Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP022225 Mycobacterium chimaera strain SJ42 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP022224 Mycobacterium chimaera strain SJ42 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP022223 Mycobacterium chimaera strain SJ42 chromosome, complete genome 8 crisprs DEDDh,cas3,RT,csa3,DinG,cas4,WYL,c2c9_V-U4,Cas9_archaeal 1 0 4 0

Results visualization

1. NZ_CP022223
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022223_1 1387483-1387561 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022223_2 2371216-2371329 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022223_3 2997876-2997972 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022223_4 3784069-3784177 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022223_5 3790355-3790470 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022223_6 3964523-3964691 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022223_7 4160512-4160608 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP022223_8 4716359-4716492 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_CP022223_4 4.1|3784107|33|NZ_CP022223|CRISPRCasFinder 3784107-3784139 33 NZ_CP022223.1 3784179-3784211 2 0.939

1. spacer 4.1|3784107|33|NZ_CP022223|CRISPRCasFinder matches to position: 3784179-3784211, mismatch: 2, identity: 0.939

gcctcggtggggttgcccttactaggcgtggtg	CRISPR spacer
gcctcggtggggttgcccttactcgccgtggtg	Protospacer
*********************** * *******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1736433 : 1815264 51 Tupanvirus(44.44%) integrase,transposase attL 1734307:1734366|attR 1786967:1789093
DBSCAN-SWA_2 2370076 : 2405727 28 Enterobacteria_phage(100.0%) holin,transposase NA
DBSCAN-SWA_3 4440382 : 4446958 7 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_4 5006455 : 5016494 9 Burkholderia_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage