey13, complete genome) position: , mismatch: 7, identity: 0.75

gtcggccggcggcggcacctccagcagc	CRISPR spacer
ccttaccggcggcggcacccccggcagc	Protospacer
 .. .**************.**.*****

67. spacer 1.4|2090868|28|NZ_CP022564|CRT matches to EF057797 (Vibrio phage VP882, complete genome) position: , mismatch: 7, identity: 0.75

gtcggccggcggcggcacctccagcagc	CRISPR spacer
ccgcaccggcagcggcacctgcagcagc	Protospacer
 .  .*****.********* *******

68. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 7, identity: 0.781

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacacttccgggcgacatgcattggtccga	Protospacer
* **************.******** **.  .

69. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013586 (Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence) position: , mismatch: 7, identity: 0.781

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacacttccgggcgacatgcattggtccga	Protospacer
* **************.******** **.  .

70. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013538 (Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence) position: , mismatch: 7, identity: 0.781

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacacttccgggcgacatgcattagtccga	Protospacer
* **************.******** **.  .

71. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 7, identity: 0.781

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacacttccgggcgacatgcattggtccga	Protospacer
* **************.******** **.  .

72. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 7, identity: 0.781

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacacttccgggcgacatgcattagaggat	Protospacer
* **************.******** *  *  

73. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.781

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacacttccgggcgacatgcattagaggat	Protospacer
* **************.******** *  *  

74. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.781

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tacacacttccgggcgacatgcattgagcggg	Protospacer
* **************.******** . .* *

75. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.781

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tacacacttccgggcgacatgcattaagcgcg	Protospacer
* **************.******** . .*.*

76. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacacttccgggcgacatgcattaggcgcc	Protospacer
* **************.******** * .*. 

77. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 7, identity: 0.781

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacacttccgggcgacatgcattagaggat	Protospacer
* **************.******** *  *  

78. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.781

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacatttccgggcgacatgcattaggtcag	Protospacer
* ****.*********.******** * *  *

79. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 7, identity: 0.781

ttcacacttccgggcggcatgcatttgttgtg-	CRISPR spacer
tgcacacttttgggcggcatgcattag-agcgc	Protospacer
* *******..************** *  *.* 

80. spacer 1.3|2090817|31|NZ_CP022564|CRT matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.742

tgctgcgggctccggctcggggtctgcttcg	CRISPR spacer
cgtcccgggcttcggctcggcgtctgctggg	Protospacer
.*.. ******.******** *******  *

81. spacer 1.3|2090817|31|NZ_CP022564|CRT matches to KM659091 (Ochrobactrum sp. LM19 plasmid pLM19O1, complete sequence) position: , mismatch: 8, identity: 0.742

tgctgcgggctccggctcggggtctgcttcg	CRISPR spacer
cggctccggctccggctccgggtctggttcc	Protospacer
.* . * *********** ******* *** 

82. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 8, identity: 0.75

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacacttccgggcggcatgcattaacaagc	Protospacer
* *********************** .. .  

83. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 8, identity: 0.75

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacacttccgggcgacatgcattaggcact	Protospacer
* **************.******** * ... 

84. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 8, identity: 0.75

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacacttccgggcgacatgcgttagaggat	Protospacer
* **************.*****.** *  *  

85. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacacttccgggcgacatgcattagagaat	Protospacer
* **************.******** *  .  

86. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 8, identity: 0.75

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacacttccgggcgacatgcgttagaggat	Protospacer
* **************.*****.** *  *  

87. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.75

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacactttcgggcgacatgcattaggcggt	Protospacer
* *******.******.******** * .*  

88. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.75

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacacttccgggcgacgtgcattagcgcgg	Protospacer
* **************.*.****** *.   *

89. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.75

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacactttcgggcgacatgcattaggcggt	Protospacer
* *******.******.******** * .*  

90. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.75

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacactttcgggcgacatgcattaggcggt	Protospacer
* *******.******.******** * .*  

91. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.75

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacactttcgggcgacatgcattagccgaa	Protospacer
* *******.******.******** *..* .

92. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.75

ttcacacttccgggcggcatgcatt-tgttgtg	CRISPR spacer
tgcacactttctggcggcatgcattaagccgc-	Protospacer
* *******.* *************  *..*. 

93. spacer 1.3|2090817|31|NZ_CP022564|CRT matches to MN961670 (Pseudomonas putida strain 420352 plasmid p420352-IMP, complete sequence) position: , mismatch: 9, identity: 0.71

tgctgcgggctccggctcggggtctgcttcg	CRISPR spacer
tgctgctggcttcggctcggggtgccgggca	Protospacer
****** ****.*********** .    *.

94. spacer 1.3|2090817|31|NZ_CP022564|CRT matches to MK496050 (Pseudomonas sp. strain FFUP_PS_41 plasmid pJBCL41, complete sequence) position: , mismatch: 9, identity: 0.71

tgctgcgggctccggctcggggtctgcttcg	CRISPR spacer
tgctgctggcttcggctcggggtgccgggca	Protospacer
****** ****.*********** .    *.

95. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacagttccgggcggcatgcattaacaagc	Protospacer
* **** ****************** .. .  

96. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacagttccgggcggcatgcattaacaagc	Protospacer
* **** ****************** .. .  

97. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacagttccgggcggcatgcattaacaagc	Protospacer
* **** ****************** .. .  

98. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacagttccgggcggcatgcattaacaagc	Protospacer
* **** ****************** .. .  

99. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
ttcacacttccaggcgacatgcatcggagcat	Protospacer
***********.****.*******. *     

100. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacagttccgggcggcatgcattaacaagc	Protospacer
* **** ****************** .. .  

101. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacagttccgggcggcatgcattaacaagc	Protospacer
* **** ****************** .. .  

102. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacagttccgggcggcatgcattaacaagc	Protospacer
* **** ****************** .. .  

103. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
ttcacacttccaggcgacatgcatcggagcat	Protospacer
***********.****.*******. *     

104. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
ttcacacttccaggcgacatgcatcggagcat	Protospacer
***********.****.*******. *     

105. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
ttcacacttccaggcgacatgcatcggagcat	Protospacer
***********.****.*******. *     

106. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
ttcacacttccaggcgacatgcatcggagcat	Protospacer
***********.****.*******. *     

107. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
ttcagacttccggacggcatgcacctaaaggc	Protospacer
**** ********.*********..*.  *  

108. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
ttcagacttccggacggcatgcacctaaaggc	Protospacer
**** ********.*********..*.  *  

109. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
ttcagacttccggacggcatgcacctaaaggc	Protospacer
**** ********.*********..*.  *  

110. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
ttcagacttccggacggcatgcacctaaaggc	Protospacer
**** ********.*********..*.  *  

111. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
ttcagacttccggacggcatgcacctaaaggc	Protospacer
**** ********.*********..*.  *  

112. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
ttcagacttccggacggcatgcacctaaaggc	Protospacer
**** ********.*********..*.  *  

113. spacer 1.5|2090916|34|NZ_CP022564|CRT matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 10, identity: 0.706

cgccgcagggtcgggcgacgcgaactcggcctcc	CRISPR spacer
aagcttcaggtcgcgcgccgcgaactcggcctcg	Protospacer
 . * . .***** *** *************** 

114. spacer 1.5|2090916|34|NZ_CP022564|CRT matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 10, identity: 0.706

cgccgcagggtcgggcgacgcgaactcggcctcc	CRISPR spacer
aagcttcaggtcgcgcgccgcgaactcggcctcg	Protospacer
 . * . .***** *** *************** 

115. spacer 1.5|2090916|34|NZ_CP022564|CRT matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 10, identity: 0.706

cgccgcagggtcgggcgacgcgaactcggcctcc	CRISPR spacer
aagcttcaggtcgcgcgccgcgaactcggcctcg	Protospacer
 . * . .***** *** *************** 

116. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 10, identity: 0.688

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tctttgtttccgggcggcatgcatcagttgat	Protospacer
*.. ...*****************. ****  

117. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 10, identity: 0.688

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tctttgtttccgggcggcatgcatcagttgat	Protospacer
*.. ...*****************. ****  

118. spacer 3.1|2231682|32|NZ_CP022564|CRISPRCasFinder matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 10, identity: 0.688

ttcacacttccgggcggcatgcatttgttgtg	CRISPR spacer
tgcacgcttccgggcgacatgcattaagcact	Protospacer
* ***.**********.******** . ... 

119. spacer 1.5|2090916|34|NZ_CP022564|CRT matches to MH617568 (Microviridae sp. isolate ctce955, complete genome) position: , mismatch: 11, identity: 0.676

cgccgcagggtcgggcgacgcgaactcggcctcc	CRISPR spacer
cgcggcagggtcgggccacgcgaaaagatcgcgt	Protospacer
*** ************ *******   . * . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 829656 : 839900 9 uncultured_Mediterranean_phage(83.33%) NA NA
DBSCAN-SWA_2 1102733 : 1229187 125 uncultured_Mediterranean_phage(25.64%) portal,protease,transposase,capsid,terminase,integrase,head,tail,tRNA attL 1136000:1136021|attR 1180384:1180405
DBSCAN-SWA_3 1449002 : 1459878 7 Cyanophage(16.67%) protease NA
DBSCAN-SWA_4 1522266 : 1531574 9 Acanthamoeba_polyphaga_mimivirus(14.29%) NA NA
DBSCAN-SWA_5 3719022 : 3729024 9 Streptococcus_phage(12.5%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP022567
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 124063 : 137523 10 Vibrio_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage